ID: 932127980

View in Genome Browser
Species Human (GRCh38)
Location 2:69161838-69161860
Sequence CTTCTCATGCAGAATTTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 309}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932127980 Original CRISPR CTTCTCATGCAGAATTTAAA AGG Intronic
900379132 1:2375159-2375181 ATTTTCATGGAAAATTTAAATGG + Intronic
905952783 1:41965882-41965904 CTTCTCATGGAGTATTTTACTGG - Intronic
906014146 1:42558799-42558821 CTTCTCATGGAGTATCTTAATGG - Intronic
906316853 1:44791940-44791962 CCTCTCATGGGGAATTTAAAAGG - Intergenic
906422738 1:45684473-45684495 CTTATCATTCTAAATTTAAATGG + Intronic
910487563 1:87732252-87732274 CTTTTCTCACAGAATTTAAAAGG - Intergenic
910566870 1:88653648-88653670 CTTGACATGAAGAATTGAAAAGG + Intergenic
910941209 1:92535951-92535973 GTTCTCCTTCAGCATTTAAAAGG - Intronic
911538498 1:99129593-99129615 CTTCTCATGCAGTATCTTACTGG + Intergenic
913368601 1:118071026-118071048 TTTTTCATGGAGAATTTAAATGG + Intronic
914218308 1:145654749-145654771 CTTCTCATGGAGTATTTTACTGG + Intronic
914470870 1:147977440-147977462 CTTCTCATGGAGTATTTTACTGG + Intronic
915442919 1:155957481-155957503 CAGCTCATGCTGAATTTGAAAGG + Intronic
916231233 1:162543525-162543547 CTTCTCAAGCATAATTTAGTGGG + Intergenic
916320085 1:163495083-163495105 AATCTCATTCAGAATTCAAAAGG + Intergenic
916403565 1:164474810-164474832 TTTCTCTTGCAGAATTGAGATGG - Intergenic
917189484 1:172399550-172399572 CTTCTCACGAAGCATTTAATTGG + Intronic
917569306 1:176248237-176248259 ATACACATGCATAATTTAAAAGG + Intergenic
917890090 1:179428135-179428157 ATTCTGATGCAGAATTTTTAAGG + Intronic
919353594 1:196492788-196492810 CTACTTATTCAGAATTTTAAAGG + Intronic
920932050 1:210398106-210398128 CTCCTCTTGCAGTATTTTAATGG + Intronic
921736248 1:218632270-218632292 CTTCTCATGGAGTATCTTAATGG + Intergenic
923157321 1:231290065-231290087 CTTCTAAGGCAGAAAGTAAAGGG - Intergenic
923584284 1:235251834-235251856 CTTGCAATTCAGAATTTAAAAGG - Intronic
924045338 1:240023996-240024018 CTTCTCATTCTTAATTTTAAAGG - Intronic
1064486504 10:15797968-15797990 CTTCTCAGCCAGAATTTCAAAGG - Intronic
1065994719 10:31047441-31047463 CTTCTCATGCTGTGTTTAATAGG + Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067199795 10:44157118-44157140 CTTCTCAGGCAGTATCTATAGGG + Intergenic
1068126711 10:52850101-52850123 CTTCTCATGGAGTATCTTAATGG + Intergenic
1069650618 10:70044713-70044735 CTTTTCATGGACAATTTCAAGGG + Intergenic
1070273957 10:74986420-74986442 CTGCTCTTGCACAATGTAAATGG + Intronic
1070933632 10:80277477-80277499 CATCTCATGCAGATCTTACATGG - Intronic
1072008368 10:91280082-91280104 GCTCACAAGCAGAATTTAAAAGG + Exonic
1072704901 10:97674069-97674091 TTTCTGATGCAGAATATAATAGG - Exonic
1073716780 10:106116248-106116270 CTTCTCATGGAGTATTTTACTGG - Intergenic
1074862381 10:117520629-117520651 CTTCTCAAGCAGAGCTAAAATGG - Intergenic
1074961390 10:118449042-118449064 CTTCTCATGCACATTTAACATGG - Intergenic
1076143894 10:128101400-128101422 GTTCTCATGCAGAATCAGAAAGG - Exonic
