ID: 932129286

View in Genome Browser
Species Human (GRCh38)
Location 2:69173287-69173309
Sequence TAGAAATATCAGATGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932129286 Original CRISPR TAGAAATATCAGATGGAGTC AGG (reversed) Intronic
900384673 1:2404893-2404915 TGGAAACATCAAATGGAGGCGGG + Exonic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
904172766 1:28603061-28603083 TTGAAATCCCAGAGGGAGTCAGG - Intronic
904584384 1:31571816-31571838 TAGAGAGGTCAGATGGAGGCTGG - Intergenic
905131475 1:35762648-35762670 CAGATACCTCAGATGGAGTCTGG + Intronic
905155043 1:35970374-35970396 TACAAATATGAAATGGAGTGAGG - Intronic
905303269 1:36999783-36999805 AAGAAATAGAAGATGGGGTCAGG - Intronic
905618608 1:39420369-39420391 AAGAAAAATCAGATAGAGGCAGG - Intronic
905992440 1:42350364-42350386 TAGAAATAAAAGAGGGAGGCAGG - Intergenic
908382349 1:63608689-63608711 TAGAAAACTCAGATGGAATCAGG + Intronic
909875212 1:80794002-80794024 TAGTAATATCAGATGCAGACTGG + Intergenic
912419017 1:109530985-109531007 TATAAATAGCAGAGGGAGGCTGG - Intergenic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914792585 1:150891506-150891528 TAGAAATATCAGATAAGGCCGGG - Intergenic
915817030 1:158978824-158978846 TAAAAATATAAGATAGAGTGGGG - Intergenic
916544630 1:165792110-165792132 AAGAAAAACCATATGGAGTCAGG - Intronic
917249151 1:173038344-173038366 TAGCTGTATCAGATGGAGGCAGG - Intergenic
919279611 1:195471045-195471067 TAGAAGTAACAGATTGAGTCTGG - Intergenic
921717721 1:218435371-218435393 TCTAAATCTCAGATGGAATCAGG + Intronic
922490818 1:226015022-226015044 TAGAAATATGAGATGCAGCCAGG - Intergenic
922583392 1:226715622-226715644 CACAAATATCAGATTGAGTCAGG + Intronic
924509628 1:244718646-244718668 TATATATTTGAGATGGAGTCTGG - Intergenic
1063454981 10:6176680-6176702 TGGAAATATAACATGGAGGCCGG - Intronic
1063668190 10:8078811-8078833 TAAAAATTCCAGATGGAGGCCGG + Intergenic
1063847582 10:10148200-10148222 TATAAAAATCACATGGAGGCTGG + Intergenic
1064363111 10:14683645-14683667 TAGAAATATCATATGGAGATAGG + Intronic
1065252341 10:23828315-23828337 CAGCAATAGCAGATGGAGTAGGG + Intronic
1066263462 10:33752002-33752024 TAGAAATACAAGGTGGAGGCTGG + Intergenic
1066542795 10:36467336-36467358 TAGGCATATCAGATAGATTCAGG + Intergenic
1067235033 10:44439862-44439884 CAGAAACATCAGATGGAAGCTGG - Intergenic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1069806171 10:71126474-71126496 TAGAAAGAGCTGTTGGAGTCAGG - Intergenic
1070748152 10:78947619-78947641 TGGAAATATCTGAAGGTGTCTGG - Intergenic
1072041964 10:91614983-91615005 TATATATTTGAGATGGAGTCTGG - Intergenic
1072709387 10:97706153-97706175 TGGAAATAACAGACAGAGTCAGG + Intergenic
1073920709 10:108455048-108455070 TAGATACATCTGATGGAGTCAGG - Intergenic
1076227138 10:128787264-128787286 CACAAAGATCAGATGGATTCAGG + Intergenic
1076264991 10:129102834-129102856 TAGAAAAATGAAATGGAGTAAGG + Intergenic
1077878831 11:6331477-6331499 TAGAAATAAAAGGTGGAGGCCGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079985798 11:27199315-27199337 TAGAAATGCCAAATGTAGTCTGG + Intergenic
