ID: 932131228

View in Genome Browser
Species Human (GRCh38)
Location 2:69189240-69189262
Sequence CTGCTGTCATTGGGCTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932131228_932131234 9 Left 932131228 2:69189240-69189262 CCAGAAGAGCCCAATGACAGCAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 932131234 2:69189272-69189294 ATCAAGCATGCCCTGCAAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 99
932131228_932131235 10 Left 932131228 2:69189240-69189262 CCAGAAGAGCCCAATGACAGCAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 932131235 2:69189273-69189295 TCAAGCATGCCCTGCAAGTCGGG 0: 1
1: 0
2: 0
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932131228 Original CRISPR CTGCTGTCATTGGGCTCTTC TGG (reversed) Intronic
901823039 1:11842440-11842462 TTGCTGTCTTTGGGCTTATCTGG - Exonic
903555906 1:24193272-24193294 CTACTGTCATTGGCCTCTCTGGG + Intergenic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
908915101 1:69117151-69117173 CTCCTGTTATTGGTCTATTCAGG + Intergenic
911060240 1:93741191-93741213 TTGCTGTCATTGGGATGTTGGGG - Intronic
922587564 1:226746494-226746516 CTGTTTTCATTTTGCTCTTCCGG - Intergenic
923207572 1:231773785-231773807 CTGCTGTCTGTGGGGTCCTCTGG + Intronic
1064383043 10:14863404-14863426 GAGCTGTCAGTGGCCTCTTCAGG + Intronic
1064996681 10:21302388-21302410 CTGCTGTCATTGTGGGGTTCAGG - Intergenic
1065406326 10:25369845-25369867 CTCCTGTTATTGGTCTATTCAGG + Intronic
1066070363 10:31802571-31802593 CTGCTTTTACTGGTCTCTTCTGG - Intergenic
1070056765 10:72942686-72942708 CCGCAGCCATTGGGCTCTTGGGG + Exonic
1071602152 10:86963550-86963572 CTGCTGACAGTGGGTTCCTCAGG - Intronic
1072079659 10:92016252-92016274 CTGCTGTTATTGGCCTTTGCTGG + Intronic
1074655183 10:115578431-115578453 TTTCTGTCATTGGTCTTTTCAGG + Intronic
1074709340 10:116164023-116164045 CTGCTGCCACAGGCCTCTTCGGG - Intronic
1074786811 10:116849106-116849128 CTGCTGTTAGTGAGCTCCTCCGG - Intergenic
1075099695 10:119497454-119497476 CTGCTGGCATTCAGCTCTTCAGG + Intergenic
1075923222 10:126230167-126230189 CTCATGGCATTGGGCTCTTATGG + Intronic
1076045806 10:127293414-127293436 CTGCTGTCATTGGACACTGTGGG + Intronic
1080856357 11:36115131-36115153 CTCCTCTCATTGGCCTCTCCAGG - Intronic
1081965162 11:47164955-47164977 CTGCTGCCAGTGGCCTCTTCTGG - Exonic
1082194000 11:49279950-49279972 CTGCTGTGTTAGGGTTCTTCAGG + Intergenic
1085448044 11:76614528-76614550 CTGCTGGCATTGAGCACTTATGG - Intergenic
1085642338 11:78200324-78200346 CTGCTGACCCTGGGCTCTTGGGG + Intronic
1085803020 11:79608909-79608931 CTCCTGTCTTTGTGCTCATCTGG + Intergenic
1086522701 11:87688722-87688744 AAGCTGTCATTGGTCTATTCGGG - Intergenic
1086672149 11:89561104-89561126 CTGCTGTGTTAGGGTTCTTCAGG - Intergenic
1087312316 11:96559040-96559062 CTCCTGTTATTGGTCTATTCAGG - Intergenic
1091317707 11:134626120-134626142 CTGCTGTCATGAGGGCCTTCAGG - Intergenic
1092225813 12:6747727-6747749 CTGCTGTAACTTTGCTCTTCAGG - Intergenic
1093325615 12:17771044-17771066 CTCCTGTTATTGGTCTATTCAGG + Intergenic
1096216989 12:49803322-49803344 CTGCTGCCCTTGGCCTCTGCAGG - Intronic
1096557607 12:52413032-52413054 GTCCTGTCACTGGGATCTTCTGG + Intergenic
1097681919 12:62657107-62657129 GTGCTGTCACTGGGCTCATTGGG + Intronic
1100295397 12:93256463-93256485 CTTTTGTCATGGGCCTCTTCAGG - Intergenic
1100408978 12:94295784-94295806 CTGCTCTCATTGGGTTCCTCTGG + Intronic
1100518489 12:95351079-95351101 TTTTTGTCATTGTGCTCTTCAGG - Intergenic
