ID: 932117984

View in Genome Browser
Species Human (GRCh38)
Location 2:69070423-69070445
Sequence AAGGGGAAAGACTCTTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932117984_932117989 10 Left 932117984 2:69070423-69070445 CCTGCAGAAGAGTCTTTCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 151
Right 932117989 2:69070456-69070478 ATCTCACTCATCCTGTGTTATGG 0: 1
1: 0
2: 3
3: 18
4: 153
932117984_932117991 24 Left 932117984 2:69070423-69070445 CCTGCAGAAGAGTCTTTCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 151
Right 932117991 2:69070470-69070492 GTGTTATGGTTGACCCTGAACGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932117984 Original CRISPR AAGGGGAAAGACTCTTCTGC AGG (reversed) Intronic
901759330 1:11460482-11460504 ATGGGTAAAGACCCTTGTGCAGG - Intergenic
904374382 1:30070889-30070911 AAGGGAAGAGAGTCTTCTGCAGG - Intergenic
905617497 1:39411294-39411316 CAGGGAAAAGACTTTTCTGATGG + Exonic
907678287 1:56538867-56538889 AAGGGGAAGGAGCCTGCTGCTGG + Intronic
908021392 1:59901969-59901991 CAGGGCAAAGACTCTTCACCTGG + Intronic
909572941 1:77138297-77138319 AATAGGAGAGACTCTACTGCAGG + Intronic
909760236 1:79277273-79277295 AAGGGAAGAGACACCTCTGCAGG - Intergenic
918493285 1:185106347-185106369 AAGGGGGAAGAATTTGCTGCCGG + Intergenic
918930105 1:190843937-190843959 AAGGGGTACGACTCTTCTGAGGG - Intergenic
919147174 1:193650878-193650900 ATGGGGAGAGACTCCTCTGCTGG - Intergenic
920242901 1:204566564-204566586 ATGGGGAAAGAGTTTTCTCCTGG - Intergenic
923655738 1:235914985-235915007 AAGGGGCAGGACTCTTGTGATGG + Intergenic
923668266 1:236017829-236017851 AATGGGAAAGACTCGTGTTCAGG - Intronic
1069062251 10:63906375-63906397 AGGGGGAAAGAGTCTGCTGATGG + Intergenic
1073299194 10:102460583-102460605 AAGAGGAAAGACTCTTGTTATGG + Intergenic
1075009067 10:118852609-118852631 AAGGGGAGAGATTCTTCTGTAGG + Intergenic
1075793703 10:125103878-125103900 AGGGGGAGAGGCTCTTCAGCAGG - Intronic
1078388565 11:10914962-10914984 AAGGGGTAAGTCCCTTCTGAAGG + Intergenic
1081189789 11:40089372-40089394 AAGCTGAAAGACTCCTCTGCGGG + Intergenic
1081745263 11:45468432-45468454 AAGCGGAAACACGCTGCTGCAGG + Intergenic
1085245960 11:75100543-75100565 AATAGGGAAGTCTCTTCTGCAGG - Intronic
1086158436 11:83694227-83694249 AAGGTAAATGGCTCTTCTGCTGG + Intronic
1086214011 11:84355440-84355462 AAGGGGAAAGGCACTTCTCTGGG - Intronic
1086588149 11:88480131-88480153 AAAGGGCAAGAGTCTTCTCCAGG - Intergenic
1088827603 11:113508812-113508834 AAGGAGCAAGTCTCTCCTGCTGG - Intergenic
1089776447 11:120840170-120840192 ATGGAGAGAGACACTTCTGCAGG + Intronic
1091783631 12:3229496-3229518 AAGGGGAAAGCCTCTGATCCTGG - Intronic
1097246212 12:57609200-57609222 GAGGAGAAAGAGGCTTCTGCTGG - Exonic
1100001933 12:89847814-89847836 AAGGGGATAGATTCTTCTTTGGG - Intergenic
1107754101 13:43600428-43600450 ATGAGGAGAGACTCCTCTGCTGG + Intronic
1107776582 13:43850133-43850155 AGGGGGAAAGACTAGTCTGTAGG - Intronic
1107832514 13:44386903-44386925 AAGGGCAAAGTCTCTTATGAGGG - Intronic
1109134532 13:58630272-58630294 GATGGGAAAGAGTTTTCTGCTGG + Intergenic
