ID: 932126742

View in Genome Browser
Species Human (GRCh38)
Location 2:69151649-69151671
Sequence CTGGATTCACAGACCCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 117}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932126732_932126742 -2 Left 932126732 2:69151628-69151650 CCGTTGCTCTGCCCCCACCCCCT 0: 1
1: 0
2: 12
3: 158
4: 1268
Right 932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG 0: 1
1: 0
2: 1
3: 11
4: 117
932126728_932126742 20 Left 932126728 2:69151606-69151628 CCTCGCCTCCCAGGTTCAGCAGC 0: 1
1: 0
2: 1
3: 52
4: 700
Right 932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG 0: 1
1: 0
2: 1
3: 11
4: 117
932126729_932126742 15 Left 932126729 2:69151611-69151633 CCTCCCAGGTTCAGCAGCCGTTG 0: 1
1: 0
2: 2
3: 11
4: 137
Right 932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG 0: 1
1: 0
2: 1
3: 11
4: 117
932126731_932126742 11 Left 932126731 2:69151615-69151637 CCAGGTTCAGCAGCCGTTGCTCT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG 0: 1
1: 0
2: 1
3: 11
4: 117
932126727_932126742 21 Left 932126727 2:69151605-69151627 CCCTCGCCTCCCAGGTTCAGCAG 0: 1
1: 3
2: 100
3: 1983
4: 22567
Right 932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG 0: 1
1: 0
2: 1
3: 11
4: 117
932126730_932126742 12 Left 932126730 2:69151614-69151636 CCCAGGTTCAGCAGCCGTTGCTC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG 0: 1
1: 0
2: 1
3: 11
4: 117
932126726_932126742 22 Left 932126726 2:69151604-69151626 CCCCTCGCCTCCCAGGTTCAGCA 0: 1
1: 0
2: 2
3: 27
4: 292
Right 932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG 0: 1
1: 0
2: 1
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932126742 Original CRISPR CTGGATTCACAGACCCTACA AGG Intronic
900480120 1:2894155-2894177 CTGGATTTGCAGACCCTGCCAGG - Intergenic
904339818 1:29827514-29827536 CTGGGTGCACAGACCCTCCTGGG + Intergenic
904817803 1:33219035-33219057 CTTGATTCACTGACCCTTAAGGG + Intergenic
905208333 1:36355881-36355903 CTGGATACACAGAACCTGTATGG - Intronic
906154621 1:43606686-43606708 CTGGTCTCCCAGACCCTACAAGG - Intronic
907010177 1:50955702-50955724 CATGATTCACAGTACCTACAAGG + Intronic
907393189 1:54171980-54172002 CAGGCTGCACAGAACCTACACGG + Intronic
911892830 1:103394134-103394156 CTGGATACACATACCCTCCCAGG - Intergenic
914225537 1:145716904-145716926 CAGGATGGACAGACACTACATGG + Intergenic
914422234 1:147539997-147540019 GTGGACTCACAGACCTAACAAGG - Intergenic
916046198 1:161001441-161001463 CTCCATTCACAGACCCTAAGAGG + Intronic
917502424 1:175597945-175597967 CTGGATTTAAAGACCCTAGCTGG - Intronic
923146533 1:231202461-231202483 GTGGGTTCAGAGACCCTAGAGGG + Intronic
924142310 1:241038268-241038290 CTGGATTTTCTAACCCTACAAGG - Intronic
1063506082 10:6600837-6600859 CTGGATTCGCAGGCTCTGCATGG + Intergenic
1068987262 10:63118764-63118786 CTGTAGTCACAAAACCTACAAGG - Intergenic
1069868721 10:71520350-71520372 CTGGTTTCACAGAGTCTACGTGG - Intronic
1072196426 10:93120477-93120499 CTGGAACCACAGACCCCTCAGGG - Intergenic
1074971686 10:118544326-118544348 CTGGATCCACACACGCTCCAGGG + Intergenic
1077336906 11:2009359-2009381 CTGGATCCACAGGCCCTGGATGG - Intergenic
1078022929 11:7670509-7670531 CTGGGCTCACAGATACTACAGGG + Intronic
1078187798 11:9066968-9066990 CTGCATACACAGACACCACAGGG - Intronic
1080124749 11:28719858-28719880 CTGGAGTCACAGTCCATAGAAGG - Intergenic
1088364989 11:109031162-109031184 CTGGTTCCACAGCCCCCACAGGG - Intergenic
1089167056 11:116485446-116485468 CTGGCTTCACTGATGCTACAAGG - Intergenic
1090433619 11:126667679-126667701 CTGGATTCTGAGACCCTTCTTGG + Intronic
1090488377 11:127135484-127135506 CTGCATACACAGACACCACAGGG + Intergenic
