ID: 932126912

View in Genome Browser
Species Human (GRCh38)
Location 2:69152888-69152910
Sequence ATGTCTCCCCAGAATAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932126909_932126912 11 Left 932126909 2:69152854-69152876 CCCCATCAGTGTCATATGGAGTC 0: 1
1: 0
2: 1
3: 10
4: 108
Right 932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 121
932126906_932126912 17 Left 932126906 2:69152848-69152870 CCTCCTCCCCATCAGTGTCATAT 0: 1
1: 0
2: 1
3: 28
4: 238
Right 932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 121
932126905_932126912 21 Left 932126905 2:69152844-69152866 CCTGCCTCCTCCCCATCAGTGTC 0: 1
1: 1
2: 15
3: 103
4: 562
Right 932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 121
932126911_932126912 9 Left 932126911 2:69152856-69152878 CCATCAGTGTCATATGGAGTCAT 0: 1
1: 0
2: 0
3: 18
4: 121
Right 932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 121
932126910_932126912 10 Left 932126910 2:69152855-69152877 CCCATCAGTGTCATATGGAGTCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 121
932126908_932126912 14 Left 932126908 2:69152851-69152873 CCTCCCCATCAGTGTCATATGGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932126912 Original CRISPR ATGTCTCCCCAGAATAGCTT AGG Intronic
901025296 1:6275951-6275973 ATGTGTCCCCAGATTAGCCGAGG - Intronic
901178348 1:7321533-7321555 ATGTATGCCCAGAATACCTGGGG - Intronic
904672490 1:32176238-32176260 ATATCCCCCGAGAATGGCTTGGG + Exonic
906988766 1:50714687-50714709 ATATCCCCCAAGAATGGCTTGGG + Intronic
912348797 1:108991442-108991464 ATGTCTCCAGAGAGTAACTTTGG - Intronic
914518136 1:148391460-148391482 ATTTTTCCCAAAAATAGCTTGGG + Intergenic
920953168 1:210592484-210592506 ATTTTTCCTCAGAATAGCTTTGG + Intronic
922388154 1:225109167-225109189 CTTTTTGCCCAGAATAGCTTTGG + Intronic
923292761 1:232562514-232562536 ATGTGTCCACATAATAGATTGGG - Intergenic
924123214 1:240823663-240823685 GTGTCTCCCCAGACTGCCTTTGG + Intronic
924300423 1:242632316-242632338 CTGTGTCCCCAGAATACCTAGGG - Intergenic
924773291 1:247095608-247095630 ATGCCTCCACAAAATAGGTTGGG - Intergenic
1062923755 10:1299183-1299205 GTGACTCCCCAGATTAGCTGGGG - Intronic
1064516341 10:16153045-16153067 ATGGATACCCAGAATAGCCTGGG + Intergenic
1064656670 10:17562836-17562858 ACGGCTTCCCAGAAAAGCTTTGG + Intergenic
1069678629 10:70267624-70267646 ATGACTTCCCAGAAGAGCTGTGG - Intronic
1070151754 10:73809561-73809583 ATGTCTCTCCAGACTAGCTCAGG - Intronic
1070808006 10:79282023-79282045 ACGTGTCCTCAGAATAGCCTGGG - Intronic
1074068957 10:110047800-110047822 ATATATCCTCAGAATATCTTGGG + Intronic
1074267932 10:111923955-111923977 ATTCCTCCACAGAGTAGCTTGGG + Intergenic
1078667723 11:13340263-13340285 ATGTCACCCCAGAATCCCTGGGG + Intronic
1079354668 11:19720223-19720245 ATGTGTTCCTAGAATGGCTTGGG + Intronic
1079643204 11:22831705-22831727 TTGTATCCTCAGAATATCTTTGG + Intergenic
1081215296 11:40389128-40389150 AATTCTCCCCTGTATAGCTTTGG - Intronic
1089991400 11:122864539-122864561 AAGTCTTCCCAGAGCAGCTTGGG - Intronic
1091847468 12:3668613-3668635 ATCTCTTCCCTGAAAAGCTTTGG + Intronic
1093156608 12:15693530-15693552 ATGTCTCTCAATAGTAGCTTAGG + Intronic
1094396344 12:30010201-30010223 ATGTTTTCCCAAAGTAGCTTAGG + Intergenic
1095316659 12:40770239-40770261 ATGCCTCTCCAGAATAACTGAGG - Intronic
1095563495 12:43593249-43593271 ATTTCTCCCCACCACAGCTTAGG - Intergenic
1095934216 12:47659184-47659206 GTATCTCCACAGATTAGCTTTGG - Intergenic
1103369580 12:120408704-120408726 ATGTCTCCCAAGAGTAGTTAGGG - Intergenic