1078677648 11:13438514-13438536 CTTCTATTGCATAATTTTAAAGG - Intronic
1079733647 11:23968051-23968073 CTTCTAATGCAAATTCTAAAAGG - Intergenic
1080241394 11:30130846-30130868 CTTCTAATGAAGAACTTCAAAGG - Intergenic
1080876404 11:36278898-36278920 ATTCTCATGCAGAAGGAAAAGGG - Intronic
1081090903 11:38865404-38865426 ATACTAATGCAGAATGTAAATGG - Intergenic
1081454787 11:43211183-43211205 CTTCTCATGGAGTATCTTAATGG + Intergenic
1082652655 11:55812686-55812708 CTTCTAATGAAGAACTTACAAGG + Intergenic
1082821825 11:57549325-57549347 CCCCTCAGGAAGAATTTAAAGGG - Intronic
1084855861 11:71985778-71985800 CTACTCTTGTAGCATTTAAAAGG + Intronic
1085334998 11:75686618-75686640 CTTCTCATGGAGTATCTAACTGG + Intergenic
1086668416 11:89515211-89515233 CTTCTGGTGAAGATTTTAAAGGG - Intergenic
1087328835 11:96754594-96754616 CTTCTCATGGAGTATTTTACTGG + Intergenic
1088005005 11:104928729-104928751 CTTCTCATGGAGTATCTTAATGG - Intergenic
1093054658 12:14543929-14543951 CTACTCTTGGATAATTTAAATGG + Intronic
1093308718 12:17551329-17551351 CCTCTGAGGCACAATTTAAAGGG - Intergenic
1093522668 12:20068427-20068449 CTTCTCATGGAGTATCTTAATGG - Intergenic
1093726431 12:22516251-22516273 TTTCTCATGGAGACTTCAAATGG - Intronic
1094328981 12:29272120-29272142 CTTCTCATGGAGTATCTTAATGG + Intronic
1094776220 12:33731085-33731107 CTTCTCATGGAGTATCTTAATGG + Intergenic
1095666980 12:44814117-44814139 CTTGTCAGGCAGCATTTCAATGG - Intronic
1097353537 12:58575881-58575903 CTTCTCATGAAAAAGTTACAAGG - Intronic
1098577681 12:72062174-72062196 CTTCTCATGCACATTTGTAAAGG + Intronic
1098941984 12:76548608-76548630 CATCTCATCCAGCATTTAAAGGG + Intronic
1099659284 12:85534662-85534684 ATTTTCAAGCAAAATTTAAAAGG - Intergenic
1105569702 13:21590094-21590116 CTTCTCATGGAGTATCTTAATGG - Intronic
1105741525 13:23329053-23329075 TTTCTTTTGCAGAATGTAAAAGG - Exonic
1105987771 13:25586085-25586107 ATTCCCTTGGAGAATTTAAAAGG + Intronic
1107248019 13:38320545-38320567 CTTCTCATGCAGCATCTTACTGG + Intergenic
1107360220 13:39609334-39609356 CTTCTCAAGACTAATTTAAAGGG + Intergenic
1108005933 13:45946484-45946506 CCTCTAACTCAGAATTTAAAAGG + Intergenic
1108160581 13:47633976-47633998 CTTCTCATGGAGTATCTTAACGG - Intergenic
1108266860 13:48719542-48719564 ATTCTTATGCACATTTTAAATGG - Intergenic
1109053402 13:57513913-57513935 GTTCTCATGGAGAATTTTAGAGG - Intergenic
1109646742 13:65268468-65268490 CTTAACATGCAGAATTTATAAGG - Intergenic
1109874930 13:68388495-68388517 CTTTTCAGGCAAAATTGAAAAGG - Intergenic
1110150063 13:72240500-72240522 CTACTCAGCCATAATTTAAAAGG + Intergenic
1110590492 13:77251536-77251558 CTTCTTTTGCAGAAATGAAATGG - Intronic
1111355004 13:87087575-87087597 CTTTTCATGAAGGATTTCAAAGG + Intergenic
1111377183 13:87396134-87396156 CATCCCAAGCAGAATTTAAAAGG + Intergenic
1111415406 13:87935381-87935403 AATCACATGCAAAATTTAAAAGG - Intergenic
1111427320 13:88103967-88103989 CTTCTCAGGCAGAAACTTAAGGG + Intergenic
1111874120 13:93871774-93871796 ATTCTCATTCAGAAATTAAGAGG - Intronic
1111958731 13:94785865-94785887 CTTCTAATGCAGAATATCAGGGG - Intergenic
