ID: 932128469

View in Genome Browser
Species Human (GRCh38)
Location 2:69166699-69166721
Sequence TTTGTCCCTCCTAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932128463_932128469 -1 Left 932128463 2:69166677-69166699 CCCTTCAACCCTATCCATCTTCT 0: 1
1: 0
2: 0
3: 20
4: 256
Right 932128469 2:69166699-69166721 TTTGTCCCTCCTAATGAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 168
932128462_932128469 22 Left 932128462 2:69166654-69166676 CCATTAAAATATTTTATTAACGA 0: 1
1: 0
2: 0
3: 81
4: 699
Right 932128469 2:69166699-69166721 TTTGTCCCTCCTAATGAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 168
932128466_932128469 -10 Left 932128466 2:69166686-69166708 CCTATCCATCTTCTTTGTCCCTC 0: 1
1: 0
2: 1
3: 38
4: 391
Right 932128469 2:69166699-69166721 TTTGTCCCTCCTAATGAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 168
932128464_932128469 -2 Left 932128464 2:69166678-69166700 CCTTCAACCCTATCCATCTTCTT 0: 1
1: 0
2: 0
3: 31
4: 348
Right 932128469 2:69166699-69166721 TTTGTCCCTCCTAATGAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 168
932128465_932128469 -9 Left 932128465 2:69166685-69166707 CCCTATCCATCTTCTTTGTCCCT 0: 1
1: 0
2: 4
3: 48
4: 427
Right 932128469 2:69166699-69166721 TTTGTCCCTCCTAATGAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932128469 Original CRISPR TTTGTCCCTCCTAATGAGGA AGG Intronic
900031395 1:375454-375476 CTTGTGCCTCCTAACCAGGATGG + Intergenic
900051946 1:603654-603676 CTTGTGCCTCCTAACCAGGATGG + Intergenic
902174149 1:14636822-14636844 TTCTCCCCTCCTAAGGAGGATGG - Intronic
905073197 1:35246121-35246143 TTTTTTCCTCCTAATTAGTAGGG - Intergenic
911176951 1:94826772-94826794 TTTTTCCCTCCTGTTGGGGATGG - Intronic
911542836 1:99179190-99179212 TTTATTCCTCCTCATTAGGATGG - Intergenic
915312724 1:155012355-155012377 CCTGTCCCTCCTAAGGGGGATGG - Intronic
915859001 1:159422315-159422337 TGTGGCCCTACTACTGAGGAGGG + Intergenic
916760787 1:167815443-167815465 TATGTCCCACCTAAGGAAGAGGG + Intronic
917389382 1:174517595-174517617 TTTTTACCTCATAATAAGGAAGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920443883 1:206001111-206001133 TTTGTTGCTCCTAGTGAGGCTGG - Intronic
921380031 1:214514803-214514825 TATTTCCCTTCTAAAGAGGAAGG - Intronic
921481664 1:215671175-215671197 TTTGTACCTCCAGATGTGGAGGG + Exonic
923464238 1:234233988-234234010 TTTTTCTCTCCTTTTGAGGAAGG - Intronic
924211532 1:241772884-241772906 CTTGTCACTGCTCATGAGGATGG + Exonic
1063016864 10:2087136-2087158 TTTGTCACTCCTATTCTGGAAGG - Intergenic
1069185091 10:65412440-65412462 ATTGTCCTTCATAATGTGGATGG + Intergenic
1069705334 10:70456016-70456038 TTTGTCCCTCCTGATGGCCAAGG - Intergenic
1070674288 10:78401639-78401661 TTTAGCTCTCCTAATGAGCAAGG - Intergenic
1072363900 10:94689552-94689574 GTTGTCCCTCCTTATCAGTAAGG + Intronic