1202819890 11_KI270721v1_random:64541-64563 CTGGATCCACAGGCCCTGGATGG - Intergenic
1092017857 12:5174056-5174078 CTGGACTCAGAGAAGCTACAAGG + Intergenic
1092442873 12:8524424-8524446 CTGGATGCATACACCCTACCGGG - Intergenic
1101150813 12:101880813-101880835 CTCAAATCACAGACCCTACAAGG + Intronic
1102083241 12:110115353-110115375 CTGGATTCACTGACCCCACAAGG + Intergenic
1104729577 12:131097592-131097614 CTGGAGTCACAGATCCGCCAGGG + Intronic
1104856602 12:131905134-131905156 CAGGATCCACAGACACTGCAGGG - Intronic
1108365923 13:49712567-49712589 GTGTCTTCAGAGACCCTACAAGG + Intronic
1110197024 13:72801488-72801510 ATGCATACACAGACCTTACATGG + Intronic
1110791602 13:79592137-79592159 ATGGACTCACAGTTCCTACATGG - Intergenic
1110983889 13:81939175-81939197 CTGAATTCACAGGGCCTACTGGG + Intergenic
1114040603 14:18674741-18674763 CTGGATTCTCAGTCCTCACATGG + Intergenic
1114045641 14:18873252-18873274 CTGGATTCTCAGTCCTCACATGG + Intergenic
1114118570 14:19646216-19646238 CTGGATTCTCAGTCCTCACATGG - Intergenic
1114323297 14:21565048-21565070 CTGGATCCACACTCCCTTCAGGG - Intergenic
1114700574 14:24674056-24674078 CTGTAATCACACACCCCACATGG - Intergenic
1116036430 14:39633128-39633150 CTGAATACTCACACCCTACAAGG - Intergenic
1118080835 14:62358193-62358215 CTGAATTCACCGACAATACATGG - Intergenic
1118731635 14:68670930-68670952 GTGGGCTCACAGACCCTCCAAGG + Intronic
1119515738 14:75246868-75246890 CTGGATTTACAGACTCTCCTGGG - Intronic
1120176284 14:81297022-81297044 TTGGATTCTCTAACCCTACAGGG + Intronic
1120519735 14:85512482-85512504 CTGGCTTCAAAAACCCTAAATGG - Intergenic
1121089409 14:91170761-91170783 CTGGTTCCACAGACCCTTCCTGG + Intronic
1122348305 14:101073728-101073750 CTGGCCTCACAGATCCCACAGGG + Intergenic
1142314717 16:89336384-89336406 CTGGATTCAAAGACCCAGGAAGG + Intronic
1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG + Intergenic
1150635325 17:66909070-66909092 CTGGAAACACAGACCCTAAAGGG + Intergenic
1151255333 17:72872220-72872242 CTGGATTTACAGACCCTCTGGGG + Intronic
1157593620 18:48850823-48850845 GTGGATTCTCAGACCCTTCGGGG - Intronic
1157913780 18:51644462-51644484 CAGGCTTCACACACCCTGCAGGG - Intergenic
1161041633 19:2113538-2113560 CTGGATTCCCAGGCTCTGCAAGG - Intronic
1161765984 19:6209167-6209189 CAGGGTTCCCAGACCCTCCAAGG - Intergenic
1162736218 19:12748524-12748546 CAGGCTTCACAGGCCCAACAGGG - Intergenic
1164756050 19:30690562-30690584 CTGGATTCACTGGCACTAAATGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926231067 2:11004525-11004547 ATGGATTCACAAGCCATACAAGG - Intergenic
929165860 2:38880746-38880768 CTGGAATCACTAAACCTACAGGG - Intronic
932126742 2:69151649-69151671 CTGGATTCACAGACCCTACAAGG + Intronic
932633537 2:73367929-73367951 CTGGATTAACAGGCCCAAAAGGG + Intergenic
933560692 2:83882520-83882542 CAGGATACACTGACACTACAGGG - Intergenic
935095955 2:99944507-99944529 CTGAATTCACACACCCTGCTGGG + Intronic
937444711 2:121948015-121948037 GAGGATTTACAGATCCTACAAGG + Intergenic
937829434 2:126403395-126403417 CAGGATTCACAGGGCCTGCAGGG + Intergenic
938269582 2:129957805-129957827 CTGGATTCTCAGTCCTCACATGG - Intergenic
944138574 2:196429335-196429357 CTGGCATCCCAGACCCCACAAGG - Intronic
1170960381 20:21020254-21020276 TTGGATTCGCAGACCCCACGGGG + Intergenic
1174997506 20:55586858-55586880 CTTGATTTACAGACACTACAGGG + Intergenic
1176920252 21:14679580-14679602 ATGGATTCTCAGGCCCTTCAAGG + Intergenic
1178145836 21:29738678-29738700 ATGAATTCACAGACTGTACAAGG + Intronic
1179570758 21:42277570-42277592 CTGGACTCACACACCCTCCACGG + Intronic
1180464172 22:15595869-15595891 CTGGATTCTCAGTCCTCACATGG + Intergenic