1114706139 14:24728171-24728193 CTTCTCATGTAGTATCTTAATGG - Intergenic
1115924383 14:38414128-38414150 CTTCTCATGGAGTATTTTAGTGG - Intergenic
1116760025 14:49000749-49000771 CTTCTAATGAATATTTTAAAAGG + Intergenic
1116977575 14:51132825-51132847 CTTCTCATGGAGTATCTTAATGG - Intergenic
1117074896 14:52092300-52092322 CTTCTAATACAGAATGTATATGG - Intergenic
1118597589 14:67448029-67448051 TTTCTCATGCAAAATTTGATGGG - Intronic
1121146464 14:91587364-91587386 CTTTTCATGCAGCATCTATAGGG - Intronic
1126318241 15:47393721-47393743 ATTCTCATGCAGAAGGGAAAAGG + Intronic
1126387100 15:48105068-48105090 CCTATCATGCAGTATTTAATGGG + Intergenic
1126956111 15:53935564-53935586 GTTCTCATGGAGAATGAAAATGG + Intergenic
1127540335 15:59931505-59931527 ATTTTTATGCAAAATTTAAAGGG - Intergenic
1129554305 15:76489173-76489195 CCTCTCATGCATGATTTATAAGG - Intronic
1129870035 15:78934239-78934261 TTTCTCATGGAGAATTTCGATGG + Intronic
1129896735 15:79114027-79114049 CTTTTCAGGCAGAAATAAAAAGG - Intergenic
1132005740 15:98225532-98225554 CTTCTCTTGCGGAATTCATATGG - Intergenic
1132250376 15:100331554-100331576 CTTCTTATGCAGAGTCAAAATGG + Intronic
1137519437 16:49179627-49179649 CTTCTCATGCAGCTTGGAAATGG - Intergenic
1138352973 16:56356274-56356296 CTTCACATTTAGAATTTGAAAGG + Intronic
1140546000 16:75809957-75809979 CTTTACATACAAAATTTAAATGG + Intergenic
1141199115 16:81883533-81883555 CTTCTCATCCAGAGTTTCAGTGG - Intronic
1142911748 17:3099180-3099202 CTTCTCATGGAGTATTTTAGTGG - Intergenic
1144194926 17:12882704-12882726 CATCACATGCACAAATTAAAGGG - Intronic
1146282098 17:31551273-31551295 CTTCTCATCAGGAATTTGAAGGG - Intergenic
1146551959 17:33788173-33788195 CTAATTATCCAGAATTTAAAAGG + Intronic
1147238204 17:39072946-39072968 CTTCCCATGCAGATTTTTATGGG + Intronic
1150420521 17:65030357-65030379 CAGATCATGCAGAATTTGAAAGG + Intronic
1150932947 17:69604787-69604809 TTTCTCAGGCAGAATGCAAAAGG + Intergenic
1150973632 17:70058974-70058996 CTTTTCCTGCAGATTTTGAAGGG + Intronic
1153746473 18:8184945-8184967 ATTCTAATGCAGACTTTCAAAGG + Intronic
1157122604 18:44925657-44925679 CATCTCATGCTGATTTTACAGGG + Intronic
1157980735 18:52377271-52377293 CTTCTCATTCAAAACTTTAATGG + Intronic
1158676814 18:59527966-59527988 CTTCTCATGGAGTATTTTACTGG + Intronic
1158689347 18:59646213-59646235 CTACGCATGGAAAATTTAAAAGG + Intronic
926082734 2:10001299-10001321 TTTCTCATGAAGAATTTTAATGG + Exonic
928215406 2:29357186-29357208 CTTTGCATTCAGCATTTAAATGG - Intronic
928444168 2:31318490-31318512 AATCTCATGCAGATTTTGAAGGG - Intergenic
930177714 2:48316849-48316871 GTTCTTGTGCAGATTTTAAATGG - Intronic
932127980 2:69161838-69161860 CTTCTCATGCAGAATTTAAAAGG + Intronic
932710245 2:74057826-74057848 CTTTTCCTACAGAATTTGAATGG - Intronic
932826910 2:74949353-74949375 CTTCTCATGGAGTATCTTAATGG - Intergenic
933157912 2:78994424-78994446 GTTCTCATTCAGAATCTAAGAGG + Intergenic
933425824 2:82111162-82111184 CTTCTCATGCAAAAATTCTATGG - Intergenic