1086798335 11:91137235-91137257 TGGAAATCTTAGATGGAGACTGG + Intergenic
1087798563 11:102479894-102479916 TAGAAATGTCAGCTGGATTAGGG - Intronic
1088262373 11:107956207-107956229 GAGAAATATCAGAGAGAGTGAGG - Intronic
1090524594 11:127518954-127518976 TAAAAATATCAGTTGTTGTCAGG - Intergenic
1091939941 12:4470146-4470168 CACAAACATCAGATGGAGGCTGG + Intergenic
1093567892 12:20630101-20630123 TACATATAACAGGTGGAGTCAGG - Exonic
1094171490 12:27497442-27497464 TGGTAAAATCAGATGGAGGCTGG + Intronic
1097968404 12:65606041-65606063 TCCAAATCCCAGATGGAGTCAGG - Intergenic
1099237007 12:80093965-80093987 TACAAAAATCAGATGGATCCTGG + Intergenic
1099692920 12:85982988-85983010 TAGAACTTTCAGAGGGAGTGGGG + Intronic
1100623470 12:96304809-96304831 TAGAAATATAAGATGGAATGTGG - Intronic
1100675993 12:96868713-96868735 TAGAAAAGTAAGATGGAGCCAGG + Intronic
1100925778 12:99546725-99546747 GAAAGAAATCAGATGGAGTCTGG + Intronic
1101705837 12:107220392-107220414 TAGAGATGTAAGATGAAGTCAGG + Intergenic
1104122904 12:125816190-125816212 TAGACAAATCAGAAGGAGACTGG - Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1108823186 13:54378855-54378877 TACAAAAATCACATGGATTCAGG + Intergenic
1109494646 13:63152688-63152710 TATAAATATAACATGGAATCTGG - Intergenic
1111182270 13:84684997-84685019 AAGGCACATCAGATGGAGTCTGG + Intergenic
1111342631 13:86907970-86907992 TATAAAATTCAGATTGAGTCTGG + Intergenic
1115302650 14:31901824-31901846 TACAAATAGAAGATAGAGTCAGG - Intergenic
1116850945 14:49908765-49908787 TAAAAATCTCAAATGGTGTCAGG + Intergenic
1126336053 15:47587322-47587344 CAGAAATGTAAGATGGAGCCAGG - Intronic
1127753171 15:62066255-62066277 TAGAAAGGCCAGATGTAGTCAGG + Intergenic
1128375380 15:67070656-67070678 TAGAAATATGAGATCTAGTATGG + Intronic
1128753607 15:70166164-70166186 TAAAAATATCAGCTGGGGACTGG + Intergenic
1131137793 15:89951751-89951773 TTGAAATATCAAAAAGAGTCTGG + Intergenic
1134371589 16:13631035-13631057 TAGAAATAACACATAGACTCTGG - Intergenic
1135467103 16:22696179-22696201 TAGAAATTTCAGATGCTGTATGG - Intergenic
1137433418 16:48436337-48436359 TAGAAATAACAGAGGGAATTAGG + Intronic
1137856460 16:51799207-51799229 AAGAAATATCACAGGGAGCCTGG + Intergenic
1138275894 16:55734502-55734524 AAGAAAGATAAGGTGGAGTCAGG - Intergenic
1138388565 16:56653234-56653256 TGGAAATAACAGTTGGAGTGGGG + Intronic
1139130132 16:64133047-64133069 TAGATATTTCAGATGCAGGCAGG + Intergenic
1139474280 16:67194820-67194842 TAGAAACAGCAGATGGGCTCTGG - Exonic
1140449557 16:75059513-75059535 GAGAAATCTCAGATGCAGTGGGG + Intronic
1142477219 17:195752-195774 TAAAAATATCAAATGCAGCCTGG - Intergenic
1147306138 17:39565728-39565750 TAGAAATATGAGAGGGAAGCTGG - Intergenic
1147472016 17:40671462-40671484 TGGAAATATCAGGTGGACTGTGG + Intergenic
1149684657 17:58528426-58528448 TAGAACCAGCAGATGGAGGCTGG + Intronic
1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG + Intronic