1111250445 13:85594609-85594631 AAGGGGCAAGAATCCTGTGCTGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1111949722 13:94701287-94701309 GAGGAGAAAGACCTTTCTGCTGG - Intergenic
1112406206 13:99123045-99123067 AAGGAGAAAGACATTTCTGCTGG + Intergenic
1113053364 13:106239035-106239057 ATGGTGAGAGTCTCTTCTGCTGG - Intergenic
1114149533 14:20021839-20021861 AAGGAGGAAGCCACTTCTGCTGG - Intergenic
1118132952 14:62988079-62988101 AATGGGAAAGAATTTTCTTCTGG + Intronic
1122331148 14:100914903-100914925 AAGGGGAAAGCCTGTATTGCAGG - Intergenic
1128682725 15:69663350-69663372 AAGGGAAAAGACTGTTCACCTGG + Intergenic
1129503862 15:76064621-76064643 AAGGGGAAATCCTCTCCTGGCGG - Intronic
1131621230 15:94070508-94070530 AAGGGGAATGACTCACCCGCCGG + Intergenic
1137700395 16:50493858-50493880 TTGGGGAAAGACTCTTTTTCTGG - Intergenic
1138826909 16:60331938-60331960 ATGGGGACAGACACTTCTTCAGG + Intergenic
1138943291 16:61816130-61816152 TAGAGGTTAGACTCTTCTGCAGG + Intronic
1141315180 16:82955829-82955851 AAGTGGAAAACCTCTTCTCCAGG + Intronic
1141577141 16:84971340-84971362 ATGGGGAAAGAATTTTCTGTAGG + Intergenic
1145291566 17:21550947-21550969 AAGGCTAGAAACTCTTCTGCTGG - Intronic
1146678312 17:34789138-34789160 TAGGGGAAAGAAGCTTCTGGAGG + Intergenic
1148753444 17:49959450-49959472 ACTGGGAAAGACACTTGTGCAGG + Intergenic
1150580984 17:66473508-66473530 AATGGGAAAGGCTGTTCTGAGGG - Intronic
1150619117 17:66795968-66795990 AAGGGAAAACTCTCTTCTGGAGG - Intronic
1152509404 17:80775155-80775177 GATGGGAAAGCCTTTTCTGCAGG + Intronic
1155345600 18:24853633-24853655 AAGGGCACAGACTCATCTGAGGG - Intergenic
1157136503 18:45062084-45062106 AAGGAGAAAGAATGATCTGCAGG + Intronic
1157277912 18:46325228-46325250 CAGGGAAAAGAATGTTCTGCAGG - Intergenic
1157782082 18:50448529-50448551 TGGGGCACAGACTCTTCTGCTGG + Intergenic
1158625011 18:59063380-59063402 AATGGAAAAGAATCTTCTCCAGG + Intergenic
1160592061 18:79950670-79950692 AAGGAGAAACCCTCTTCTCCGGG + Intronic
1164127930 19:22335500-22335522 AAGGGGAAACAGTCTTCAGAAGG - Intergenic
1164171566 19:22729894-22729916 AAGGGGAAACAGTCTTCAGAAGG + Intergenic
1164243045 19:23407102-23407124 CAGGTGATAGATTCTTCTGCTGG - Intergenic
1164473496 19:28554975-28554997 GAGGGGAAAGCCTGTCCTGCCGG - Intergenic
1165402141 19:35608267-35608289 AAGTGGAAAGACCCTGATGCTGG - Intergenic
1167573337 19:50304714-50304736 AAGGTGAAAGACTCATGAGCTGG + Intronic
1167984878 19:53306319-53306341 GAGGGGAAGGTCCCTTCTGCTGG + Intergenic
925734278 2:6947725-6947747 AAAGGGACAGCCTCTGCTGCAGG + Intronic
927628947 2:24754028-24754050 AAAGAGAAAGACTTTTCTTCTGG - Intronic
928654931 2:33440677-33440699 AAGGGGAAAAACGATTCTGGAGG - Intronic
932117984 2:69070423-69070445 AAGGGGAAAGACTCTTCTGCAGG - Intronic
932733207 2:74235034-74235056 GAGGGGAAAGAATCTGCAGCTGG + Intronic
932805619 2:74780278-74780300 AAGGGGAAACACTTTTCACCTGG + Intergenic
934110191 2:88735076-88735098 AAGGTGAAATCCTGTTCTGCTGG + Intronic
936660343 2:114536255-114536277 AAGGGAAAAGATTCATCTGTTGG - Intronic