936964903 2:118117940-118117962 CTTCTCTTTGAGGATTTAAATGG + Intergenic
937521160 2:122713586-122713608 CTTCTCATGTAGAATCTTACAGG - Intergenic
937640706 2:124207779-124207801 CTGTTCATGCATAATTTGAAGGG + Intronic
937878773 2:126849706-126849728 CTTCTCAGCCAGAGTTTCAAGGG - Intergenic
938789177 2:134661664-134661686 TTTATTCTGCAGAATTTAAATGG - Intronic
939889380 2:147718953-147718975 CATCTCATGGAGAACTTACAAGG + Intergenic
939898583 2:147823089-147823111 CTTCTCCTGAATGATTTAAAAGG + Intergenic
940934646 2:159477581-159477603 TTTCTTATTCAGAATTAAAATGG - Intronic
941189028 2:162353583-162353605 ATTCTCAAGTAGAATTTTAAAGG + Intronic
941779415 2:169427686-169427708 CTTCACATGCTGGATTTAACGGG + Intergenic
942116127 2:172731052-172731074 CTTCTTGAGCAGGATTTAAAGGG - Intergenic
942485308 2:176433189-176433211 CTTTTCCTTCAGAATTTTAAAGG + Intergenic
943514208 2:188863902-188863924 CTTCTCATGCAGTATCTTAGTGG - Intergenic
943983092 2:194581195-194581217 CTTCTAATGGAGAGTTTACAGGG - Intergenic
944219801 2:197291576-197291598 TTTCTCATGCAGAATTTGGCTGG - Intronic
944238321 2:197461207-197461229 TTTCTCATGTAGAGTTCAAATGG + Intronic
944330407 2:198458787-198458809 ATTTACATGCAGAATTTAGAGGG + Intronic
944375905 2:199041902-199041924 TTTCTCATCTAAAATTTAAATGG + Intergenic
944618955 2:201492067-201492089 TTTCCCTTACAGAATTTAAAGGG - Exonic
945110846 2:206357883-206357905 CCTCTCATGGGGAATTTAAAAGG + Intergenic
945488182 2:210423317-210423339 CTTCTCATTTAGAATTTATAAGG - Intergenic
947802336 2:232937727-232937749 CTTCTCCTGCAGTAATTAAGTGG + Intronic
948277169 2:236717865-236717887 CTTCTCAGGCAGCATATTAAAGG + Intergenic
948731259 2:239965210-239965232 CTTCTCAGGCAGCAGTTAACTGG + Intronic
948935378 2:241160762-241160784 CATCTCAGGCAGAATGTAACTGG - Intronic
1170011636 20:11729650-11729672 CTTCTCATGGAGTATCTTAATGG - Intergenic
1170050133 20:12133566-12133588 CTTCTAGTGCAGAATTCAAGTGG - Intergenic
1170432875 20:16293406-16293428 ATTTTCATTCAGAATTTCAAAGG - Intronic
1171058804 20:21935356-21935378 CTTCTCAAGCAGAAAATAAAGGG - Intergenic
1171388376 20:24785698-24785720 CTTCTCATGAGGAATTGAGAAGG - Intergenic
1173455410 20:43197500-43197522 CAGCTCATGCAGAATGTATATGG - Intergenic
1173764415 20:45594515-45594537 CTTCTCATGGAGTATTTTACTGG + Intergenic
1176732602 21:10515406-10515428 CTTCTCATACATATGTTAAAAGG - Intergenic
1176923293 21:14715838-14715860 CATGTCAGGCAGAAATTAAATGG + Intergenic
1177039695 21:16093242-16093264 TTTCTTATGCAGTATTTTAAAGG + Intergenic
1177283173 21:19011767-19011789 CTTTTCTTGCAGAATTTCAGTGG - Intergenic
1177721542 21:24913556-24913578 CTCTACATGCAGAATTAAAAGGG - Intergenic
1177878761 21:26668053-26668075 CTTCTCATGGAGTATCTTAATGG + Intergenic
1180044554 21:45298837-45298859 CTCCTCCTGCAGAATTTGAAAGG + Intergenic
1180250198 21:46580932-46580954 CTTCTCATGGAGTATTTTACTGG + Intergenic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1185192522 22:49447613-49447635 ATTCTCATGAAGAAAGTAAATGG - Intronic
1185316204 22:50180234-50180256 CATGTCATGCAGAATTAACAAGG + Exonic