1106142825 13:27025556-27025578 ATGTCTCCCTAGCATGGGTTTGG + Intergenic
1107956119 13:45513591-45513613 ATCTCTCCACAGAATAATTTGGG + Intronic
1108320844 13:49288942-49288964 ATTTGTCCCCAGGATAGCTCTGG - Intronic
1110213702 13:73003202-73003224 ATGATTCCCTAGAAGAGCTTTGG + Intronic
1117458722 14:55923638-55923660 ATTTCTCCCACGAATAGCTATGG + Intergenic
1118263713 14:64272820-64272842 ATTTTTGCTCAGAATAGCTTTGG + Intronic
1118838689 14:69495012-69495034 AGCTGTCCCCAGAATGGCTTGGG - Intronic
1119758561 14:77135606-77135628 ATGTCGGCACAGATTAGCTTGGG + Intronic
1120311001 14:82828331-82828353 TTGTCTCTCCAGAAAACCTTGGG + Intergenic
1123031534 14:105454071-105454093 ATGTCGCCCCACAAGAGCTCTGG + Intronic
1123727097 15:23114070-23114092 ATGTCTCACTTGATTAGCTTAGG + Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1131467453 15:92667289-92667311 ATCTTTCCCCAGAAAAGCTGAGG + Intronic
1139207421 16:65042823-65042845 ATGTCTGTCCACAATAGATTTGG - Intronic
1139570946 16:67811837-67811859 GTGTCTGCCCAGATGAGCTTGGG - Intronic
1141287984 16:82690512-82690534 TTTTCTATCCAGAATAGCTTAGG - Intronic
1142182125 16:88676429-88676451 CCGGCTCCCCAGAAGAGCTTGGG - Intergenic
1146706539 17:35004445-35004467 AGGTCTCCCCAGAGTGGATTTGG + Exonic
1148454027 17:47801275-47801297 GTGTCTCCCCAGAAAGGCTGGGG - Intergenic
1149224935 17:54458828-54458850 ATGTGTTCCCAGAATAGCAAGGG + Intergenic
1156539649 18:37897117-37897139 ATGTCTTCCCAGTGTAGCCTTGG - Intergenic
1159522157 18:69540069-69540091 ATGTCTCCTGAGAACAGCATGGG + Intronic
1160497171 18:79382553-79382575 AGTTCTCCCCAAAATAGCTCGGG + Intergenic
932126912 2:69152888-69152910 ATGTCTCCCCAGAATAGCTTAGG + Intronic
946516410 2:220416342-220416364 ATGCCTTCCCAGAATGGCTCAGG - Intergenic
1170048798 20:12116541-12116563 AGTTCTCCCCAGCAGAGCTTGGG + Intergenic
1173666003 20:44763515-44763537 AGTACTCCCCAGAATGGCTTGGG - Intronic
1175163865 20:57029389-57029411 ATGTCTCCCCAGAGCAGGTAAGG - Intergenic
1177298138 21:19203754-19203776 CTGTCTGCTAAGAATAGCTTTGG - Intergenic
1178017692 21:28369147-28369169 CTGCCTGCTCAGAATAGCTTTGG + Intergenic
1179198420 21:39188733-39188755 CGTTCTCCCCAGAATAGGTTAGG + Intronic
1181674305 22:24441795-24441817 TTGTCTCCACAGAGCAGCTTGGG + Exonic
1183063355 22:35348564-35348586 ATGTCTTCCCAACTTAGCTTTGG - Intergenic
1185269429 22:49922220-49922242 CTGTCTGCCCAGAATAGCCTAGG - Intronic
949293502 3:2493766-2493788 AAGTCTCCCCATAATAGTTCTGG - Intronic
952132257 3:30378348-30378370 CTTTCTCCTCAGGATAGCTTTGG + Intergenic
952967690 3:38631313-38631335 TTGTCTCCCCAGACCAGATTGGG - Intronic
953298675 3:41749762-41749784 ATGTCTCACTTGATTAGCTTAGG - Intronic
954110688 3:48431170-48431192 ATGGCTCCCCAGAATGGCATGGG - Intergenic
955672415 3:61415754-61415776 TTGGCTCCTCAGAATAGCCTTGG - Intergenic
957235077 3:77576989-77577011 ATGTCTTCTCAGAATAATTTTGG + Intronic
958993443 3:100874039-100874061 ATGTCTCTAGAGAATACCTTGGG - Intronic
960468796 3:118033676-118033698 AAGTCTCCCCAGAAATGATTTGG + Intergenic
963370407 3:144392604-144392626 ATGTCACCCAAGAATTGTTTTGG - Intergenic
970250324 4:14108342-14108364 ATGTTTCCCCAGCATTGCCTTGG + Intergenic
970589486 4:17546787-17546809 AGATCTCTCAAGAATAGCTTGGG + Intergenic
973659223 4:53085573-53085595 ATTTTTGCACAGAATAGCTTTGG - Intronic
973944747 4:55945063-55945085 ATCCCTCCCCATACTAGCTTAGG - Intergenic
974844266 4:67332045-67332067 CTGTCTTTCCAGAATAGCTTTGG - Intergenic
975784049 4:77868623-77868645 GAGTCTCCCCTGAATAGATTAGG - Intronic
