ID: 932122318

View in Genome Browser
Species Human (GRCh38)
Location 2:69113180-69113202
Sequence CAGCAGGACTAGGGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 505}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932122318_932122334 24 Left 932122318 2:69113180-69113202 CCACCTTCCCCCTAGTCCTGCTG 0: 1
1: 0
2: 3
3: 54
4: 505
Right 932122334 2:69113227-69113249 CCCTCTATTTCTGCACCCCATGG 0: 1
1: 1
2: 0
3: 13
4: 165
932122318_932122329 -4 Left 932122318 2:69113180-69113202 CCACCTTCCCCCTAGTCCTGCTG 0: 1
1: 0
2: 3
3: 54
4: 505
Right 932122329 2:69113199-69113221 GCTGTCCTGCGGGGGTAAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932122318 Original CRISPR CAGCAGGACTAGGGGGAAGG TGG (reversed) Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900800881 1:4736324-4736346 CAGGAGGCCAAGGGAGAAGGCGG - Intronic
900868057 1:5282834-5282856 CAGGGGGACTAGGGACAAGGTGG + Intergenic
901165236 1:7216143-7216165 CAGGAGGAAGAGGGTGAAGGGGG + Intronic
901176474 1:7303051-7303073 CAGCAGCACCAAGAGGAAGGCGG - Intronic
901447669 1:9318163-9318185 CAGCAGGCAGTGGGGGAAGGTGG + Intronic
903320362 1:22539314-22539336 TTGCAGGACTGGGGGGAAGCTGG - Intergenic
903761900 1:25704205-25704227 CAGCAGGACTGGGGGCAGGAAGG - Intronic
905009731 1:34739247-34739269 CAGCAGGCCCAGAGGAAAGGCGG - Intronic
905168292 1:36096393-36096415 AAGCAGGACTAGGGCCCAGGAGG - Exonic
905548171 1:38816556-38816578 CAACAGCCCAAGGGGGAAGGTGG - Intergenic
905937142 1:41833757-41833779 CAGAATGACTTGGGGAAAGGAGG - Intronic
906136544 1:43503896-43503918 CGGCAGGACTTGGGGGTATGGGG - Intergenic
906558922 1:46739582-46739604 AAGGAGGAAAAGGGGGAAGGAGG - Intergenic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
906685532 1:47760939-47760961 CAGCAGGACTGGGATGAAGGGGG + Exonic
907515948 1:54993611-54993633 CAGCAGGGCCAGGGGCAGGGTGG - Intergenic
907519783 1:55015579-55015601 CAGCAAGCCTGGGGGTAAGGAGG + Intergenic
907575407 1:55521697-55521719 CATCAGAACTAGGGGGAGGGAGG - Intergenic
908516441 1:64897454-64897476 CAGGAGGACGAGGGAGGAGGAGG + Intronic
909987399 1:82178575-82178597 GAGCAGGCCTGGGTGGAAGGTGG + Intergenic
911157205 1:94648193-94648215 CAGCAAGGCTAGGAGGGAGGGGG + Intergenic
911335189 1:96573535-96573557 GGGCAGGACTGGGGAGAAGGAGG - Intergenic
911759253 1:101597747-101597769 CAGCGGGACTAGGGGCAGCGTGG + Intergenic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912385989 1:109271400-109271422 CAGCAGGAGGACGGCGAAGGAGG - Exonic
912798039 1:112704765-112704787 TGGCAGGCCTAGGAGGAAGGGGG - Intronic
913939864 1:125091646-125091668 AAGGAGGAGGAGGGGGAAGGAGG + Intergenic
915109515 1:153554118-153554140 CAGCAGCTCTAGGAGGAAGTGGG + Intergenic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915893982 1:159796929-159796951 GAGCAGGATCAGGGAGAAGGGGG + Intergenic
916444555 1:164860202-164860224 CTGCATGACTTGGGGGAAGGTGG - Intronic
916550532 1:165845606-165845628 CAGCAGTATTTTGGGGAAGGGGG + Intronic
916913816 1:169384258-169384280 CAACAGGACTAGGGGAATGAAGG - Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918189894 1:182163967-182163989 CAGCAGGACAAGAGGTCAGGAGG + Intergenic
919362059 1:196608621-196608643 CCCCAGGACTAGGGGGAGGCGGG + Exonic
919529585 1:198700561-198700583 CAGCTGGACTAGATGGAATGAGG - Intronic
920004695 1:202824397-202824419 CAGCAGTATGAGGAGGAAGGAGG + Intronic
920426835 1:205885113-205885135 AAGCAGGATTAGGGGCAATGTGG + Intergenic
921394482 1:214654068-214654090 CAGGAGGAGGAGGGGGAATGAGG - Intronic
921842768 1:219846282-219846304 CAGGAGGATTAGGAGGAAGATGG + Intronic
921945405 1:220882763-220882785 CAGCAGGAGGAGGAGGAAGGAGG - Intronic
922574700 1:226654065-226654087 CAGCCGGACCAGGGTGAGGGAGG + Intronic
922977921 1:229800668-229800690 CAGCAGGAACAGGGCGAAAGTGG + Intergenic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
923933174 1:238726746-238726768 CACCAGGAGTAAGGGGAACGTGG + Intergenic
924333930 1:242967949-242967971 TAGCAGGGGTAGGGGGACGGGGG - Intergenic
1063253348 10:4298850-4298872 CAGGAGGAACAGGGTGAAGGGGG - Intergenic
1063487447 10:6433244-6433266 CATCAGGATGAGGGGGAAGGAGG - Intronic
1063489268 10:6448045-6448067 CAGGTGGAGTAGGGGGAAGCTGG + Intronic
1063661316 10:8036576-8036598 CTGCTGGAATAGGGGAAAGGGGG + Intergenic
1065733926 10:28734233-28734255 CAGCAGCTCTAGGGGTGAGGTGG - Intergenic
1065890397 10:30116466-30116488 CAGCAGGACAAGCGGCCAGGAGG + Intergenic
1066285860 10:33965554-33965576 CAGGAGGCCAAGGGGCAAGGAGG - Intergenic
1067691238 10:48503719-48503741 CAGCAGGACTTGGGCTGAGGAGG - Intronic
1068204489 10:53831471-53831493 CAGCCGTATTATGGGGAAGGAGG - Exonic
1068509261 10:57943199-57943221 GAACAGGACTAGGGGGTGGGGGG + Intergenic
1068816429 10:61320178-61320200 CAGCAGGACTAGCGGGTAGGAGG - Intergenic
1070276585 10:75013064-75013086 CAGCATGTCTTTGGGGAAGGAGG - Intronic
1070751259 10:78965310-78965332 CAGCAGCACTGGGGGCAGGGCGG + Intergenic