1100821809 12:98438901-98438923 CTGCTGTGTCTGGGCTCTCCAGG + Intergenic
1103331811 12:120159468-120159490 CTGCTGTCATGTGGCTGTTCAGG + Intronic
1103748148 12:123140294-123140316 TTGCTGTCTCTGGGCTGTTCTGG - Intronic
1104326698 12:127805558-127805580 CTCCTGTCATTGTCCTTTTCTGG - Intergenic
1104399339 12:128462864-128462886 CTGCTGTTATTGGGGAGTTCTGG - Intronic
1104661466 12:130613922-130613944 CTGCTGTCATTGGGGTCCTATGG - Intronic
1106144248 13:27037488-27037510 GTGCAGGCATTGGGCTGTTCTGG - Intergenic
1106587493 13:31070012-31070034 CATCTGTGTTTGGGCTCTTCAGG - Intergenic
1108307718 13:49155195-49155217 CTCCTGTTATTGGTCTATTCAGG + Intronic
1108838885 13:54586795-54586817 CTGCTGTAATGTGGCCCTTCAGG - Intergenic
1109010351 13:56933330-56933352 CAGCTGTCTTTGGGCTATTTAGG - Intergenic
1112580411 13:100673246-100673268 CAGCTGTCATTGGGCCCTCATGG - Intronic
1118104263 14:62640010-62640032 CTCCTGTTATTGGTCTATTCAGG - Intergenic
1118442663 14:65826417-65826439 CAGCTGTGACTGGTCTCTTCTGG - Intergenic
1124855287 15:33381665-33381687 CTCCTTTCATTGGCCTCTTGTGG + Intronic
1129075924 15:72996118-72996140 CTCCTGGCAATGGGCTGTTCAGG + Intergenic
1129301709 15:74629268-74629290 CTTCTGACATCTGGCTCTTCTGG - Intronic
1131993532 15:98112966-98112988 GTGCAATCATTGGGCTGTTCTGG - Intergenic
1132075309 15:98815192-98815214 ATGTTGTCATTTGGCTCTTGGGG + Intronic
1132879428 16:2155401-2155423 CCTCTGTCATTGGGCTATCCTGG + Intergenic
1134242215 16:12514366-12514388 CTACTGTCTTTGGCATCTTCAGG + Intronic
1135007868 16:18843556-18843578 CTTTTGTCATTGGGCACTTGGGG - Intronic
1138379472 16:56590154-56590176 CAGCTGCCATTGGAGTCTTCTGG - Intronic
1140046756 16:71444720-71444742 CAGCTGTCCTTGGACTCTCCCGG + Intergenic
1141023348 16:80519426-80519448 CTCATGTCATTGAGCTTTTCTGG + Intergenic
1141652674 16:85401914-85401936 CCGCTGTGAGTGGGCACTTCTGG + Intergenic
1144006034 17:11100479-11100501 CTGCAGTGACTGGGCTCTGCAGG - Intergenic
1147876297 17:43623175-43623197 CTGCTCTCATTGGTCACTCCTGG + Intergenic
1148170468 17:45515265-45515287 CTGCTGTCTGAGGGCTCCTCCGG + Intergenic
1148170945 17:45519258-45519280 CTGCTGTCTGAGGGCTCCTCCGG + Intergenic
1148278736 17:46330542-46330564 CTGCTGTCTGAGGGCTCCTCTGG - Exonic
1148300946 17:46548404-46548426 CTGCTGTCTGAGGGCTCCTCTGG - Exonic
1148365075 17:47049294-47049316 CTGCTGTCTGAGGGCTCCTCCGG - Intergenic
1150156348 17:62856961-62856983 CTGCTGTCTTTGTGCCCTACTGG - Intergenic
1150401561 17:64860859-64860881 CTGCTGTCTGAGGGCTCCTCCGG + Exonic
1153386834 18:4507907-4507929 ATGTTTTCATTGTGCTCTTCTGG - Intergenic
1154316936 18:13311639-13311661 CTGCTGGCACTGTGCTCTTGAGG + Intronic
1159640373 18:70856916-70856938 CTCCTGTTATTGGTCTATTCAGG + Intergenic
1160125803 18:76170277-76170299 CTGCTTTAATTGGTCTCCTCAGG - Intergenic
1160134719 18:76262448-76262470 CTGCTTCCAGTGGGCTCTCCGGG - Intergenic
1160974146 19:1784543-1784565 CTGATGCCATCGGGCTCTTAAGG - Intronic
1165610656 19:37149508-37149530 ATGCTGTCATTGGGCCCTGCTGG + Exonic
1166631386 19:44410634-44410656 CTGATGTCATTGTGCTCTCCCGG + Intergenic
1168022885 19:53622691-53622713 CTGGTGACTGTGGGCTCTTCAGG - Intergenic
1168127037 19:54290074-54290096 CTGGTGCCATTGGGGTCTTCAGG + Intergenic
925352215 2:3209289-3209311 TGGCTTTCAGTGGGCTCTTCTGG - Intronic
931202500 2:60112051-60112073 GGGTTGTTATTGGGCTCTTCTGG - Intergenic
931846520 2:66209648-66209670 CTCCTGTTATTGGTCTATTCAGG - Intergenic