1149879221 17:60271283-60271305 TACAAATATGAGATGGGCTCAGG + Intronic
1150948576 17:69775744-69775766 TAAAAATAACAGATGAAGTAGGG - Intergenic
1151264734 17:72945946-72945968 TAGAAAAATCAGATAAAGTCTGG + Intronic
1155185189 18:23381499-23381521 TAGAAAATACAGATGGAGGCCGG - Intronic
1155417487 18:25614709-25614731 CAGAAATTTCAAATGTAGTCAGG - Intergenic
1155693285 18:28653019-28653041 TATACATATTACATGGAGTCTGG + Intergenic
1156682308 18:39605861-39605883 TAGAGATATAAGATGGAGTAAGG - Intergenic
1156982504 18:43307051-43307073 TAAAAATATCAAATTGAGCCAGG + Intergenic
1157420197 18:47541370-47541392 CAGAAATATCAGGTGGAGGCTGG + Intergenic
1158218976 18:55130088-55130110 TAGAGATTTCAGAAGGAGTACGG + Intergenic
1158262323 18:55621120-55621142 AAGAAATGTAAGATAGAGTCTGG - Intronic
1161757651 19:6146172-6146194 TCAAAAAATCAGATGGAGCCAGG + Intronic
1162992339 19:14311750-14311772 TAGAAATAGGAGTTGGAGCCAGG + Intergenic
1163286260 19:16350123-16350145 TTTAAAAATCAGATGGAGGCTGG + Intergenic
1165891874 19:39117503-39117525 TAAAAATATAAGATGCAGGCCGG - Intergenic
1166642670 19:44507378-44507400 TAGAAGAATCAGATTGATTCAGG - Intronic
1167024212 19:46903114-46903136 CAGAAATCACAGATGGATTCAGG + Intergenic
927120427 2:19955243-19955265 TAGAAATATAAGATGTGGCCAGG - Intronic
927392464 2:22610812-22610834 TAGAACTATCAGAGAGAGACGGG + Intergenic
928094843 2:28398272-28398294 TAGAATTACCAGATGGGGTTTGG - Intronic
929283156 2:40105345-40105367 TAAAAATATCAGAATGGGTCTGG - Intronic
931049863 2:58399957-58399979 TATAAATATCAGATGAAGGAAGG + Intergenic
932129286 2:69173287-69173309 TAGAAATATCAGATGGAGTCAGG - Intronic
933317065 2:80727715-80727737 AAGAAATATCAGTGGTAGTCTGG + Intergenic
935574884 2:104698922-104698944 GAGAAAAATCACATGCAGTCTGG - Intergenic
936591864 2:113811992-113812014 TAGAAGTTTCAGATGTAGTGGGG + Intergenic
936772595 2:115932860-115932882 TAGAAATATGAGATACAGGCTGG + Intergenic
937549791 2:123073680-123073702 TAGAAATAACAGAAGGAGCCAGG - Intergenic
938309883 2:130282742-130282764 TAGAGATATGAGATGGAGTGGGG - Intergenic
938445034 2:131369627-131369649 TAGAGATATGAGATGGAGTGGGG + Intergenic
938927751 2:136059977-136059999 TAGAAATATCACAGGGAGCTTGG - Intergenic
942542521 2:177029460-177029482 CAGAAATATCAGATGTGGACAGG - Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
942819177 2:180090726-180090748 TAGAAAAATCTGATGGAATAAGG + Intergenic
943561794 2:189472920-189472942 AAGAAATATCATAAGGAGGCCGG + Intronic
944172274 2:196793130-196793152 GAGAAACATCAGATGGAGTGAGG - Exonic
946807731 2:223488187-223488209 AAGAAATAATAGATGGAGTGGGG + Intergenic
947698633 2:232214290-232214312 TAGAAAGTTCAAATGCAGTCTGG - Intronic
1169024955 20:2362570-2362592 TAGTTATATCAGACAGAGTCTGG + Intergenic
1169684467 20:8255258-8255280 TAGTAATATCAGAGGTAGTAAGG + Intronic
1170348688 20:15416562-15416584 CATAAATATGATATGGAGTCAGG + Intronic
1174595694 20:51681716-51681738 TAGAAGTTTCGGATGGAGGCTGG - Intronic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1182389643 22:29981911-29981933 TAAAAATTTCAGATTGAGGCCGG + Intronic