1071700557 10:87928682-87928704 CAGTAGGTATAGGTGGAAGGAGG + Intronic
1073057030 10:100709639-100709661 GAGCAGGAATAGGGTGGAGGAGG - Intergenic
1073071777 10:100798850-100798872 CAGCAGGACCAGGGAGGTGGAGG - Intronic
1073597722 10:104817410-104817432 GAGGAGGAGGAGGGGGAAGGGGG - Intronic
1075597514 10:123742865-123742887 CAGCAGGACTGGCCAGAAGGAGG - Intronic
1075744475 10:124717103-124717125 AAGCAGGACTTAGGGGATGGGGG + Intronic
1075835371 10:125448412-125448434 CAGGAGGACGAAGGTGAAGGTGG - Intergenic
1075844582 10:125535137-125535159 CTGCAGGAACAGGGGGCAGGTGG + Intergenic
1076523012 10:131092858-131092880 CTGCAGGACTGTGGGGAAGCAGG - Exonic
1076563337 10:131381683-131381705 CACCAGGACCAGGTGGAGGGGGG - Intergenic
1077095196 11:796159-796181 GAGCAGGACCAGCGGGCAGGTGG - Exonic
1077176857 11:1195043-1195065 CCGCACGCCTAGGGGGACGGTGG + Intronic
1077497905 11:2895419-2895441 CAGCAAGTCTAGGGGCAGGGAGG + Intronic
1077710195 11:4528711-4528733 CAGCAGGGGTAGGATGAAGGTGG + Intergenic
1077868627 11:6243096-6243118 GAGCAGGAACAGAGGGAAGGGGG - Intronic
1078456992 11:11483170-11483192 CAGCAGGCATAGAGGCAAGGAGG - Intronic
1078697025 11:13644585-13644607 CAGGAGGAAGAGGGGAAAGGGGG + Intergenic
1078749963 11:14152129-14152151 AAGCATGACTAGGGAGATGGAGG - Intronic
1079249933 11:18779998-18780020 CAGCAGGAATATGGAGAAGGAGG - Intronic
1080179436 11:29406282-29406304 CAGCAGTCCTATGGGGAAGAGGG + Intergenic
1081761961 11:45582879-45582901 CAGCAGAAATAGGAGGAAGGTGG - Intergenic
1082791347 11:57348435-57348457 CAGCAGGAGGAGGAGGCAGGTGG - Intronic
1083883081 11:65557966-65557988 CCGCAGGACCCGGGGGAGGGGGG + Exonic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084571665 11:69963420-69963442 GAGGAGGAGGAGGGGGAAGGGGG + Intergenic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084662269 11:70552972-70552994 CATGAGGACACGGGGGAAGGCGG - Intronic
1085630392 11:78110804-78110826 CAGCAGGCCAAAGGGGAAAGGGG - Intronic
1086140436 11:83492861-83492883 CAGCAGGAATAGGTGGAAGCAGG - Intronic
1086173881 11:83866906-83866928 CAGCAGGACTAGGAAGAAGCCGG - Intronic
1086530035 11:87774160-87774182 CAGCAGGACAAGGCAGAAGGTGG + Intergenic
1086856111 11:91868060-91868082 CAGCAGGGCTGGGCAGAAGGAGG - Intergenic
1086936790 11:92753976-92753998 TTGGAGGACTTGGGGGAAGGTGG + Intronic
1087216943 11:95504721-95504743 GAGCAGGACCAGGAGGCAGGGGG - Intergenic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1089322444 11:117635527-117635549 CAGCAGGGGTCAGGGGAAGGAGG + Intronic
1089701566 11:120247570-120247592 CAGCAAGACTAAGGAGAATGTGG + Intronic
1090402850 11:126460106-126460128 GAGCAGGAGGAGGGGGAAGGGGG + Intronic
1090453650 11:126828527-126828549 CAGCAGGACCAGGGGAGTGGGGG + Intronic
1091150181 11:133321089-133321111 GACCAGAACTTGGGGGAAGGTGG + Intronic
1091349172 11:134879384-134879406 GAGCAGGACTTGGGGGCAGGGGG + Intergenic
1091412016 12:248032-248054 AAGCAGGAGGAGAGGGAAGGGGG + Intronic
1092031981 12:5294019-5294041 GAGGAGTACTAGGGGAAAGGAGG + Intergenic
1092261140 12:6953878-6953900 CCGCAGGGATGGGGGGAAGGAGG - Intronic
1093194874 12:16118747-16118769 CAGCAGTACAAGGGGGCTGGTGG - Intergenic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1096102041 12:48975702-48975724 CACCAGGAGTAGGGGGCAAGAGG - Intergenic
1096146934 12:49284915-49284937 CAGCAGGACTAGGGAGAAAGAGG - Intergenic
1096180265 12:49546775-49546797 CAGCAGGACACAGGGGAGGGTGG - Intronic
1097225935 12:57476805-57476827 GAGCAGGAAAAGGGGGGAGGGGG + Intronic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1097797675 12:63880976-63880998 GATCAGGAGTAGGGGGAGGGAGG + Intronic
1097823101 12:64147365-64147387 CAGCAGGAATTGGGAGGAGGAGG - Exonic
1098188846 12:67926540-67926562 CAGGAGAACTAGGAGGAAGCTGG - Intergenic
1099316375 12:81087408-81087430 GAGCAGGAGGAGGAGGAAGGAGG + Intronic
1100237146 12:92672419-92672441 GAGCAGGACAAGGGGGAGGAGGG + Intergenic
1100449927 12:94696066-94696088 GAGCAGCAGCAGGGGGAAGGAGG + Intergenic
1100756135 12:97752893-97752915 TAACAGGAATTGGGGGAAGGGGG - Intergenic
1101993720 12:109509417-109509439 CATCAGGGGTAGGGGGAAAGGGG - Intronic
1102046477 12:109833079-109833101 TAGCAGGTCTGGGGGGAGGGCGG - Intronic
1103782520 12:123408683-123408705 CAGCAGGATGAGGGGGAATGGGG - Exonic
1104379109 12:128291514-128291536 CAGCAGAAATAGGTGAAAGGGGG + Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104774162 12:131382438-131382460 CAGCAGCACCAGGAGGGAGGGGG - Intergenic
1104774298 12:131382887-131382909 CAGCAGCACCAGGAGGGAGGGGG - Intergenic
1105217797 13:18299705-18299727 CAGCAGGATGAGGGGGAATGGGG - Intergenic
1106568583 13:30907032-30907054 CATCAGGACTGGGGGCGAGGGGG + Intronic
1107707039 13:43118510-43118532 CAGCAGGATAAGGGGGTAAGAGG - Intergenic
1108092086 13:46859555-46859577 AAACAGCACTAGGGGGATGGTGG - Intronic
1109181580 13:59220075-59220097 GAGGAGGAAAAGGGGGAAGGGGG + Intergenic