937011674 2:118568541-118568563 AGGGAGAAAGACTATTCTTCAGG - Intergenic
940021209 2:149157698-149157720 AAGGGGAGAGGCTCCACTGCTGG - Intronic
946035612 2:216740024-216740046 AAGGGGAAAGACACATGAGCAGG - Intergenic
947348228 2:229216033-229216055 AGGGGGACATCCTCTTCTGCAGG - Intronic
948539290 2:238675517-238675539 AAGGGGAATGACATTTCTGGTGG - Intergenic
1170141763 20:13131995-13132017 AAGTGCAAAGACCCTTCTGTGGG - Intronic
1170679622 20:18514393-18514415 ATGGGGCTAGAGTCTTCTGCTGG + Intronic
1170800625 20:19587070-19587092 ACAGCGACAGACTCTTCTGCTGG - Intronic
1171032654 20:21691338-21691360 AAGTGGAAAGGCTCATCTGGTGG + Intergenic
1172034170 20:32000133-32000155 AAGGGCTGAGACTCTTCTGAGGG - Exonic
1172065406 20:32216388-32216410 AACAGGAAAGACTCTCCTGCTGG + Intronic
1173227403 20:41169965-41169987 GAGGGGAAGGACTACTCTGCTGG - Intronic
1174766779 20:53262032-53262054 ATGGAGAAAGACTTCTCTGCAGG - Intronic
1180755800 22:18160264-18160286 AAGAGGTAAGACTGTTCTTCAGG + Exonic
1181075976 22:20377137-20377159 AAGAGGTAAGACTGTTCTTCAGG - Exonic
1181882430 22:25991714-25991736 AAGAGTAAAGACTCACCTGCTGG + Intronic
1182324743 22:29504035-29504057 AAAGGGAAAATCTCTTCTGGAGG + Intergenic
1182440659 22:30362117-30362139 AAGGGGAAAGCCCCATCTTCTGG + Intronic
1184605096 22:45568383-45568405 TAGGGGAATGCCTCTTCTGTAGG + Intronic
1184605115 22:45568478-45568500 TAGGGGAATGCCTCTTCTGTAGG + Intronic
1184605123 22:45568516-45568538 TAGGGGAATGCCTCTTCTGTAGG + Intronic
1184605150 22:45568664-45568686 TAGGGGAATGCCTCTTCTGTAGG + Intronic
949454907 3:4228038-4228060 AATGGGAAAGAGTTTCCTGCAGG + Intronic
950941402 3:16896807-16896829 AAGGGGAAATAATCTTCAGATGG + Intronic
952336177 3:32404938-32404960 AAAGGGAGAGAGTCTCCTGCTGG + Intronic
953583984 3:44183163-44183185 ATGGGGAAAGATTCTGCTGTGGG + Intergenic
954649306 3:52150471-52150493 AAGGGGCAAGCCTCCTCTGCAGG + Intronic
954957165 3:54531470-54531492 AAGGGGAAAAAATCTTCTGAGGG - Intronic
956287230 3:67623583-67623605 AAGGGGAAAAAATCTTGTTCTGG + Intronic
957492019 3:80939825-80939847 AAGGGGAGAGAATCAACTGCGGG + Intergenic
959761216 3:109967622-109967644 AAAGGTAAAGATTCTTCTCCTGG + Intergenic
962009914 3:131382392-131382414 AGGGGCAAAGACTTTTCTCCAGG - Exonic
966065717 3:175819084-175819106 AAGGGGAAAGACACAGCTGTAGG - Intergenic
966600025 3:181765781-181765803 GAGGGGAAAGACTTATTTGCTGG - Intergenic
966624454 3:182001237-182001259 AAAGGAAAAGACTCATCTCCAGG + Intergenic
967606628 3:191454768-191454790 AATAGGGAAGAGTCTTCTGCTGG - Intergenic
969954387 4:10873400-10873422 AAAGGGAGAGATTCTCCTGCTGG - Intergenic
970158430 4:13165056-13165078 AACGCCAAAGACTGTTCTGCAGG - Intergenic
972615463 4:40694093-40694115 AAGTGAAAAGACTCCACTGCAGG + Intergenic
972838494 4:42903906-42903928 AGAGGCAAAGACTCTTATGCAGG - Intronic
974518401 4:62946367-62946389 AAGTGGAATTACTTTTCTGCTGG + Intergenic
979805314 4:124962949-124962971 AAGGGAAGGGACTGTTCTGCTGG - Intergenic
980159313 4:129139950-129139972 AAGTGGAAAGAATGTTCTCCAGG - Intergenic
980410728 4:132414665-132414687 AAGGGGCAAGACCCTTTTCCAGG + Intergenic