949146947 3:712754-712776 CTTCTGATACAGACTGTAAAAGG + Intergenic
949774093 3:7611931-7611953 ATTCTCATGAAGAATATAATAGG + Intronic
951104653 3:18728850-18728872 CCTCTCCTGCTGAATTCAAATGG - Intergenic
951285471 3:20807442-20807464 GTTCTCATGAAGCATTTAATAGG + Intergenic
951871966 3:27371770-27371792 CTCCTCTTGCAGAATCTCAAAGG + Intergenic
953365714 3:42342877-42342899 GTTCTCATGAAGAAATAAAAAGG + Intergenic
954592477 3:51794687-51794709 CTTTACATGAACAATTTAAAGGG - Intergenic
955119084 3:56037705-56037727 CTTCTCATGGAGTATTTTACTGG - Intronic
955595502 3:60586004-60586026 CTTCTCATGGAGAATCTCATTGG + Intronic
956578472 3:70782271-70782293 CTTCTCAAGCAGCATTTGAAAGG - Intergenic
958013522 3:87911991-87912013 CTTGTCATGCTGATTTTCAAGGG - Intergenic
959418202 3:106103029-106103051 CTTCTCATGGAGTATCTTAATGG + Intergenic
959613422 3:108320287-108320309 TTTCACATGCAGAAAATAAAAGG - Intronic
959798655 3:110463613-110463635 CCCCTTTTGCAGAATTTAAAGGG + Intergenic
960059460 3:113305423-113305445 CTTTTCATGCAGAAAATAAAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963416094 3:144997740-144997762 CTTCTCATGCAGTATCTTACTGG + Intergenic
963982500 3:151555338-151555360 CTTTGCAAGCAGAATTTAGAGGG + Intergenic
964466113 3:156995322-156995344 CTTCTCATTCAACATTTAGAGGG - Intronic
965034301 3:163417057-163417079 CGTTTAATGCAGAATTTCAAAGG - Intergenic
965263493 3:166512136-166512158 CTTCTCATGGAGTATCTTAATGG - Intergenic
965497547 3:169416365-169416387 CAGCTAAAGCAGAATTTAAAGGG + Intronic
967708808 3:192682321-192682343 ATTTTCATGCAAAATTTACATGG - Intronic
968074760 3:195810225-195810247 CTTCTCTTGCAGCCTTTAAACGG + Intronic
969743239 4:9049177-9049199 CTTCTCATGCAGAGTTGATGAGG - Intergenic
969968345 4:11020474-11020496 CTCCTCATCCAGACTTTAATGGG - Intergenic
970666330 4:18341732-18341754 CTTCTCATGGAGTATCTTAATGG + Intergenic
972216053 4:36897846-36897868 CTTCTCCTGTAGTATCTAAATGG + Intergenic
973676192 4:53265565-53265587 CACCTAATGCACAATTTAAAGGG + Intronic
975342102 4:73254451-73254473 TTTCTAAGGCAGAATTCAAAGGG - Intronic
975812677 4:78185353-78185375 ATTGTCTTGCAGAATTTAGATGG + Intronic
977127756 4:93192009-93192031 CTTCAAATGTAGAATATAAAGGG - Intronic
977221037 4:94337763-94337785 GTTTTCATGCAGAATTCAACAGG - Intronic
977311654 4:95395430-95395452 CCTCTCAAGCACTATTTAAAGGG - Intronic
979194653 4:117905858-117905880 GTTCTAATGTACAATTTAAAGGG + Intergenic
979594685 4:122521490-122521512 CTGATAATGCAGATTTTAAAAGG - Intergenic
980075493 4:128288642-128288664 CTGCTCTTGTAGAATTTTAAAGG + Exonic
980797860 4:137708890-137708912 ATTCATATGCAGAATATAAAAGG - Intergenic
981631710 4:146826598-146826620 CTTCTCATGGAGTATCTTAATGG + Intronic
982357274 4:154484725-154484747 CTTTTCATTTATAATTTAAAAGG + Intronic
982595502 4:157378813-157378835 CCTCAGATGCATAATTTAAAAGG - Intergenic
984834189 4:184004017-184004039 ATTTTCAAGTAGAATTTAAAGGG - Intronic
985208128 4:187562654-187562676 ATTCTCATGCAGAATTTACAGGG - Intergenic
986569170 5:9147608-9147630 CTTATAAGGCACAATTTAAAAGG + Intronic