1109571991 13:64204913-64204935 AACTAGGACTAGGGAGAAGGTGG - Intergenic
1110848539 13:80217920-80217942 CAGGAGGAGTAGGGGGATTGAGG + Intergenic
1111754667 13:92378161-92378183 TAGCAGGACTAGCAGGAAAGTGG - Intronic
1111883403 13:93987933-93987955 GAGCAGGACAAGAGGCAAGGAGG - Intronic
1111912708 13:94329766-94329788 GAGGAGGAGTAGGAGGAAGGAGG - Intronic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112733094 13:102388741-102388763 GGGCAGTACTAGGAGGAAGGAGG - Intronic
1112888030 13:104197385-104197407 CAGCAAGACTAGGGTGGAAGCGG - Intergenic
1115017406 14:28633831-28633853 CAGCTGGACCAGGGGAAAGTGGG - Intergenic
1115709877 14:36039215-36039237 CAGGAGGACTAGGGGCAAGGAGG + Intergenic
1116457712 14:45138039-45138061 GAGCAGGTTTAGGGGGAACGTGG + Intronic
1116703699 14:48268431-48268453 CAGCAAGAATATGGGGAAAGGGG - Intergenic
1117680659 14:58199998-58200020 CGCCAGGACTAGGGGAAAAGAGG - Intronic
1118154382 14:63224438-63224460 CAGCAGCAGTTGGGGGGAGGGGG + Intronic
1119017243 14:71071552-71071574 CAGAAGGAATAGGGTTAAGGGGG - Intronic
1119281988 14:73417117-73417139 CAGCAGGATGATGGGGAAGCTGG - Intronic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1121233759 14:92377536-92377558 CAGCAGGAACAGGAGGCAGGAGG + Intronic
1121576651 14:94994378-94994400 CAGCAGGAGAAAGAGGAAGGAGG - Intergenic
1121586654 14:95067577-95067599 CAGCAGCATGAGGGGGAGGGTGG + Intergenic
1121917803 14:97851954-97851976 CAGGAGGAATAGGGGGATTGTGG + Intergenic
1122141786 14:99667089-99667111 CAGCTGGACTGGGGGCAGGGAGG - Intronic
1122262249 14:100530331-100530353 CAGCAGGCCTGGGAGGAGGGAGG - Intergenic
1122281017 14:100622443-100622465 CAGCAGGAGGAGGGGGAAAGAGG - Intergenic
1122518687 14:102327108-102327130 CAGCAGGAACAAGGGGCAGGGGG + Intronic
1122543809 14:102511395-102511417 CAGCAGGAGTAGGGGTATAGAGG + Intergenic
1122900733 14:104781370-104781392 CAGCAGGACTGGGTGGTGGGTGG - Intronic
1123042499 14:105496119-105496141 CCGCAGGACTTGGGGGTGGGTGG + Intronic
1123677322 15:22723526-22723548 CAGCTGTACTGGGGGGCAGGGGG - Intergenic
1124346365 15:28924060-28924082 CAGCAGGGCAACGGGGCAGGGGG - Intronic
1124596660 15:31096929-31096951 CAGCAGGAGTGAGGGGTAGGCGG + Intronic
1124621731 15:31277835-31277857 TGCCAGGACTAGGGGGGAGGGGG + Intergenic
1124653320 15:31488347-31488369 CAGAAGGGCTAGGGTGGAGGGGG + Intronic
1124816781 15:33001700-33001722 GAGGAGGAGGAGGGGGAAGGGGG - Intronic
1124952613 15:34337689-34337711 CAGCAGGGTGAGGGAGAAGGAGG + Exonic
1125042953 15:35213488-35213510 CATCAGGTCTAGTGGGGAGGTGG - Intergenic
1125281587 15:38047549-38047571 CAGGAGGAAAAGAGGGAAGGGGG + Intergenic
1125575501 15:40752663-40752685 GAGAAGGACTAGGAGAAAGGGGG + Intronic
1125608541 15:40956063-40956085 CAGCAGCACTGGGGGGAATCTGG - Exonic
1126299922 15:47184205-47184227 CACCAGGACTAGGAGGCAGCGGG + Intronic
1126522796 15:49615532-49615554 CAGGAGGAAAAGGGTGAAGGGGG - Intronic
1128072658 15:64807299-64807321 CAGCAGGACTCAGGGGATGGGGG + Intergenic
1128242410 15:66109995-66110017 CAGCAGGACAAGGGTGCAGAGGG + Intronic
1128551533 15:68600904-68600926 CAGCAGGACAGCCGGGAAGGTGG - Intronic
1129901523 15:79154813-79154835 CAGGAGCATTGGGGGGAAGGAGG + Intergenic
1130135954 15:81182142-81182164 CAACTGGGCTCGGGGGAAGGTGG - Intronic
1131395790 15:92084911-92084933 CCGCAGGGCCAGGCGGAAGGAGG + Intronic
1131455318 15:92578913-92578935 CAGGAGGGCTAGTGGGGAGGAGG - Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1132093038 15:98960926-98960948 CAGCAGGACCAGGGAGACGGAGG - Exonic
1132744394 16:1430670-1430692 CAGGAGGACCCTGGGGAAGGGGG - Intergenic
1133814160 16:9183802-9183824 CAGCAGGATTGGGGGGGGGGGGG - Intergenic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1134692063 16:16197603-16197625 GAGGAGGAGGAGGGGGAAGGAGG + Intronic
1134787578 16:16959065-16959087 TATTAGGACTAGCGGGAAGGAGG + Intergenic
1135569668 16:23539059-23539081 CAGCTGAACTAGGGAGATGGAGG - Intronic
1136494734 16:30635402-30635424 AAGAAGGACTAGGGGGAATGGGG + Intergenic
1136799199 16:33055245-33055267 AAGGAGGAGGAGGGGGAAGGAGG - Intergenic
1137282737 16:46992327-46992349 CGGCAGGCCTGGGTGGAAGGGGG - Intergenic
1137670647 16:50276309-50276331 CAGCAGCACTGGGGGTGAGGAGG - Intronic
1138356357 16:56384116-56384138 GAGCTGGATCAGGGGGAAGGAGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138596445 16:58031655-58031677 CAGCAGGAGAAGCAGGAAGGAGG - Intronic
1138635100 16:58331957-58331979 CACCAGGGATTGGGGGAAGGTGG - Intronic
1140954437 16:79849198-79849220 CTGCAGGACCAGCGGGAAGGTGG - Intergenic
1141623559 16:85249702-85249724 CAGCAGGACATTTGGGAAGGGGG + Intergenic
1141733417 16:85837032-85837054 CAGCAGGTCTTGGAGGAGGGGGG - Intergenic
1141845115 16:86603368-86603390 AAGAAGGAGGAGGGGGAAGGAGG - Intergenic
1142197066 16:88743884-88743906 CAGCAGGGAGAGTGGGAAGGAGG + Intronic
1142608518 17:1095577-1095599 CAGCAGGACTGGGGAGGAGGGGG - Intronic