1183007801 22:34917955-34917977 CTGTATTCACAGCACCTAGAAGG + Intergenic
1184452053 22:44588735-44588757 CTGGATTCACGTTCCCTCCAGGG + Intergenic
1184527545 22:45034359-45034381 CTGCATTCAAAGACTTTACATGG + Intergenic
1185175751 22:49325571-49325593 CTGGCTACACTGACCCAACAGGG - Intergenic
1185334019 22:50263526-50263548 CTGGGCTCTCAGACCCTCCAGGG + Intergenic
952352224 3:32551285-32551307 CTGGAATGACAGACTCTCCATGG - Intronic
955475958 3:59336278-59336300 CTGCAGTCACATACCTTACAGGG - Intergenic
955555669 3:60134606-60134628 CTAGATTCACAAATCTTACAAGG + Intronic
958991799 3:100854693-100854715 TTGCATTCACAGAACATACATGG + Intronic
967962383 3:194936494-194936516 CTGGCTTCACAGAAAGTACAAGG - Intergenic
968158813 3:196407022-196407044 CCGACTTCACAGAGCCTACACGG + Intronic
970377370 4:15472883-15472905 AAGGTTTCACTGACCCTACAGGG - Intronic
971842937 4:31877869-31877891 CTGTATTCACAGTCCCAACTTGG + Intergenic
975545904 4:75560421-75560443 CTGAAGTCACAGACCATAAATGG + Intronic
985839417 5:2295001-2295023 CTTGAGTCACAGCTCCTACAAGG - Intergenic
986038065 5:3959983-3960005 CTAGATCCACAGAGCCTCCAGGG - Intergenic
986415246 5:7521685-7521707 CTGGTTTCTCAGACCCAGCAGGG - Intronic
992732522 5:79687679-79687701 TTGAATTCACAAATCCTACATGG + Intergenic
996368338 5:122726385-122726407 CTGGTTTCACTGACTCTACTGGG - Intergenic
1001793964 5:174486126-174486148 CTGGATTCACCTACCTCACAAGG + Intergenic
1006971409 6:38049497-38049519 CTGGTTACACACACCCTACTGGG + Intronic
1008571091 6:52817303-52817325 CTGGTTTCACAGCCACTTCATGG - Intergenic
1015655521 6:135514077-135514099 CTCTATTAACAGAGCCTACATGG + Intergenic
1015770437 6:136762843-136762865 GTGGATTCACAGAGAGTACAAGG - Intronic
1016690026 6:146926812-146926834 GCGGATTCACAGACACTCCAGGG - Intergenic
1019003565 6:168777522-168777544 CTGGGCTCACAGGCCCAACAGGG - Intergenic
1019585864 7:1803108-1803130 CTGGCTTCACACCCTCTACATGG + Intergenic
1019914482 7:4123968-4123990 GTGGTTTCAGAGACCCCACAGGG + Intronic
1022307311 7:29159347-29159369 CTGGCATCACAGAGCCTTCATGG + Intronic
1023349069 7:39301301-39301323 GTGGACTGACAGATCCTACAGGG - Intronic
1024458756 7:49638202-49638224 CTGGCATCACAGTCCCCACAGGG + Intergenic
1038958642 8:32494792-32494814 CTGGATGCACAGACACAAAAGGG - Intronic
1042433286 8:68734229-68734251 CTGGAACAACAGACCCTACATGG - Intronic
1043538826 8:81236194-81236216 GTGGCTGCACAGACCCTACTCGG - Intergenic
1044926980 8:97217893-97217915 CTAGAATGACAGCCCCTACAGGG - Intergenic
1047686573 8:127311112-127311134 ATGGAGTCACAGACACTAAATGG - Intergenic
1048085942 8:131179554-131179576 ATGGAATCACAGTCCCTCCATGG - Intergenic
1049329182 8:142040956-142040978 CTGAATCAACAGACCCTGCAGGG - Intergenic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1058370658 9:104263304-104263326 CTGGATTCACAGACAATAGTTGG + Intergenic
1059371678 9:113844619-113844641 CTGGATCCACAAGCCATACAAGG - Intergenic
1059865779 9:118512457-118512479 CTGGATTCCCAGGCACTACAAGG - Intergenic
1061434922 9:130555068-130555090 CTGGATTCTCAGACACTGCGGGG - Intergenic
1061615122 9:131774346-131774368 CTGGACCCACAGACCCTTCCTGG - Intergenic
1062033573 9:134372806-134372828 CTGGGGTCACACAGCCTACAAGG - Intronic
1062702733 9:137916513-137916535 CTCGCTGCACTGACCCTACAGGG - Intronic
1062711481 9:137977569-137977591 CTGGATTCTCAGACCCCGCAGGG + Intronic
1185468874 X:370905-370927 GTGGACGCACAGACCCTACACGG - Intronic
1188906095 X:35793615-35793637 CTGGTTACCCAGACCCTACATGG + Intergenic
1196080776 X:111628119-111628141 CTGGATCCACAGTCCCTTCCTGG + Intergenic
1196122665 X:112067314-112067336 CTGGATTCAGAGGCCCCACAGGG - Intronic
1199991963 X:152992557-152992579 CAGGGTTCACAGACTCTGCAGGG - Intronic