987398962 5:17454968-17454990 TTTCTGATGCATAATTCAAACGG + Intergenic
987399663 5:17462492-17462514 CTTCTCATGGAGTATCTTAATGG + Intergenic
987834541 5:23144920-23144942 CTTCTCATGGAGTATCTTAATGG + Intergenic
989370473 5:40701684-40701706 CTTCTTGTGCAGAATTTTATAGG - Intergenic
990138915 5:52681161-52681183 CTTCTCATGGAGTATTTTAATGG + Intergenic
991134769 5:63168469-63168491 CTCCTCATGGAGAAATTAAGGGG - Intergenic
992137652 5:73763461-73763483 CTTCCAATGCAGACTTCAAAGGG + Intronic
993898341 5:93565757-93565779 ATTCTCCTGCTGAGTTTAAAAGG + Intergenic
994152368 5:96462600-96462622 CTTCTCAATAAAAATTTAAAAGG + Intergenic
994410873 5:99405834-99405856 CTCCACATGCATAATTTAAATGG + Intergenic
994482958 5:100359451-100359473 CTCCACATGCATAATTTAAATGG - Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
995411224 5:111859313-111859335 AATCTCAGGCACAATTTAAATGG + Intronic
996006007 5:118421200-118421222 CTTCTCATGCAGTATTTTACTGG - Intergenic
996566692 5:124887090-124887112 TTTTTCATGCAGTATTAAAATGG + Intergenic
999924230 5:156357559-156357581 ATTCTCATGAAAAATTTTAAGGG + Intronic
1000829296 5:166083520-166083542 CACCTCATCCAAAATTTAAAAGG + Intergenic
1000895624 5:166852034-166852056 CTTCAAATGAATAATTTAAAAGG - Intergenic
1001788989 5:174438451-174438473 CTTCTCATGGAGTATCTTAATGG - Intergenic
1004760281 6:18658048-18658070 CTTCTCATGAAGAATCTTAGTGG - Intergenic
1006249295 6:32767003-32767025 CTTCTCATGCAGTATGGAAATGG + Intergenic
1006256217 6:32834753-32834775 CTTCTTCTGCTGATTTTAAAGGG + Intronic
1006422454 6:33943859-33943881 CTTCAAATGAAGAACTTAAAAGG + Intergenic
1008623562 6:53295563-53295585 CTCCTCATGCAATATTTACAAGG + Intronic
1008864917 6:56198740-56198762 CTTCTCAGTAAGAAATTAAATGG + Intronic
1009740071 6:67733044-67733066 CTTCTCATGGAGTATTTTATTGG + Intergenic
1009983606 6:70756357-70756379 CTTCTCAATTATAATTTAAAAGG - Intronic
1010331472 6:74627976-74627998 CTTCTCATGGAGTATCTTAATGG - Intergenic
1010530005 6:76956929-76956951 TTTCTCAAGCAGAAATTAAAAGG + Intergenic
1011493265 6:87914099-87914121 CTGCTCATTCAGAATCAAAAAGG - Intergenic
1012032925 6:94096046-94096068 ATACTCAAGCAGAATATAAATGG - Intergenic
1012510505 6:99995878-99995900 CTTTTTATGCATACTTTAAAAGG + Intergenic
1013629192 6:111968898-111968920 CTTCTCATGCAGAAATGGCATGG - Intergenic
1013945597 6:115718619-115718641 ATGCTCATTCAGAATTTGAAAGG + Intergenic
1014513948 6:122359121-122359143 TATCTAATGCAGTATTTAAAGGG + Intergenic
1014678484 6:124398337-124398359 CTTCACAGGTAGAATTTAAGTGG + Intronic
1016052251 6:139542274-139542296 ATTCTCATGCAAAAGTCAAATGG - Intergenic
1016790932 6:148065874-148065896 CTTCTAAAACAGATTTTAAAAGG - Intergenic
1018560949 6:165100420-165100442 ATTCTCCTGCAGAAATTAAATGG + Intergenic
1018672272 6:166189583-166189605 CTTCACCTTCAGAATTTATAAGG + Intergenic
1019024437 6:168946930-168946952 CTTTTCATTCAGCAGTTAAATGG + Intergenic
1019113361 6:169736802-169736824 CTTCTCATGGAGTATCTTAATGG + Intergenic
1021105452 7:16634063-16634085 TTTCTCATGCAGAAGGGAAAGGG - Intronic