1142677260 17:1521460-1521482 CATCATTACTAGAGGGAAGGAGG + Intronic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1142975467 17:3641123-3641145 CAGCAGGGCTAGGGGTCAGTTGG + Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143321731 17:6072725-6072747 CAGGAGGCCCAGGGAGAAGGTGG - Intronic
1143455601 17:7065612-7065634 CTGCAGGACTTGGGGGAACATGG + Intergenic
1144009266 17:11130515-11130537 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1144193380 17:12867196-12867218 CAGCAGGATTATGGGGGATGGGG + Intronic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144613914 17:16751465-16751487 CAGCAGTGCTCTGGGGAAGGGGG + Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145103878 17:20098737-20098759 CAGCAGGAGGAGGAGGATGGAGG - Intronic
1145133577 17:20381517-20381539 CAGCAGTGCTCTGGGGAAGGGGG + Intergenic
1145224417 17:21116208-21116230 CAGCAGGTTTAGGGGGAAATGGG - Intergenic
1145249440 17:21289318-21289340 CAGGACGAATATGGGGAAGGTGG + Intronic
1145741292 17:27276868-27276890 GAGAAGGACTTGGGGGAAGGCGG - Intergenic
1145990379 17:29075752-29075774 CAGGAGGAGTACGGGAAAGGTGG - Exonic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147006362 17:37407009-37407031 TAGCGGGACTAGGGAGAAGCGGG + Intronic
1147053975 17:37819707-37819729 AAGGAGGAAGAGGGGGAAGGAGG - Intergenic
1147121755 17:38339204-38339226 CAGGAGGAATAGGGGGTGGGGGG + Intronic
1147224692 17:38967544-38967566 CAGAAGCCCTAGCGGGAAGGAGG + Intergenic
1147948779 17:44095535-44095557 CAGGAGGCCTCGGGGAAAGGGGG + Intronic
1147976954 17:44253308-44253330 CAGCAGGTCCAGGTGGAAGCCGG + Exonic
1148218336 17:45846033-45846055 CAGCAGGGCCAGCAGGAAGGAGG - Exonic
1148763842 17:50026182-50026204 GAGCAGGACAAGGGGGAGTGAGG + Intergenic
1149273161 17:55004716-55004738 AAGGAGGAGGAGGGGGAAGGAGG + Intronic
1149285573 17:55160614-55160636 CAGCAGGGTATGGGGGAAGGGGG - Exonic
1150472127 17:65446361-65446383 CTGCAGGAAGAGGGAGAAGGTGG + Intergenic
1150748817 17:67840513-67840535 GAGGAGGAAAAGGGGGAAGGGGG - Intronic
1151172581 17:72259744-72259766 CAGCAGGGCCAACGGGAAGGTGG - Intergenic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151785149 17:76271777-76271799 CTGCAGGGCTGCGGGGAAGGGGG - Intergenic
1151875242 17:76864261-76864283 CAGCAGGACCCAGGGGCAGGGGG + Intergenic
1151977249 17:77489791-77489813 CAGCAGGAGTCAGGGGCAGGGGG + Intronic
1151997390 17:77618508-77618530 CAGCAAGGGTAGGGGGCAGGAGG + Intergenic
1152138988 17:78525322-78525344 CAGGAGGCCTTGGGGGATGGAGG - Intronic
1152336945 17:79703951-79703973 CTGCAGGAGTGGGGGGTAGGAGG + Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152680306 17:81664449-81664471 TGCCAGGACTTGGGGGAAGGTGG + Intergenic
1153983673 18:10334158-10334180 AGGCAGCAGTAGGGGGAAGGGGG - Intergenic
1157288672 18:46394502-46394524 CAGCCTGGCTGGGGGGAAGGTGG - Intronic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1158312292 18:56171327-56171349 CAGCAAGTCTATGGGTAAGGGGG + Intergenic
1158838847 18:61361209-61361231 TAACAGAGCTAGGGGGAAGGAGG + Intronic
1159537162 18:69728669-69728691 CAGCAGAACTCGGGTAAAGGGGG - Intronic
1159868866 18:73738013-73738035 CAGCAGGACTGGGGTGGAAGTGG - Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160712794 19:560404-560426 GAGGAGGGCTAGGGGGAAGAAGG + Intergenic
1160728068 19:627062-627084 CTGCAGGACTATGGGGTGGGAGG - Intronic
1161083701 19:2324076-2324098 CAGCGGGACGAGGGGGATAGTGG - Intronic
1162038174 19:7953554-7953576 AAGGAGGAGGAGGGGGAAGGAGG - Intergenic
1163031233 19:14545495-14545517 CAGCAAGCCTAGGGGGTGGGGGG + Intronic
1163324050 19:16591982-16592004 CAGGAGGTCTAGGGGGGATGGGG - Intronic
1164540769 19:29120044-29120066 CAGCAGGACCAGAGGCATGGAGG + Intergenic
1165406508 19:35634106-35634128 CAGGAGGACCTGGGGGAGGGAGG + Intronic
1166109500 19:40613641-40613663 CAGCAGGATCAGGGGGCAGCTGG + Intronic
1166180758 19:41106853-41106875 GTGGAGGACTGGGGGGAAGGTGG - Intergenic
1166197093 19:41214245-41214267 GGGCAGGAGTAGAGGGAAGGTGG - Intergenic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1167605636 19:50480238-50480260 GAGGAGGACGAGGGAGAAGGGGG - Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168032709 19:53693722-53693744 CAGCAGGCTTAGGTGGGAGGTGG - Intergenic
1168035467 19:53715922-53715944 CAGCAGGTTTAGGTGGGAGGTGG - Intergenic
1168036614 19:53724764-53724786 CAGCAGGATTAGGTGGGAGGTGG - Intergenic
1168038057 19:53736172-53736194 CAGCAGGCTTAGGTGGAAGGCGG - Intergenic
1168041213 19:53760469-53760491 CAGCAGGCTTAGGTGGGAGGCGG - Intergenic
1168417372 19:56177119-56177141 GAGGAGGACCAGGGGGACGGAGG - Exonic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
925617647 2:5758905-5758927 GACCAGGACTGGGGGAAAGGAGG - Intergenic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
927471836 2:23383558-23383580 GAGCAGGAGTGGGGGGGAGGGGG - Intergenic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928035825 2:27822189-27822211 CAGCAGGACTATGGCTAAGCAGG + Intronic