1072979452 10:100087597-100087619 TTTATTCCTCCCAAGGAGGAGGG + Intergenic
1073257294 10:102161124-102161146 TTTGTCCCCCCAAATCAGGATGG + Intronic
1075266263 10:121001700-121001722 TCTGTCCCTGGTAAGGAGGATGG - Intergenic
1077773105 11:5242655-5242677 TGTTTCCCTCCGAATGATGATGG - Intergenic
1077966800 11:7142888-7142910 ATTGTCTTTCCTAATGTGGATGG + Intergenic
1078803380 11:14670021-14670043 TATCTCCCACCTAATGATGAAGG - Intronic
1078878957 11:15428772-15428794 TTTGGCCTTCCTAATGTGGGTGG + Intergenic
1079281449 11:19090508-19090530 TTGGACATTCCTAATGAGGAAGG - Intergenic
1080155709 11:29108276-29108298 TTTGTCCCTTATAATTTGGATGG + Intergenic
1080938121 11:36884169-36884191 TTTGTCCCTCCATATGAAGGAGG - Intergenic
1084282589 11:68108195-68108217 GTAGTCCCAGCTAATGAGGAGGG + Intronic
1086392622 11:86381172-86381194 TCTGTCCCACCTAAGGAGAAAGG - Intronic
1087431058 11:98055900-98055922 ATTGTCCCATCTAATCAGGAGGG - Intergenic
1088841304 11:113629754-113629776 TTTGTCCCTCCCAGTGTGTAGGG - Intergenic
1089159269 11:116424943-116424965 TTTGTTCCTCCCCATGGGGACGG + Intergenic
1090059482 11:123451656-123451678 TGTGTCCCTCCAAATGGGAAGGG - Intergenic
1102806364 12:115784209-115784231 TTTAACCCTCCTAAAGAGCAGGG + Intergenic
1103291071 12:119846782-119846804 GTTGTCCCAGCTAATCAGGAAGG + Intronic
1104312447 12:127665768-127665790 TTTGTCTCTCAGAATGTGGATGG + Intergenic
1104553244 12:129776822-129776844 TTTTTTCCTCCTTAAGAGGAAGG - Intronic
1106622289 13:31382435-31382457 TTTGTCCCTTCTACTGCGTAAGG - Intergenic
1113979429 13:114261343-114261365 TTTGACTCTGTTAATGAGGAAGG + Intronic
1115288216 14:31741361-31741383 TCTGTCCCACCTAAAGAGGGAGG - Intronic
1115610950 14:35048079-35048101 TTTTTCCCTCCTACTTAAGAAGG + Intronic
1115808183 14:37075947-37075969 TTGGTGCCTCCAAATGATGAGGG + Intronic
1118299255 14:64600840-64600862 CTTGTCGCTCCTAGTGATGATGG + Intergenic
1122530088 14:102419267-102419289 CTTGGCCCTGCTGATGAGGAGGG - Intronic
1202847219 14_GL000009v2_random:190322-190344 TTTTTCCATCTTAATGAGGTGGG + Intergenic
1202916682 14_GL000194v1_random:180884-180906 TTTTTCCATCTTAATGAGGTGGG + Intergenic
1125016497 15:34942023-34942045 TATCTCCCTCCCAATGTGGATGG - Exonic
1125099783 15:35898961-35898983 TTTATGCATCCTAATGAGAAGGG + Intergenic
1128389358 15:67172824-67172846 CTTGTTCCTCCAAGTGAGGAAGG - Intronic
1128479325 15:68023704-68023726 TTTCAGCCTCCAAATGAGGAGGG + Intergenic
1128544307 15:68556877-68556899 TTTTCCCTTCCTAGTGAGGAGGG + Intergenic
1128990398 15:72255005-72255027 ATTGTCCTCCCTAATGTGGAAGG + Intronic
1129266725 15:74397306-74397328 CTTGCCCCTCCTTGTGAGGACGG + Intergenic
1133850656 16:9500294-9500316 CTTGCTCTTCCTAATGAGGAAGG + Intergenic
1134570789 16:15289401-15289423 GTTGCCCCTCCTAATGTGGGTGG - Intergenic
1134731591 16:16466674-16466696 GTTGCCCCTCCTAATGTGGGTGG + Intergenic