1021430422 7:20552195-20552217 CTACTAATTCAAAATTTAAAAGG + Intergenic
1023113442 7:36837684-36837706 CTTCTTTTCCAGAATTTGAAGGG + Intergenic
1023508257 7:40922536-40922558 CATCACATGCATACTTTAAAAGG + Intergenic
1024209961 7:47194619-47194641 CTTCCCCTGCAGATTTCAAAGGG + Intergenic
1024924612 7:54599823-54599845 CTTCTCATGGGGAAGTTAAGGGG - Intergenic
1027417267 7:77986467-77986489 TTTCTCATGCATAATTCAAAGGG - Intergenic
1027631589 7:80612460-80612482 CTTCTTATGAAGAAATTAAGGGG + Intronic
1028027820 7:85868088-85868110 CTTCTCATGGAGTATTTTACTGG - Intergenic
1028551064 7:92066931-92066953 CTTCACAAGAACAATTTAAATGG - Intronic
1029866245 7:103633321-103633343 TTTCTTATGAAGAATTTACATGG + Intronic
1030231504 7:107212792-107212814 CTTCTAATGCAGTTTTTATATGG - Intronic
1030393770 7:108960267-108960289 CTTCTAAAGGAAAATTTAAAAGG + Intergenic
1030701400 7:112645578-112645600 CTTCTCATGGAGTATCTTAATGG + Intergenic
1030988548 7:116271657-116271679 CTTCTTTAGCAGAATTTCAAAGG + Intergenic
1031206274 7:118761952-118761974 TTTCTCATGCAAAATAGAAAAGG - Intergenic
1031804753 7:126294014-126294036 CTTCTCATGGAGTATCTTAATGG - Intergenic
1031890879 7:127292227-127292249 CTTCTCATGCTGAATTTATATGG + Intergenic
1032100991 7:128977552-128977574 CCTATGATGCAGAATTTAAGGGG + Intronic
1032573580 7:133028237-133028259 CTTCTCAGGCAAAATTCAACAGG + Intronic
1032943557 7:136823791-136823813 CCACCCATGCAGAATTTGAAAGG - Intergenic
1032962638 7:137055156-137055178 CTTAGCATACAGAATTTAATTGG + Intergenic
1033032035 7:137836609-137836631 CTTGTACTGTAGAATTTAAAAGG + Intronic
1033395795 7:140972718-140972740 CACCTCATGCAAAATTTAAGGGG + Intergenic
1034596982 7:152206114-152206136 CTTCTCATACACATGTTAAAAGG + Intronic
1035071884 7:156150994-156151016 TTTCTCATGCAGAGTTTTTAGGG - Intergenic
1035599320 8:887861-887883 CTTCTCATGGAGCATCTTAATGG + Intergenic
1036252360 8:7173374-7173396 CTTCTCATGCAGAGTTGATGAGG + Intergenic
1036365134 8:8114086-8114108 CTTCTCATGCAGAGTTGATGAGG - Intergenic
1037198597 8:16222552-16222574 CTTCTCATGGAGTATTTTACTGG + Intronic
1037249412 8:16875781-16875803 CTTCTCATGTAGTATTTTACAGG + Intergenic
1037318277 8:17619522-17619544 CTTCTAATAAAGTATTTAAAGGG - Intronic
1039160230 8:34610731-34610753 ATTCTCATGGAAACTTTAAATGG + Intergenic
1040647013 8:49410432-49410454 CTTCTCCTAAATAATTTAAAAGG - Intergenic
1041747430 8:61223667-61223689 CTTCTCATGGAGTATCTTAATGG + Intronic
1041784922 8:61621087-61621109 CTTCCCATGCTGTATCTAAAAGG + Intronic
1046248515 8:111599291-111599313 CTTCTCGTCCTGAATTTAAGAGG + Intergenic
1046709010 8:117488319-117488341 CTTCTCATGGAGTATCTTAATGG - Intergenic
1046923345 8:119758610-119758632 CTTTTCAAGCATAATATAAAAGG + Intronic
1047582431 8:126231071-126231093 CTTCTGATTTAGAATTTTAAAGG - Intergenic
1047848719 8:128832868-128832890 CTTGTAATGGAGAATTTAAATGG - Intergenic
1050075647 9:1860287-1860309 CTTCTAATTCTGAATTTAAATGG - Intergenic
1050982493 9:12037482-12037504 CTTCTCATGGAGTATCTTAATGG - Intergenic