928699955 2:33888603-33888625 CAGCAAGACTAGGGGATAGAGGG - Intergenic
929589261 2:43134546-43134568 CATCTGGACTAGGTGGGAGGTGG + Intergenic
929830620 2:45343855-45343877 CCCCAGGACTGGGAGGAAGGAGG - Intergenic
930771455 2:55134320-55134342 CAGGAGGAGTGGGGGGAAGAGGG - Intergenic
931654809 2:64501358-64501380 CAGCAGGGCTATGAGGATGGGGG + Intergenic
931902760 2:66807553-66807575 GAGGAGGAGGAGGGGGAAGGAGG + Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932272354 2:70421618-70421640 CAGCAGGTCTAGGGTGGAGCTGG + Intergenic
932691019 2:73913827-73913849 CAGCTGGTCTCTGGGGAAGGAGG - Intronic
932800619 2:74739491-74739513 CAGCAGGAAGAGGGGAAGGGAGG - Intergenic
933917853 2:87014591-87014613 CAGCAGGACAAAGGTGAAGAGGG + Intronic
934005142 2:87755323-87755345 CAGCAGGACAAAGGTGAAGAGGG - Intronic
934926554 2:98385845-98385867 CGGCAGGAGCAGGAGGAAGGTGG + Intronic
935645274 2:105329531-105329553 GAGCAGGAGTGGGGGGTAGGCGG - Intronic
935768099 2:106389415-106389437 CAGCAGGACAAAGGTGAAGAGGG - Intergenic
935811356 2:106800643-106800665 CAGCAGGAGCTAGGGGAAGGAGG - Intergenic
937307450 2:120881296-120881318 AAGCAGGACCCTGGGGAAGGGGG - Intronic
937901659 2:127024713-127024735 CTGCAAGACTCGTGGGAAGGAGG + Intergenic
938109079 2:128552276-128552298 CAGGAGAACTTGGTGGAAGGCGG - Intergenic
938143044 2:128812161-128812183 CAGCAGGGCTTTGGGGCAGGTGG - Intergenic
938242178 2:129751712-129751734 AAGGAGGAAGAGGGGGAAGGGGG + Intergenic
940854736 2:158721165-158721187 CAGAAGCACTTGGGGGAGGGTGG - Intergenic
940887340 2:159001145-159001167 CACCAGGAAAAGGGGGCAGGGGG - Exonic
941945310 2:171089979-171090001 CAGCAGGATTTTGGGGAGGGTGG - Intronic
942512513 2:176717540-176717562 CAGCAGGACTGGGCAGAGGGAGG + Intergenic
942556631 2:177178354-177178376 CAGCAGAACTTGGGGGGAAGCGG - Intergenic
946153303 2:217790530-217790552 CAGCATCAGTAGGGGGCAGGAGG - Intergenic
946734959 2:222744800-222744822 ATGCAGGACTATGGGGTAGGAGG + Intergenic
947901780 2:233727330-233727352 TAGCAGAACTATGGGGAGGGAGG - Intronic
948225189 2:236304367-236304389 CAGCAGGACCTGGAGGAAGCTGG - Intergenic
948645058 2:239399584-239399606 CAGCAGGACTGGGGGGATACTGG - Intronic
949041777 2:241852931-241852953 GAGCAGGGCTGGGGAGAAGGTGG + Exonic
1169118831 20:3083543-3083565 CAGCAGGGCGAGGAGGAAGGAGG - Intronic
1169765575 20:9144664-9144686 GAGGAGGAGGAGGGGGAAGGAGG + Intronic
1170130277 20:13011575-13011597 ACGCTGGACCAGGGGGAAGGAGG - Intronic
1170144104 20:13153882-13153904 CAGCAGCACTAGCTGGGAGGAGG - Intronic
1170331710 20:15219365-15219387 CAGCAGGAGTAGGAGCAGGGTGG - Intronic
1170684876 20:18560375-18560397 CATCAGGACTATGGAGAAGAGGG + Intronic
1170779058 20:19407251-19407273 CAGCAGCACTAAGAGGATGGCGG + Intronic
1171854671 20:30333501-30333523 CAGAGGGACTAGGGAGAAAGTGG - Intergenic
1172900911 20:38334320-38334342 GAGCAGCGCTAGGGGAAAGGAGG + Intronic
1174150376 20:48482161-48482183 GAGGAGGAGCAGGGGGAAGGAGG + Intergenic
1174185602 20:48703821-48703843 CAGCAGGGCTGGGGTGGAGGGGG - Intronic
1174557898 20:51408883-51408905 CAGCAGGACTGGGGTGGAGGTGG + Intronic
1174706633 20:52662974-52662996 CAGTAGGACTAGGGTGAACCTGG + Intergenic
1175834529 20:61985006-61985028 CAGCAGGAGGACGGGGCAGGGGG + Intronic
1176011508 20:62899064-62899086 CAGCAGGCCTAGGGCGCTGGAGG + Intronic
1176091162 20:63319232-63319254 CAGGAGGAGTAGGGGCAGGGAGG + Intronic
1176134340 20:63514655-63514677 CAGCAGGAAGAGAGTGAAGGGGG + Intergenic
1176155239 20:63616684-63616706 CAGCAGGAATGAGGGAAAGGAGG + Intronic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1178364276 21:31975579-31975601 CAACAGGCCCAGGGTGAAGGTGG - Intronic
1178761307 21:35405303-35405325 CCGCAGGACTTGGTTGAAGGTGG - Intronic
1179156764 21:38857770-38857792 CAGCAGGTCCATGGAGAAGGTGG + Intergenic
1179236741 21:39554167-39554189 CAGAATGACTAGGAGGAAGGAGG - Intergenic
1179338782 21:40484726-40484748 CAGCAGCACTTTGGGGAATGAGG - Intronic
1179340151 21:40500113-40500135 CAGCAGTACTGGGAGGGAGGAGG + Intronic
1179502849 21:41820904-41820926 CAGCAGGGCTCGGGGGCAGCTGG - Intronic
1179566325 21:42251333-42251355 CAGCAGCACCAGGTGGAAGGAGG + Intronic
1179812992 21:43884274-43884296 GAGAAGGAGGAGGGGGAAGGAGG - Intronic
1180626845 22:17199280-17199302 CTGCAGAACAAGGGGGAAGATGG + Intronic
1180837098 22:18935345-18935367 CAACAGGAGGCGGGGGAAGGCGG - Intronic
1181064859 22:20300678-20300700 CAACAGGAGGCGGGGGAAGGCGG + Intergenic
1181408188 22:22699944-22699966 CAGAAGGACTTGGTGGAACGAGG + Intergenic
1181413506 22:22743253-22743275 CAGAAGGACTTGGTGGAACGAGG + Intronic
1181648113 22:24244684-24244706 CAGCAGGACTAGGCTGACCGTGG + Exonic
1182069754 22:27455259-27455281 TAGCAGGACTGGGGAGCAGGGGG - Intergenic
1182488006 22:30650833-30650855 AAGCAGGACAAGGGGGCTGGAGG - Intronic
1184300037 22:43553275-43553297 GAGCAGAACCAGGAGGAAGGAGG + Intronic