982492564 4:156046853-156046875 AAGGTAAAATAATCTTCTGCTGG + Intergenic
982802168 4:159719038-159719060 AAGGTCAAAGTCACTTCTGCTGG + Intergenic
984785530 4:183564248-183564270 CTGGGGAAAGACTCTTAGGCTGG + Intergenic
985339709 4:188936638-188936660 AAGGGAAAAAACTCTTATTCAGG + Intergenic
985411436 4:189689832-189689854 GAGATGAAAGACTCCTCTGCTGG + Intergenic
989231237 5:39088840-39088862 TAGGGAAAAGACCCTTCTGTTGG - Intergenic
989635412 5:43527028-43527050 GAGGGGAAAAAGTCTTCTTCTGG - Exonic
997879026 5:137573498-137573520 CAGGGGAAAAACAGTTCTGCTGG - Intronic
999484829 5:151985222-151985244 AAGGGCATACACTCTTGTGCGGG - Intergenic
1002691657 5:181054185-181054207 AAGGGGAAAGACTCTCAGGTTGG - Intronic
1003318738 6:5034243-5034265 AAGAGGAAATTCACTTCTGCAGG + Intergenic
1008771307 6:54982062-54982084 AAAGAGAAACATTCTTCTGCAGG - Intergenic
1009758913 6:67978487-67978509 AGGAGGAAAGGCTCTGCTGCAGG - Intergenic
1011324270 6:86131759-86131781 ATGGGGAAAGAATTTTCTACTGG - Intergenic
1012412205 6:98971364-98971386 CAGGGCAAAGACTCTACTGTGGG + Intergenic
1013556789 6:111264453-111264475 TACGGGAAAGAATCTACTGCAGG - Intronic
1015829830 6:137356806-137356828 ATGGGGAAAGTCTCTTCAGGAGG + Intergenic
1017583746 6:155897104-155897126 ATGGGGAAAGACATTTCTGAGGG - Intergenic
1022234083 7:28444549-28444571 CAGGGGAAAGACTCTTCCACTGG + Intronic
1022828024 7:34036526-34036548 AAGGGGAAAGACCTTGCTGGGGG + Intronic
1024263355 7:47588172-47588194 AAGGGAAAAGCCAGTTCTGCTGG + Intergenic
1028842205 7:95440826-95440848 GTGGGCAGAGACTCTTCTGCAGG + Intergenic
1029134417 7:98359042-98359064 AAGGGGAAAGACCCCATTGCAGG + Intronic
1029432937 7:100543520-100543542 AAGGGGATAGAGTCGTCTGGGGG + Intronic
1031645822 7:124223588-124223610 GTGGGGAAAGTCTCTTCTGAAGG - Intergenic
1035287406 7:157815138-157815160 AAGGGCGCAGAATCTTCTGCAGG - Intronic
1044265459 8:90176346-90176368 AAGGGTACAGACCCTGCTGCAGG - Intergenic
1047116398 8:121846134-121846156 AGGGTGGAAGACTCTTCTCCAGG - Intergenic
1048365337 8:133733333-133733355 CAGGAAATAGACTCTTCTGCGGG + Intergenic
1048568538 8:135629964-135629986 GAGGGGAAACATTCTGCTGCTGG + Intronic
1049561527 8:143314161-143314183 AAGGTGCCAGACTCTTCTCCAGG - Intronic
1056321611 9:85440531-85440553 GAGGGGGAAGATTATTCTGCTGG - Intergenic
1056720722 9:89069585-89069607 AAGGGCAAAGAACCATCTGCTGG + Intronic
1061062019 9:128255237-128255259 ATGGGGAATGTCTCCTCTGCTGG + Exonic
1061315854 9:129795374-129795396 AAGAGGACAGACTGATCTGCGGG - Intergenic
1203776158 EBV:74337-74359 AAGGGGAAGGCCTCCTCCGCCGG + Intergenic
1203671160 Un_KI270755v1:13150-13172 GAGATGAAAGACTCCTCTGCTGG - Intergenic
1186657627 X:11632258-11632280 AAGGGGAAATAATTTTCTTCTGG + Intronic
1189516102 X:41714898-41714920 AAGAGGAAATACTCTCATGCAGG + Intronic
1190375293 X:49783199-49783221 CAGGGGAAGGACTATTCTGGTGG + Intergenic
1196137544 X:112226363-112226385 ATGGGAAAAGACACATCTGCTGG - Intergenic
1196178220 X:112663443-112663465 AAGGGGAAAGTCCCTTCTGAAGG + Intronic
1198576099 X:138011826-138011848 AAGAGGACAGACTCTACTCCAGG - Intergenic