978255443 4:106686879-106686901 ATGTTTCACCAGAATCACTTTGG - Intergenic
979879367 4:125935500-125935522 ATGTTTGCTTAGAATAGCTTTGG - Intergenic
983254531 4:165382903-165382925 ATGTCATCACAGAATAGGTTTGG - Intronic
987166035 5:15199516-15199538 CTGACTCTCCAGAATAGCTAGGG + Intergenic
990979135 5:61586061-61586083 ATGTCTTTCCTGAATAGGTTAGG - Intergenic
992384479 5:76270596-76270618 ATGACACTACAGAATAGCTTGGG + Intronic
993407831 5:87533988-87534010 ATGTATCAGGAGAATAGCTTGGG - Intergenic
993614900 5:90098623-90098645 TTATCTCCCTAGAATATCTTTGG - Intergenic
994737213 5:103569832-103569854 TTGCCTCCCCTGCATAGCTTGGG + Intergenic
995414597 5:111895004-111895026 AAGTTTCCAGAGAATAGCTTTGG + Intronic
996936514 5:128955636-128955658 ATTTCTCCCCTGAATATCTCAGG - Intronic
998143499 5:139712492-139712514 AAGTTTCCCCAGAAGGGCTTGGG + Intergenic
999263538 5:150252022-150252044 ATCTCTCCCCAGAAGTGCTGCGG - Exonic
1000383219 5:160647578-160647600 CTTTCTCCCCAGAACAGCTCAGG - Intronic
1001785538 5:174409439-174409461 GAGTCTTCCCAGAATGGCTTTGG - Intergenic
1007271188 6:40638422-40638444 ATGCCACCCCAGAATGGCTCAGG - Intergenic
1009649367 6:66453411-66453433 ATTTCTCTCCAAAATAGATTTGG - Intergenic
1020147194 7:5653732-5653754 CTGTCTCCCCAGACTAGATCAGG - Intronic
1025715703 7:63953495-63953517 ATGTCTCCCCAGGAGAGCTGGGG + Intergenic
1025728228 7:64087543-64087565 ATGTCTCCCCAGACTGGCTAGGG - Intronic
1028787406 7:94811345-94811367 CTGCCTCCCCAGGATTGCTTTGG - Intergenic
1031016237 7:116579697-116579719 GTGTCTATCAAGAATAGCTTGGG + Intergenic
1031213009 7:118855590-118855612 ATGTCTTTCCAGTACAGCTTGGG - Intergenic
1033022075 7:137735704-137735726 CTTTCTTCCCAGAATTGCTTTGG - Intronic
1033617356 7:143029397-143029419 ATGTCCTCCCAGAGGAGCTTAGG + Intergenic
1033833325 7:145279234-145279256 CTTTTTGCCCAGAATAGCTTTGG + Intergenic
1034669684 7:152848593-152848615 CTGTCTCTCCAGAATATCATCGG + Intronic
1035894633 8:3385756-3385778 ATGTCTTTCCAGAAAAACTTAGG + Intronic
1036507331 8:9367502-9367524 AATACTCCCCAGAAGAGCTTCGG + Intergenic
1041109661 8:54472572-54472594 CTGTCTCCCCAGAAGAACTTTGG + Intergenic
1053481563 9:38420209-38420231 ATGACACCCCAGAGTAGTTTGGG - Intronic
1055483663 9:76735023-76735045 ATGACTCCCCAGGATGGCTCTGG - Intronic
1056588878 9:87949250-87949272 AAATCTCCCCAGTATAACTTTGG + Intergenic
1060736751 9:126071005-126071027 ATGTGTGCCCATAATAGCATTGG - Intergenic
1061072119 9:128317264-128317286 ATGCCACCCCAGGATGGCTTTGG + Intronic
1061429424 9:130521826-130521848 TTGGCTCCCCAGAATACCTGTGG - Intergenic
1203560694 Un_KI270744v1:53986-54008 CTGTCTCCCCAGATTAACTGTGG + Intergenic
1186439624 X:9574536-9574558 AAGTCTCCCCAGCAAAGGTTCGG - Intronic
1186492375 X:9983971-9983993 CAGTTTCCCCAGAATAACTTGGG - Intergenic
1193670642 X:84381385-84381407 ATTTTTGCCTAGAATAGCTTTGG - Intronic
1193756289 X:85412695-85412717 ATGTTTGCTCAGGATAGCTTTGG + Intergenic
1198416334 X:136423771-136423793 TTGTCTCCCCAGACAAGTTTAGG - Intergenic
1199304440 X:146250957-146250979 GTTTTTGCCCAGAATAGCTTTGG - Intergenic
1199501295 X:148509499-148509521 AAGTCTCCCAAGAAGAGCTTTGG + Intronic
1199888728 X:152051774-152051796 AATTCTTCACAGAATAGCTTTGG + Intergenic
1200870224 Y:8089785-8089807 ATGTCTTCCCTGACTAGCTCTGG + Intergenic
1202249339 Y:22853547-22853569 ATGTCTCCCCGGATTGGCTAGGG + Intergenic
1202402325 Y:24487295-24487317 ATGTCTCCCCGGATTGGCTAGGG + Intergenic
1202468455 Y:25182789-25182811 ATGTCTCCCCGGATTGGCTAGGG - Intergenic