1184445515 22:44544773-44544795 CAGCAGGACATGGGGCTAGGGGG - Intergenic
1184842907 22:47063092-47063114 CAGCAGGACTCGGTGGAGGATGG + Intronic
1185101794 22:48844579-48844601 CAGCAGGGCCAGGGGCATGGAGG - Intronic
1185331667 22:50254783-50254805 CAGCAGGTCTGGGGGCCAGGAGG + Intronic
1203287191 22_KI270734v1_random:160644-160666 CAACAGGAGGCGGGGGAAGGCGG - Intergenic
950190409 3:10972570-10972592 CAGCAGGAGTCGGAGGGAGGGGG + Intergenic
950335077 3:12187119-12187141 CAGCAGGACAAGGAGGAACCAGG - Intronic
950483634 3:13260099-13260121 CTGGAGGAAGAGGGGGAAGGAGG + Intergenic
951825128 3:26859853-26859875 CAGGAGGACTGGGGCGGAGGTGG - Intergenic
952038571 3:29234134-29234156 CATCAGGACTTGGGGGAAGTAGG + Intergenic
953177593 3:40566130-40566152 CAGCAGGATTAGGGGCAGTGTGG - Intronic
953384691 3:42499880-42499902 CTGAAGCACTGGGGGGAAGGGGG - Intronic
954961632 3:54570669-54570691 CAGCAAGTCTAGGAGGTAGGGGG + Intronic
955259414 3:57370619-57370641 CATCAGTACTAGGAGGAAGAAGG - Intronic
956015915 3:64882390-64882412 CAGAAGGAGTGGGAGGAAGGAGG - Intergenic
956534016 3:70255570-70255592 CTGCAGGACTAGGAGGCAGGAGG - Intergenic
956768555 3:72505289-72505311 CATCAGGACAAAGGAGAAGGAGG + Intergenic
956929652 3:74028603-74028625 CAGCATCCCTAGAGGGAAGGTGG + Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
957867979 3:86049692-86049714 CAGAAGGCAAAGGGGGAAGGAGG + Intronic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
960551955 3:118985828-118985850 CAGGAAGACAAGGGAGAAGGAGG - Intronic
960811541 3:121631767-121631789 CAGCAGGAATAGGGAGGGGGTGG + Exonic
961569046 3:127785193-127785215 CAGCAGGTGTGTGGGGAAGGAGG - Intronic
961605438 3:128091284-128091306 CAGCAGGAGCTGGGGGAACGGGG + Intronic
961831833 3:129626988-129627010 CAGCCGGCCTAGGGGGGCGGGGG + Intergenic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962468753 3:135686532-135686554 CAACAGGACCAGCGAGAAGGAGG + Intergenic
963027129 3:140931092-140931114 CAGCAGGAATAGGTGGTGGGAGG + Intergenic
963320570 3:143805332-143805354 CAGCAGGATTAGGGGCAGTGTGG - Intronic
964452692 3:156826665-156826687 CTGCAGGTCCAGGGGGAACGGGG + Exonic
965061234 3:163787933-163787955 CATCTGGACTAGGGGAAAGCAGG + Intergenic
966857554 3:184205700-184205722 AAGATGGACTAGGGGGAAGGGGG - Intronic
967090657 3:186132361-186132383 CAGCAGATCCAGGTGGAAGGAGG + Intronic
967092424 3:186146480-186146502 GAGCGGGAGTTGGGGGAAGGAGG - Intronic
967327614 3:188257910-188257932 TAGCAGCACTGGGTGGAAGGTGG - Intronic
968470805 4:781522-781544 CGGCCGGCCTAGGGGGAACGCGG + Intergenic
968871514 4:3245081-3245103 CACCTGGACCAGGGAGAAGGGGG - Intronic
968943587 4:3652107-3652129 CAGAAGCACAAGGGGCAAGGTGG - Intergenic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
970601137 4:17641978-17642000 CAGCCGCAGTAGGGGGAGGGGGG + Intronic
971403234 4:26295670-26295692 CCACAGGGCTATGGGGAAGGAGG - Intronic
975195029 4:71514320-71514342 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
977890957 4:102310579-102310601 CAGCACAACTTGGGGGATGGTGG + Intronic
978253960 4:106670932-106670954 CAGGAGAACTAGGGGGTAAGAGG - Intergenic
981259926 4:142707565-142707587 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
983192755 4:164772217-164772239 CAGCAGGAAGAGGGAGAAGGGGG + Intergenic
983904311 4:173168754-173168776 GAGCCGGAGGAGGGGGAAGGAGG + Exonic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986008089 5:3684788-3684810 CAGCAGGCCGAGGAGGAAGGAGG - Intergenic
986263237 5:6167358-6167380 CAGCAGGACTGGGCAGAAGAGGG - Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
989323784 5:40166114-40166136 CAGCAGTTCTCTGGGGAAGGGGG - Intergenic
990510780 5:56487547-56487569 CAATAGGACTAGTGGGAAGTTGG + Intergenic
991396443 5:66209287-66209309 CAGCAGGACTTGGTGGCAGTGGG - Intergenic
992206431 5:74434710-74434732 ATGCAAGACTAGGGTGAAGGAGG - Intergenic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
992705464 5:79387003-79387025 AAGAAGGAAGAGGGGGAAGGGGG - Intronic
995069670 5:107904934-107904956 CAGGAGGAGGAGGGTGAAGGTGG + Intronic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
997642771 5:135460373-135460395 CAGCGTGGCAAGGGGGAAGGAGG - Intergenic
998161841 5:139817366-139817388 GAGCAGGTCTAGGGGGTGGGTGG + Intronic
999773469 5:154792809-154792831 GAGCAGGACTTGGGAGAAGGTGG + Intronic
1001115047 5:168932454-168932476 CAGAAAGACTAGGAGGTAGGAGG + Intronic
1001158437 5:169293360-169293382 CAGCATGATTTAGGGGAAGGTGG - Intronic
1001722498 5:173868224-173868246 CAGCAGGCCTTAGGGGAAAGAGG - Intergenic
1001891712 5:175344780-175344802 AGGCAGGAGTGGGGGGAAGGAGG + Intergenic
1001892492 5:175351121-175351143 AAGGAGGACTATGGGGCAGGCGG - Intergenic
1002064970 5:176647413-176647435 CAGCAGGGCTCCGGGCAAGGAGG + Exonic
1002414135 5:179109965-179109987 CAGCAGGTATAGGGAGAAGCAGG - Intergenic
1002461431 5:179375845-179375867 CAGCAGGGGAGGGGGGAAGGGGG + Intergenic