1134935861 16:18245328-18245350 GTTGCCCCTCCTAATGTGGGTGG - Intergenic
1137944572 16:52721489-52721511 GTTGGCCCTGCTACTGAGGAGGG + Intergenic
1138381270 16:56604375-56604397 TTAGTCCCTGCTACTCAGGAGGG + Intergenic
1139754023 16:69128476-69128498 TTTTTCCCTCCTCATGAGATTGG - Intronic
1140873792 16:79131388-79131410 TTTTTCCCTCCTGATTCGGAGGG + Intronic
1140873793 16:79131393-79131415 TTTTTCCCTCCGAATCAGGAGGG - Intronic
1147898828 17:43770228-43770250 TTTGTCCTTTCTACTGTGGATGG - Intronic
1151982799 17:77524065-77524087 TTTGTCCTCCCTAGTGTGGAGGG - Intergenic
1152948258 17:83210259-83210281 CTTGTGCCTCCTAACCAGGATGG - Intergenic
1155161844 18:23202423-23202445 TTTGAACCTCCTGCTGAGGAGGG + Intronic
1155690821 18:28620426-28620448 TCTATCCTACCTAATGAGGAGGG + Intergenic
1160266047 18:77341424-77341446 TCGGTCCCTCCTGTTGAGGAAGG + Intergenic
1160735712 19:661515-661537 TTTGTTCCTCCTGCTGGGGAGGG + Intronic
1163549986 19:17960932-17960954 TTTGGCCCACCCAATGAAGAGGG - Intronic
1165876377 19:39010463-39010485 TATGTCTCTCCTTATGAGGTAGG + Intronic
1166209183 19:41294769-41294791 TTTTTCCCCCGTAATGATGATGG + Intronic
926358383 2:12062381-12062403 CTCGTCCCTGCTAATGAAGATGG + Intergenic
927110650 2:19861629-19861651 TTGGTCCTTCCTACTGAGGAGGG + Intergenic
930225302 2:48786176-48786198 TTTGTCCCTCTAAATAAGAATGG + Intergenic
932128469 2:69166699-69166721 TTTGTCCCTCCTAATGAGGAAGG + Intronic
938451073 2:131420932-131420954 TTTGTCCTTCCTCAAGAGAAGGG + Intergenic
942321314 2:174739000-174739022 TTTCTCTCTACTATTGAGGAGGG - Intergenic
946777226 2:223155871-223155893 TTTATCCCTGCCATTGAGGAAGG + Intronic
948483029 2:238262199-238262221 TTTGTGCCTCCCAATGATGAAGG + Exonic
1169104145 20:2979867-2979889 TTTTTCCCTCCTAATCATGTTGG + Intronic
1171277478 20:23870285-23870307 TTTGATCCACCTGATGAGGAAGG + Intergenic
1173566277 20:44040700-44040722 TCTCTTCCTCCTGATGAGGATGG + Intronic
1173727642 20:45308398-45308420 TTTGCCCCCCCTCAGGAGGAAGG - Intronic
1176359518 21:5983088-5983110 TGTGTCCCTGCTACTGGGGAGGG + Intergenic
1176636037 21:9195531-9195553 TTTTTCCATCTTAATGAGGTGGG + Intergenic
1177823426 21:26056713-26056735 TGTGTCCCTCAAAATGAGAATGG + Intronic
1178194104 21:30322736-30322758 TTTGTCTCTCCTACTGTAGAAGG + Intergenic
1178442445 21:32609954-32609976 TTTCTCCCTCCTAATATGCAAGG - Exonic
1179551443 21:42146425-42146447 TCTGTCCCTCCTGGGGAGGAAGG + Intergenic
1179551490 21:42146587-42146609 TCTGTCCCTCCTGGGGAGGAGGG + Intergenic
1179551507 21:42146641-42146663 TCTGTCCCTCCTGGGGAGGAGGG + Intergenic
1179551524 21:42146695-42146717 TCTGTCCCTCCTGGGGAGGAGGG + Intergenic
1179551543 21:42146749-42146771 TCTGTCCCTCCTGGGGAGGAGGG + Intergenic
1179551560 21:42146803-42146825 TCTGTCCCTCCTGGGGAGGAGGG + Intergenic