1183255404 22:36758569-36758591 AAGGAAACTCAGATGGAGTCAGG + Intronic
1183778486 22:39983539-39983561 TGGAAATGTCATATGGATTCTGG - Intergenic
1183850030 22:40577900-40577922 TAAAAAGATCAGATGTAGGCCGG - Intronic
953111170 3:39940284-39940306 GAAAAATATCAGATGGTGCCAGG + Intronic
953938735 3:47071204-47071226 AAAAAGTATCAGATGGAGTGTGG - Intronic
955078495 3:55636170-55636192 TATAAATCTCTGATGGAGGCTGG - Intronic
955812727 3:62808167-62808189 TAGAAATATCAAATTGAGGCTGG - Intronic
957422903 3:79994860-79994882 CAGAAATATCAGAAGGAGCATGG - Intergenic
957541198 3:81571332-81571354 TTGAAATATCAGAAGAAATCTGG - Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958771569 3:98432356-98432378 TAAAAATGTCAGATAGAGTTAGG + Intergenic
958943626 3:100339973-100339995 TAGAAACATCTGAATGAGTCAGG + Intronic
959917274 3:111829756-111829778 TAGAAATATCAGATGTTGGTCGG - Intronic
960345916 3:116532844-116532866 TTGAAATATCAGTTTGATTCTGG + Intronic
960893339 3:122475131-122475153 TAGAAATAATACATGGATTCAGG + Intronic
962156321 3:132952449-132952471 AAGAAATATCAGAAAGAGCCTGG - Intergenic
967464974 3:189794481-189794503 TAGAAATATAAGAAGGAATGAGG + Intronic
970229851 4:13898448-13898470 TAGAGGTATCAGAGGGAGTCTGG + Intergenic
970448120 4:16140759-16140781 TAGGAATATCTGATGGGCTCTGG + Intergenic
970601104 4:17641796-17641818 TTGAAATAAAAGAGGGAGTCTGG - Intronic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
972355592 4:38277115-38277137 TAGCACTATCAGAGGGAGTATGG - Intergenic
972471462 4:39409630-39409652 TAAAAATATCAGATTGGGCCGGG + Intronic
973826670 4:54714443-54714465 AAGAAATACTAGATGGAGTGGGG - Intronic
974000938 4:56510061-56510083 TAGAATTATAAGAGGGAGGCTGG + Intronic
975600145 4:76090555-76090577 TAGAAACATTAGACGCAGTCTGG - Intronic
975959265 4:79881112-79881134 TGGAAATATCAGCTGGTCTCTGG - Intergenic
977697516 4:99982504-99982526 TAGAAACAAAAGTTGGAGTCTGG - Intergenic
978074642 4:104513447-104513469 TAGAAAACTCAGATGGATCCTGG + Intergenic
982494181 4:156069368-156069390 TATAAATATCAAATAAAGTCTGG + Intergenic
984135988 4:175939926-175939948 CAGAAATATTATATGTAGTCTGG - Intronic
985304934 4:188529114-188529136 TAAAAATATCAACTAGAGTCTGG + Intergenic
986568476 5:9139872-9139894 TAGAAGAATCAGAAGGAATCGGG - Intronic
987442958 5:17979811-17979833 TAGAAATCACAGATGTAGTCAGG - Intergenic
989089396 5:37714372-37714394 TAGAAAAACCAGGTGGAGTTGGG + Intronic
989270755 5:39530116-39530138 TGGAAAAATAAGATGGAGCCAGG - Intergenic
989273564 5:39560017-39560039 GAGAAATATGAGATGATGTCAGG - Intergenic
989503564 5:42198565-42198587 TTTAAACATCAGATGGAGGCTGG - Intergenic
989972237 5:50538690-50538712 TAGAAAGATGAGAGGGAATCAGG - Intergenic
990385249 5:55254073-55254095 AAGACACATCACATGGAGTCTGG - Intergenic
992235051 5:74700585-74700607 TATAAATATAAGGTGGAGTATGG - Intronic
996615350 5:125435024-125435046 TGGAAATATCAGATGGACACAGG - Intergenic
996643727 5:125790658-125790680 TAAAAATATCATATGTATTCTGG + Intergenic