1002472549 5:179445046-179445068 CTGCAGGACTTGGGGGACAGAGG - Intergenic
1002481572 5:179504605-179504627 CTGCAGGACTTGGGGGACAGAGG + Intergenic
1002607072 5:180389847-180389869 CAGCAGGTCCAGGGGACAGGAGG - Intergenic
1003148911 6:3532187-3532209 CACCAGGGCCTGGGGGAAGGAGG - Intergenic
1003236046 6:4295901-4295923 CAGCAGGACTGGGGTGAGGCTGG - Intergenic
1003710285 6:8581876-8581898 CACCAGGACTAGGTGAAATGTGG - Intergenic
1004128880 6:12900233-12900255 CAACAGAAAGAGGGGGAAGGAGG - Intronic
1005504392 6:26457477-26457499 CAGGAGGGCTTGGGGGAAGCTGG - Intergenic
1006215273 6:32436727-32436749 CAGAAGGAAAAGGGGGTAGGGGG + Intergenic
1006744233 6:36330309-36330331 CAGGAGGCCAAGGGGGAAGGAGG - Exonic
1006865407 6:37205639-37205661 GGGGAGGACTAGGGGAAAGGAGG + Intergenic
1007239780 6:40416722-40416744 TAGCAGGAGAAGGAGGAAGGGGG - Intronic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1007952444 6:45884434-45884456 TAGCAGGACTTGGAAGAAGGGGG + Intergenic
1008549090 6:52610500-52610522 CTGCAGGACAAGGAGAAAGGTGG - Intergenic
1008617878 6:53243645-53243667 CAGCAGGTCTAGGGCGAGGTCGG + Intergenic
1009292919 6:61906543-61906565 CAGGAAGAATAGTGGGAAGGAGG - Intronic
1009995255 6:70889393-70889415 GAGCATGACTAGGAGGCAGGAGG - Intronic
1012158833 6:95856962-95856984 CAGCAGAACTAGGGGGGCAGGGG + Intergenic
1014126686 6:117784026-117784048 CTGGAAGACTTGGGGGAAGGTGG - Intergenic
1014141173 6:117944917-117944939 CAGCAGGCTTAGGGGGCAGAGGG + Intronic
1016126909 6:140414933-140414955 GAGAAGGACTGGGGAGAAGGAGG - Intergenic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017781888 6:157721756-157721778 GAGCAGGACGGGCGGGAAGGAGG - Intronic
1017869768 6:158477277-158477299 AAGCAGAACTAGGAGGGAGGAGG + Intronic
1017916497 6:158835739-158835761 CAGCAGGACGAGGCGGAGTGGGG - Intergenic
1017954695 6:159168766-159168788 AAGGAGGAATAGGGAGAAGGAGG + Intergenic
1018128943 6:160709589-160709611 CAGCAGGACAAAGGTGAAGAGGG - Intronic
1018811216 6:167299793-167299815 CCGCAGGGCTGGGGGCAAGGTGG + Intronic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1019010677 6:168841637-168841659 CAGCAGCACCAGGTGGCAGGAGG + Intergenic
1019502890 7:1374008-1374030 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1019999103 7:4744780-4744802 GAACAGGACTGGGCGGAAGGAGG - Intronic
1021382610 7:19985653-19985675 CAGGAGGAAGAGGGAGAAGGGGG - Intergenic
1021441119 7:20677772-20677794 CAGCGGGACTAGGTAGAAAGAGG - Intronic
1021605195 7:22402966-22402988 GAGCAGGCCTGGGGTGAAGGAGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022636600 7:32142181-32142203 CAGAAGGAGAAGGGGGAAGGAGG + Intronic
1023055169 7:36285047-36285069 GAGCAGGAGAGGGGGGAAGGAGG + Intronic
1023149128 7:37183193-37183215 CAGAAGGAGAAGGAGGAAGGAGG + Intronic
1023839628 7:44089058-44089080 GAGCAGGCCCAGAGGGAAGGAGG - Intergenic
1024135073 7:46398536-46398558 CAGCAGGAATATGGGGAAGTGGG - Intergenic
1024421894 7:49177630-49177652 CAGCAAGCCTTTGGGGAAGGAGG - Intergenic
1024676009 7:51638448-51638470 CAGGAGGAGAAGGTGGAAGGAGG + Intergenic
1024709037 7:51995291-51995313 CAGCTGTACTCTGGGGAAGGAGG + Intergenic
1025198714 7:56949445-56949467 GAGGAGGAATAGGGAGAAGGAGG - Intergenic
1025673234 7:63627486-63627508 GAGGAGGAATAGGGAGAAGGAGG + Intergenic
1026148431 7:67768325-67768347 CAGCAAGACCAGGGTAAAGGAGG + Intergenic
1026152884 7:67803030-67803052 CAGCAGGCATATGGGGAAGATGG + Intergenic
1026890641 7:73979807-73979829 CAGCAGGACTTGGGGCTTGGAGG + Intergenic
1027569689 7:79848390-79848412 CATCAGGACTGGGGGGCAGTAGG - Intergenic
1028268716 7:88759842-88759864 CAGCAGGACGCAGGGGGAGGCGG - Exonic
1031541436 7:122999590-122999612 CAGCTGCACTAGGTGGAGGGAGG + Intergenic
1032962041 7:137046862-137046884 AAGAAGGAGGAGGGGGAAGGAGG + Intergenic
1033262471 7:139855625-139855647 CAGCAGTGCTAGGAGGAAGTGGG + Intronic
1033464512 7:141578597-141578619 CAGCAGGAGTAGGGGCAGTGTGG + Intronic
1033653808 7:143360879-143360901 CTGCAGGACTCAGGGGAAGGAGG + Intronic
1034113306 7:148559394-148559416 CACCAGGCCTATGGGGAAGAAGG - Intergenic
1034397731 7:150839917-150839939 CAGCAGGGGTAGGGGGTAGTTGG + Intronic
1034438550 7:151075296-151075318 CAGCAGGTCCAGGTGGAAGCCGG - Exonic
1034927925 7:155138206-155138228 AAGCAGGACTGGGCAGAAGGAGG + Intergenic
1035010212 7:155708992-155709014 CAACAGGACAAGGGGTCAGGTGG - Intronic
1035161495 7:156953530-156953552 AAGCAATACAAGGGGGAAGGGGG - Intronic
1035235681 7:157496411-157496433 CAACAGGGGAAGGGGGAAGGGGG + Intergenic
1036726374 8:11224460-11224482 CAGGAGGAAGAGGGAGAAGGAGG + Intergenic
1037056268 8:14445534-14445556 CAGCTGGAGAAGGGGGCAGGTGG - Intronic
1037771233 8:21801296-21801318 CTGCAGGACTGGGAGGCAGGAGG + Intronic
1038065879 8:23963349-23963371 GAGCAGGAAAAGGGGGGAGGGGG - Intergenic
1039777621 8:40752317-40752339 CAAGAGGAGTAGGGGGAAGGAGG - Intronic