1179764000 21:43555462-43555484 TGTGTCCCTGCTACTGGGGAGGG - Intronic
1181404795 22:22675423-22675445 TTTCTCCTTCCTCATGAGAATGG + Intergenic
1184547164 22:45178678-45178700 CTTGTCGCTCCTAGTGATGATGG - Exonic
949711085 3:6872197-6872219 TATGTCCCTCCTCATAAGGATGG - Intronic
954141048 3:48605704-48605726 GTTGTCCCTCCTGAGGATGAAGG - Intronic
957482080 3:80811129-80811151 TTTGTCCCTCCTAAGAAAGCAGG + Intergenic
960039532 3:113135866-113135888 TTTGACCCTCCAAATGAACATGG - Intergenic
960472564 3:118085388-118085410 ATTGCCCTTCCTAATGCGGATGG + Intergenic
961799683 3:129437523-129437545 TTTGTCCCTCCTTCTGTGAATGG - Intronic
967407915 3:189138030-189138052 TGTGTCCCTCCTCTTGAGGCAGG - Intronic
975435106 4:74343103-74343125 TTTGTTCAGCCTAAAGAGGAGGG + Intergenic
976088616 4:81431461-81431483 TTTGTACCTCCCAGTGATGAGGG - Intronic
977766357 4:100802825-100802847 ATTGCCCTTCATAATGAGGATGG - Intronic
978508826 4:109493086-109493108 CTTGTCCCTCCTCATGGTGATGG - Intronic
979783779 4:124689500-124689522 ATTGTCCTTCCTAATGTGGGTGG + Intronic
980822319 4:138034016-138034038 TTTGTCCCTCCTTCTGTGGGAGG - Intergenic
982841385 4:160191796-160191818 TCTGTCCTTCATAGTGAGGAAGG - Intergenic
983270724 4:165558468-165558490 ATTGTCCTCCCTAATGTGGATGG + Intergenic
986671422 5:10146368-10146390 TTTGTCCCTCCTGATGACGGAGG - Intergenic
987114330 5:14714211-14714233 TTTCTCCCTCCTAATGGTGTGGG + Intronic
987618236 5:20304648-20304670 CTTGTCGCTCCTAGTGATGATGG + Intronic
992188630 5:74268284-74268306 TTTGTCCTTCCTTAGGTGGAAGG + Intergenic
992832525 5:80608217-80608239 ATTGTCCTTCCTAATGTGGATGG - Intergenic
993583722 5:89697026-89697048 TGTTTCCCTCCTACTTAGGAAGG - Intergenic
993667337 5:90716475-90716497 ATTGTCCTTGCTAATGATGACGG + Exonic
995648232 5:114337970-114337992 TTTGTCCCTGCTAGAGAGGCTGG + Intergenic
996616675 5:125450338-125450360 TTTATCCTCACTAATGAGGATGG - Intergenic
997720108 5:136071257-136071279 TTGGTCCCTCCTACAGTGGAGGG + Intergenic
1002742425 5:181443414-181443436 CTTGTGCCTCCTAACCAGGATGG - Intergenic
1005371763 6:25140780-25140802 CTTGTCGCTCCTAGTGATGATGG - Intergenic
1011536216 6:88379164-88379186 TTTGTTCCTTCTACTGTGGATGG + Intergenic
1012974530 6:105765876-105765898 CTGTTTCCTCCTAATGAGGAGGG + Intergenic
1013214387 6:108014462-108014484 TTTGTCTATCCTAATGAACAAGG + Intergenic
1016465465 6:144320912-144320934 TCTTTCCCTGCTAATGGGGATGG + Intronic
1018031346 6:159844494-159844516 TTGTCCCCTCCTACTGAGGAGGG + Intergenic
1018283311 6:162211068-162211090 CTTGTGCTTTCTAATGAGGAAGG - Intronic
1018545304 6:164929210-164929232 TGTGTCCTTGCTAATGATGAGGG - Intergenic
1019247561 6:170719153-170719175 CTTGTGCCTCCTAACCAGGATGG - Intergenic
1020937527 7:14486188-14486210 ATTGTCCCTCCCATTCAGGAAGG + Intronic
1021542034 7:21770541-21770563 CTGGTCCCTCCTCATGAGGCTGG - Intronic