997081113 5:130739445-130739467 TAGAAATAACACATGGACACAGG - Intergenic
998186484 5:139983467-139983489 AAGAAATAGCACATGGAGTTTGG - Intronic
999107381 5:149085787-149085809 TACAAATATAAGATGTAGGCTGG - Intergenic
1002062458 5:176633903-176633925 TAGAAAGATCAGTAGGAGGCTGG + Intronic
1002359698 5:178660929-178660951 CAGAAATAGCATCTGGAGTCTGG - Intergenic
1002660421 5:180787814-180787836 GACAAATGTCTGATGGAGTCTGG - Intergenic
1003811030 6:9780769-9780791 AAAAAATATCAGTTGGATTCTGG - Intronic
1003861523 6:10326598-10326620 TAGAAAAGTCAGATGGGGCCGGG + Intergenic
1003942394 6:11043155-11043177 GAGCAAAATCAGATGGAGTGGGG + Intronic
1005248853 6:23920708-23920730 CAGAAAGATCAGCTGGGGTCAGG + Intergenic
1005824896 6:29626924-29626946 TAGAAGGATGAGAAGGAGTCAGG + Intronic
1007029304 6:38613713-38613735 TAAAAATGTCAGAGGGAGCCTGG + Intronic
1010774283 6:79867592-79867614 TAGGAATATCAGAAGAATTCAGG - Intergenic
1011792205 6:90910724-90910746 TGGAAATATCAAATGCAGTAAGG + Intergenic
1012127374 6:95447784-95447806 AAGAAACATCAGAAGCAGTCGGG + Intergenic
1013175926 6:107676405-107676427 GAAAAATATTAGATGAAGTCAGG + Intergenic
1015443762 6:133279115-133279137 TATCAACATGAGATGGAGTCTGG + Intronic
1015539165 6:134297210-134297232 TAGAAATGCCGGCTGGAGTCTGG - Intronic
1017429725 6:154359189-154359211 GAGCAATAACAGATGGAGGCAGG + Intronic
1020802464 7:12748544-12748566 TAGAAATATCCGATGGAGGCCGG + Intergenic
1023078670 7:36507452-36507474 TGCAAATATCAGTTGGAGCCAGG - Intergenic
1023343154 7:39243788-39243810 GAGACAAATCAGATGGATTCTGG - Intronic
1024147740 7:46534455-46534477 TATAAATTCCAGATGGGGTCAGG - Intergenic
1025226896 7:57173421-57173443 TAGAGATATTAGATGGTGTGGGG - Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025987060 7:66463137-66463159 TAGAAATAAGACATGGAGGCTGG - Intergenic
1026027951 7:66762292-66762314 TAGAAATAGGACATGGAGGCTGG + Intronic
1027210332 7:76141967-76141989 TAGAAATAAGACATGGAGGCTGG - Intergenic
1028315876 7:89402185-89402207 TAGAAATGTGAGTAGGAGTCAGG - Intergenic
1029123904 7:98284752-98284774 TAGAAAGGGAAGATGGAGTCAGG - Intronic
1029665321 7:101991461-101991483 TAAAAATATCAGTTGGGGCCGGG + Intronic
1029992468 7:104974751-104974773 TAGAAAAATCAAATGTAGGCCGG + Intergenic
1030486108 7:110170082-110170104 TAGAAATATCACCTGAAATCGGG - Intergenic
1031857979 7:126944582-126944604 TTGAAATTTAAGATGGATTCTGG - Intronic
1039156331 8:34562595-34562617 TAGGAATATGCGATGGAGTGGGG + Intergenic
1041625142 8:60016881-60016903 TATATATATAATATGGAGTCTGG + Intergenic
1041695359 8:60730562-60730584 TAGAAATATTAAATGGAGGCCGG + Intronic
1042101605 8:65280681-65280703 TAGAAACTTCAGATGGAGCATGG - Intergenic
1044263854 8:90160011-90160033 TAAAAATACCTGATGCAGTCAGG + Intergenic
1045600657 8:103711882-103711904 TATATATTTCAGATGGGGTCCGG - Intronic
1045719859 8:105096385-105096407 TAAAAATATCAGAGAGAGACTGG - Intronic
1046243156 8:111525993-111526015 TATGAATATCAGTTGGAGTCTGG + Intergenic
1047320088 8:123770929-123770951 TAGTAATCTCAGATGGAGCTCGG - Intronic