1051147007 9:14037516-14037538 ATTCTCAAGCAGGATTGAAACGG - Intergenic
1051983080 9:23047349-23047371 CTTCTCATGGAGTATCTTAATGG - Intergenic
1052225118 9:26076619-26076641 CTTCTCATGGAGCATCTTAATGG + Intergenic
1052546819 9:29890266-29890288 CTTATCATGGAGTATCTAAATGG - Intergenic
1056434382 9:86561343-86561365 CTTCTCCTGCAGAACCAAAAGGG - Intergenic
1056480506 9:86998958-86998980 CTTCTCAGGCAGAGCTTGAAAGG - Intergenic
1056589555 9:87955003-87955025 CTGCTCATGATGAATTTTAAAGG + Intergenic
1056643827 9:88392889-88392911 TGTTACATGCAGAATTTAAAAGG - Intronic
1057736668 9:97668637-97668659 CTTCTCATTCAGAAATTCCATGG - Intronic
1058401124 9:104620607-104620629 CTTCTCAGTCATAATTTAACAGG - Intergenic
1058514273 9:105753318-105753340 CTTCTCATGGAGTATCTAACTGG - Intronic
1062709206 9:137964179-137964201 CTTCTCATGGAGTATTTTACTGG + Intronic
1186088628 X:6019734-6019756 CTTCTCATCCAGTATGTGAAAGG - Intronic
1186093427 X:6074278-6074300 CTGCTCATGGAGTATTTACAGGG - Intronic
1186326671 X:8485344-8485366 CTTCTCATGTTCATTTTAAATGG + Intergenic
1187988766 X:24846622-24846644 CTTCTGGAGCAGAATTTAAGGGG - Intronic
1189077976 X:37938119-37938141 CTGAGCCTGCAGAATTTAAAGGG + Intronic
1189354904 X:40303158-40303180 TTTCTCATGCAGAATAAAAAGGG + Intergenic
1190550743 X:51577297-51577319 CTTCTCATGAAGTATCTTAATGG - Intergenic
1190971967 X:55358122-55358144 CTTCTCATGGAGTATTTTACTGG - Intergenic
1191817763 X:65266788-65266810 CCTCTCAATCAGAATTTTAATGG + Intergenic
1192701888 X:73482780-73482802 CTTCTCATGGAGTATCTTAAGGG - Intergenic
1193039456 X:76989005-76989027 CTTCTCATGGAGTATCTTAATGG - Intergenic
1193056326 X:77155207-77155229 CTTCTCATGGAGTATTTTACCGG - Intergenic
1193847812 X:86496753-86496775 CCTCTCAAGCAGAACCTAAATGG + Intronic
1194177367 X:90666713-90666735 CTTCTCATGAAGTATTTTATTGG - Intergenic
1194281211 X:91956744-91956766 CTTCTCATGGAGTATTTTACTGG + Intronic
1195143135 X:101984189-101984211 TTTTTCATTCAGTATTTAAAGGG + Intergenic
1195360879 X:104083043-104083065 CTTCTCATGCAGCATCTTACTGG + Intergenic
1195545628 X:106109316-106109338 ATCCTTATACAGAATTTAAAAGG - Intergenic
1196517104 X:116627238-116627260 CTTCTCATGGAGTATCTTAATGG + Intergenic
1196914362 X:120517011-120517033 CTGATCTTGCAGAATTAAAAAGG + Intergenic
1197291083 X:124658795-124658817 CTTCTCAGGTAGAAGTAAAATGG + Intronic
1197689892 X:129487402-129487424 TTGCTCTTGCATAATTTAAATGG + Intronic
1199078758 X:143552855-143552877 CTTGTCATTCAGCTTTTAAATGG - Intergenic
1199472714 X:148212432-148212454 TTTCTAATGTAGAATTTAAAAGG - Intergenic
1199828208 X:151521623-151521645 TTTCTCATGCATTATTTATAAGG + Intergenic
1200321444 X:155194482-155194504 CTTCTCATGGAGTATTTTACTGG + Intergenic
1200344800 X:155437242-155437264 CTTCTCATGAAGTATCTTAATGG - Intergenic
1200905135 Y:8473995-8474017 CATCTCATGCAGGATTTTTAAGG + Intergenic
1201504765 Y:14685982-14686004 CTGCTCATGGAGTATTTACAGGG + Intronic
1201680510 Y:16640051-16640073 CTTTTCCTCCAGAATTTAACAGG + Intergenic
1201696930 Y:16836267-16836289 CTTTTCTTCCAGAATTTAACAGG - Intergenic