1023019317 7:35996352-35996374 TTTTTCTCTCCTGATGAGGCTGG + Intergenic
1025798184 7:64759238-64759260 CTTTTCCTTCATAATGAGGATGG + Intergenic
1026261365 7:68758711-68758733 CTTGTCTCTCCAAAAGAGGAAGG + Intergenic
1029425351 7:100490870-100490892 TTTTTCCCTTCTGATGAGGCAGG + Intronic
1029496527 7:100897852-100897874 TTTGGCCCTGCTAGTGATGAAGG + Intergenic
1029860904 7:103570875-103570897 TATGTCCCTCATCATGAGGTAGG - Intronic
1032503663 7:132419160-132419182 TTTCTCCCACTTAAAGAGGAAGG - Intronic
1035500576 8:88783-88805 CTTGTGCCTCCTAACCAGGATGG + Intergenic
1038784732 8:30601611-30601633 TGTGTCCCTCTTAAGAAGGATGG - Intronic
1038903099 8:31865984-31866006 TCTGTCCCTCCTAATGAGCCTGG - Intronic
1038949503 8:32399159-32399181 AGAGTCCCTCCTATTGAGGAAGG + Intronic
1039914087 8:41846833-41846855 CTTGAGGCTCCTAATGAGGAGGG - Intronic
1047208073 8:122819418-122819440 TTTGTATCTCCTCCTGAGGATGG - Intronic
1050008348 9:1158551-1158573 TTTGTGGCTCTGAATGAGGAGGG + Intergenic
1050812972 9:9773462-9773484 TTTGATCCTCCAAATGAGAAAGG - Intronic
1051065563 9:13098322-13098344 TTTTTCCCTCCTTTTGAAGAGGG + Intergenic
1053594054 9:39542201-39542223 ATTGTGACTCCTAATGGGGATGG - Intergenic
1053851838 9:42297247-42297269 ATTGTGACTCCTAATGGGGATGG - Intergenic
1054572199 9:66822756-66822778 ATTGTGACTCCTAATGGGGATGG + Intergenic
1055551872 9:77439099-77439121 TTTGTCCCTCTGAATGAGAATGG + Intronic
1055609220 9:78004320-78004342 TTTGTCCCACCTGAAGAGTAAGG - Intronic
1055785319 9:79864351-79864373 TGGGTTCCACCTAATGAGGAAGG + Intergenic
1057990717 9:99766878-99766900 ATTGTCCTTCCTAATGTGGATGG + Intergenic
1058253182 9:102728428-102728450 CTTGTGCCTTCCAATGAGGAAGG + Intergenic
1058754719 9:108073748-108073770 TTTGTCCATGCAAAAGAGGATGG + Intergenic
1203608332 Un_KI270748v1:74633-74655 CTTGTGCCTCCTAACCAGGATGG - Intergenic
1185691849 X:2161937-2161959 CTGGTCCATCCTAATGAGCACGG + Intergenic
1185923406 X:4119463-4119485 ATTATTCATCCTAATGAGGAAGG - Intergenic
1186023079 X:5278854-5278876 TTTGTTCCTTGTAAAGAGGATGG - Intergenic
1186123127 X:6384348-6384370 TGTCTCCCTACTAATCAGGAGGG + Intergenic
1187840292 X:23479910-23479932 TTTGTGACTCCTAAGCAGGAGGG - Intergenic
1190892899 X:54586634-54586656 TGTGGCCCTACTACTGAGGAGGG - Intergenic
1193240586 X:79164516-79164538 TTTGTTTCTACTAATCAGGAGGG + Intergenic
1193526201 X:82592506-82592528 TTTATCCCTAATAATAAGGAAGG - Intergenic
1193821366 X:86169967-86169989 TTTGTCCATCCCAAGAAGGATGG + Intronic
1194235643 X:91380479-91380501 ATTGTCCTTCCTAATGTCGATGG + Intergenic
1194974792 X:100383085-100383107 TTTGTGCCTCTTAATCTGGAAGG - Intronic
1196118624 X:112024302-112024324 ATTGCCCTACCTAATGAGGATGG + Intronic
1197075090 X:122343791-122343813 TTTTTCCCTCCTAATCAGCTGGG + Intergenic
1198170840 X:134103718-134103740 TTTTCCTCTTCTAATGAGGATGG - Intergenic