1047692990 8:127375381-127375403 TAGAAAGAGCAGATGGGGTTTGG - Intergenic
1048850505 8:138640965-138640987 TAGGAATGTCTGATGGAGGCAGG - Intronic
1049768574 8:144367882-144367904 AAGAAATATCAGATTGGGGCTGG - Intergenic
1050996945 9:12232496-12232518 AAGAAATCTCAGATGGAGATGGG - Intergenic
1051631737 9:19147182-19147204 CAGAACTATCACAAGGAGTCCGG - Intronic
1052890154 9:33691628-33691650 TAGTTCTATCAGATGGAGGCTGG + Intergenic
1053116219 9:35505376-35505398 TAGAAATATGTGGTGGGGTCGGG - Intronic
1053127641 9:35595891-35595913 TGGAAATGTCAGAAGTAGTCAGG + Intergenic
1053611385 9:39716543-39716565 TAGAAATATCAAAAGAACTCTGG + Intergenic
1053869420 9:42474592-42474614 TAGAAATATCAAAAGAACTCTGG + Intergenic
1054086869 9:60754617-60754639 TAGAAATATCAAAAGAACTCTGG - Intergenic
1054242135 9:62625849-62625871 TAGAAATATCAAAAGAACTCTGG - Intergenic
1054556260 9:66660365-66660387 TAGAAATATCAAAAGAACTCTGG - Intergenic
1055211148 9:73793919-73793941 AAGAAATGTCAGTTGGATTCTGG - Intergenic
1055584398 9:77742961-77742983 TAGAAAGATCAGCAGGAGGCTGG + Intronic
1056948085 9:91017846-91017868 TAGAACTATCAGGTGGAGGCAGG - Intergenic
1056983741 9:91341820-91341842 TAGAAAAATGTGATGGAGGCTGG + Intronic
1058122791 9:101157169-101157191 TAGAAAAATCAGGTGAAGTGGGG - Intronic
1059205046 9:112456686-112456708 TAAAAATGTCAAATGAAGTCTGG - Intronic
1062605564 9:137347102-137347124 TAGAAAAATGACATGGAGGCTGG - Intronic
1203369464 Un_KI270442v1:289110-289132 TATAAATATCAGAAGCAGACCGG + Intergenic
1186013960 X:5169574-5169596 TAGAGATATTAGATGGAGTGGGG - Intergenic
1186610907 X:11137386-11137408 TAAAAATATCAGATGGCTTTGGG - Intergenic
1187505032 X:19872474-19872496 TAGAAGTATCAGTTGGGGCCGGG + Intronic
1189065391 X:37803107-37803129 TAGAAATAACGCATGGAATCAGG + Intronic
1189078901 X:37947923-37947945 AAGAAATATGAAATGGAGTTGGG - Intronic
1190779653 X:53581228-53581250 TATAAAGATCACATGCAGTCTGG - Intronic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1193913045 X:87328351-87328373 CAGAAAAATCAGGTGGAGTTGGG - Intergenic
1194636972 X:96357793-96357815 TAGAAATATATGATGGGGTTAGG - Intergenic
1195018842 X:100805815-100805837 CAGAAATCTCAGATGGTGACGGG + Intergenic
1195404674 X:104499867-104499889 TATAAATATCAGATGCTGTCTGG - Intergenic
1195633795 X:107090077-107090099 TAGAAATGTCTAATGGAGGCCGG + Intronic
1197109066 X:122750585-122750607 TAGAAATATCAGATGGCACATGG + Intergenic
1197685413 X:129434606-129434628 TAGAAAATTCAGAGGGAGCCAGG - Intergenic
1198034118 X:132783955-132783977 TAGCAATATTAGCTGGAATCAGG + Intronic
1199091446 X:143697669-143697691 TAGATATATCAGAAGGTTTCAGG + Intergenic
1200712787 Y:6504025-6504047 TAGAAAGCTCAGATGGATACTGG + Intergenic
1201021128 Y:9658015-9658037 TAGAAAGCTCAGATGGATACTGG - Intergenic
1201075504 Y:10184539-10184561 TAAAAATATTAAATTGAGTCGGG + Intergenic
1201322416 Y:12714748-12714770 TAGATTTAACAGATGGAGGCCGG - Intronic
1201950913 Y:19562879-19562901 TAGAAATATAAGATGAAGCAGGG + Intergenic