1039886892 8:41659893-41659915 AAGCCAGGCTAGGGGGAAGGAGG - Intronic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1041935128 8:63324895-63324917 AAGCAGGTCTGGGGGGAAGCTGG - Intergenic
1042598745 8:70477012-70477034 GGGCAGGACTAGGAGCAAGGAGG + Intergenic
1042711912 8:71726658-71726680 GAACTGGAGTAGGGGGAAGGAGG + Intergenic
1043180751 8:77083689-77083711 CAGCAGGACCAGCAGGAAGTGGG - Intergenic
1047422199 8:124716506-124716528 CACCAGGAGTAGGTGGAAGTGGG - Intronic
1047775641 8:128068083-128068105 CAGCAGGAACAGGGGGCAAGAGG - Intergenic
1048317295 8:133371609-133371631 AAGCAGGAGGAGGAGGAAGGAGG + Intergenic
1048508615 8:135042645-135042667 AAGCAGGATTAGGCAGAAGGAGG - Intergenic
1049231779 8:141488450-141488472 GAGGAGGGGTAGGGGGAAGGAGG - Intergenic
1049508928 8:143018268-143018290 CAGCAGGGCCGGGTGGAAGGAGG + Intronic
1049542515 8:143214998-143215020 CAGCAGCACTGGGGACAAGGCGG - Intergenic
1049623234 8:143608457-143608479 CACCAGGCCTTGGGGGAATGTGG + Intronic
1051562129 9:18453687-18453709 CTGTAGGACTTTGGGGAAGGTGG - Intergenic
1052968766 9:34363622-34363644 GAGCAGCAGCAGGGGGAAGGGGG - Intergenic
1053104640 9:35399294-35399316 CAGCAGGAGGAAGTGGAAGGAGG - Intronic
1055357751 9:75454791-75454813 CAGGGGGACTATGGGGAAGTTGG - Intergenic
1056671114 9:88627588-88627610 AAGGAGGATTGGGGGGAAGGTGG + Intergenic
1056739349 9:89240425-89240447 TAACAGGAATAGGGGGAAAGAGG - Intergenic
1056807075 9:89737119-89737141 ATGGAGGACTTGGGGGAAGGGGG - Intergenic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1057327411 9:94078001-94078023 CAGGGGGACTAGGGTGAAAGTGG - Intronic
1057610004 9:96533410-96533432 CAGCAAGCCTTGGGGAAAGGGGG - Intronic
1057719395 9:97519804-97519826 CAGCATGGCTCGGGGAAAGGAGG + Intronic
1057769478 9:97954855-97954877 GAGGAGGACTTGGAGGAAGGGGG - Intergenic
1058915641 9:109561741-109561763 CAGCAGCATTAGGAGGGAGGAGG + Intergenic
1059072459 9:111152946-111152968 AAGCAGGAGGAGGAGGAAGGAGG + Intergenic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059751242 9:117249613-117249635 CCTCAAGACCAGGGGGAAGGTGG - Intronic
1060190595 9:121589896-121589918 GAGCAGGACTGGGCAGAAGGAGG - Intronic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1060773305 9:126348298-126348320 CGGCAGGACAAAGGGGAATGTGG - Intronic
1060956175 9:127641955-127641977 CCGCAAGAGTAGGGGGAAGGAGG + Intronic
1061043660 9:128153211-128153233 CAGCAGTGCTGGGGGGCAGGGGG - Intronic
1061431851 9:130536313-130536335 CAGCAGGGCTAGGGGAGGGGTGG + Intergenic
1061995681 9:134181587-134181609 CAGCAGGACCCGTGGGCAGGTGG - Intergenic
1062219830 9:135409218-135409240 CCCCAGGAGAAGGGGGAAGGGGG + Intergenic
1062386003 9:136311816-136311838 CAGCAGGGCTGGGGGGCCGGGGG - Intergenic
1062469703 9:136697004-136697026 GAGGAGGAGGAGGGGGAAGGAGG - Intergenic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1062624013 9:137434903-137434925 TTGCAGGACTAGTGGGAAGGCGG - Exonic
1062701198 9:137904667-137904689 CAGCAGGAGGAGGGGGGAGGCGG - Intronic
1185492196 X:526244-526266 CAGCAGGGGTGGGGGGACGGCGG + Intergenic
1186421813 X:9432747-9432769 TTGCAGGATTAGGGGTAAGGAGG + Intergenic
1186545513 X:10445010-10445032 CAGCAGGTCTCGGGGGAGGCAGG + Intergenic
1187552129 X:20316524-20316546 CAGCAGGAGTAGGCAGAGGGAGG - Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1189332146 X:40151001-40151023 CAGCTGGCCAAGGGGAAAGGAGG + Intronic
1189494944 X:41500165-41500187 CAGCTGGACTAGGGTGATGATGG - Intergenic
1190533789 X:51407056-51407078 CAGCAGGACGAGGGGCAGGGAGG + Exonic
1190639969 X:52474902-52474924 CAGAAGGACATGGGGGAAGAAGG + Intergenic
1190647703 X:52537963-52537985 CAGAAGGACATGGGGGAAGAAGG - Intergenic
1190958419 X:55220580-55220602 CATCAGGACCTGGGGGAAGGCGG - Exonic
1191000980 X:55659338-55659360 CAGGAGGACATGGGGGAAGAAGG + Intergenic
1191840958 X:65513385-65513407 GAGCAGGGCCAGGGAGAAGGAGG - Intronic
1192072290 X:67953759-67953781 CAACAGGACTATGGGAAAGGAGG + Intergenic
1192190063 X:68985574-68985596 GAGAAGGACAGGGGGGAAGGGGG + Intergenic
1192243045 X:69349855-69349877 GTGCAGGAGAAGGGGGAAGGAGG - Intergenic
1195696228 X:107669606-107669628 GAGGAGGAGGAGGGGGAAGGGGG - Intergenic
1196708884 X:118742169-118742191 CAGCAGGACAAGGGAGAGGAAGG - Intronic
1196772718 X:119310855-119310877 CAGATGGCATAGGGGGAAGGAGG - Intergenic
1197033671 X:121849247-121849269 GAGCAGGAGGAGGAGGAAGGGGG - Intergenic
1197896209 X:131318242-131318264 GATCAGGAACAGGGGGAAGGGGG - Intronic
1198138750 X:133781652-133781674 AAGCATGCCTAGTGGGAAGGTGG + Intronic
1198506755 X:137308872-137308894 CAGGAGGAATAGAGTGAAGGAGG - Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1200049850 X:153422975-153422997 CTGCAGGGCTAAGGGGAAGAGGG - Intergenic
1200880817 Y:8209817-8209839 TAGAAGGACTAGGGAGAATGAGG - Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1202390895 Y:24369443-24369465 TAGCAGGGGTAGGGGGACGGGGG + Intergenic
1202479889 Y:25300673-25300695 TAGCAGGGGTAGGGGGACGGGGG - Intergenic