932131228 2:69189240-69189262 CTGCTGTCATTGGGCTCTTCTGG - Intronic
936039184 2:109136544-109136566 CTGCTTTCTTTAGGCTCTCCTGG + Intronic
936041859 2:109155962-109155984 ATGCTGTCACTGAGCTCTGCAGG + Intronic
937804600 2:126124274-126124296 CCGAGGTCATTGGCCTCTTCAGG + Intergenic
940649985 2:156432953-156432975 CTGCTGTCCTTTGGTTGTTCTGG + Intergenic
941461584 2:165778714-165778736 CGGCTGTGAATGGCCTCTTCTGG - Intronic
942666414 2:178324034-178324056 CTGCTATCTTTGGTCTTTTCAGG + Intronic
944237574 2:197453929-197453951 TTGGTGCCTTTGGGCTCTTCCGG + Intronic
945865068 2:215165145-215165167 CTGCTTTTATTGGTCTGTTCAGG - Intergenic
946137718 2:217661816-217661838 TTGCTGTTCTTGGGCTATTCAGG + Intronic
947475449 2:230443776-230443798 CTGGTTTCCTTGGGCCCTTCAGG + Intronic
1169100569 20:2944513-2944535 CAGCTGTCATTTGGCTCTATGGG - Intronic
1170228428 20:14018987-14019009 ATGATCTCATTGGGCTGTTCAGG + Intronic
1171012260 20:21515108-21515130 CTGCTGCCTCTGGGCTCTGCGGG + Intergenic
1171030475 20:21672089-21672111 CAGCTGGCATTGAGATCTTCTGG + Intergenic
1172186789 20:33035901-33035923 CTGCTGTCTTTGGAGTCTTGTGG - Intronic
1173224521 20:41154477-41154499 CTGCTGTCCTTGAACTCTGCCGG + Intronic
1173470381 20:43319074-43319096 CTGATGTCCTTGGCCTCTTCTGG - Intergenic
1174180034 20:48668840-48668862 CTGCCGCCATTGGGCCCTGCTGG - Intronic
1175985753 20:62763480-62763502 CTGCTGTCACCGGCCTCTTGTGG - Intergenic
1177191918 21:17861473-17861495 CTGCTGCCACTGTGCTCTTGTGG + Intergenic
1179635108 21:42703717-42703739 CTGCTGGCCTTGGGCTGTGCGGG + Intronic
1181003112 22:19997237-19997259 CTGCAGTCACTGGGCTCGTTCGG - Intronic
1181259872 22:21589896-21589918 CTGCTGTCATTAGCATCCTCAGG + Intronic
1181863013 22:25833964-25833986 CTGTTGTCAGTGTGTTCTTCTGG + Intronic
1182320696 22:29477097-29477119 CTGCTGTCCCTGGGCTTTTGTGG - Intergenic
1183990959 22:41596849-41596871 CTGGGGTCAGTGGGCTCTGCAGG + Intergenic
1184403541 22:44287281-44287303 CTGCTTCCCTTGGGCTCCTCTGG + Intronic
950144712 3:10640733-10640755 CTGCTTTCCTAGGGCTCTCCAGG + Intronic
951255312 3:20442471-20442493 CTGTTGTTATTGGTCTGTTCAGG - Intergenic
951867105 3:27320822-27320844 CTACTCTGATTGGACTCTTCTGG - Intronic
952674306 3:36008541-36008563 CTGCTGTCCTGGGGAGCTTCTGG - Intergenic
953096909 3:39786665-39786687 CTACTGTGATTAGGCTCTTGAGG + Intergenic
954927791 3:54252595-54252617 CTCCTGTCTTTGGTCTCTGCAGG + Intronic
956624739 3:71256298-71256320 CTGCTGTCCCTGAGCTCTACAGG - Intronic
960400781 3:117195394-117195416 CTTCTGTTATTGAGCTTTTCTGG - Intergenic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
963266595 3:143245970-143245992 CTGCTGACTGTGGGCTCTTTGGG + Intergenic
969417701 4:7071762-7071784 CTGCTTTCATTAGGCTCATGAGG - Intergenic
970391031 4:15614189-15614211 CTGCTGTAATTGTTCTTTTCTGG + Intronic
970473676 4:16401220-16401242 TGGCTGTCATTGGGCTTCTCAGG - Intergenic
972957746 4:44413827-44413849 ATGATGGCATTGGGCTCTTCTGG - Intronic
973640090 4:52893897-52893919 TTGCTGTCCTTGGGCTCCCCAGG + Intronic
975486627 4:74940758-74940780 GTACTGTAATTGGACTCTTCAGG + Intronic
979176714 4:117674064-117674086 CTGCTGTCATGTGACTCTTGTGG - Intergenic
981581070 4:146248826-146248848 CTGCTGTCAGTGTGGTCTCCTGG - Intergenic
984540251 4:181029542-181029564 ATTCTGTCAGTGGGCTCTTTTGG + Intergenic
985083481 4:186290270-186290292 CTACTGTCATTTTGCTCTTTTGG - Intergenic
985611152 5:890218-890240 CTGTGGTCATTTGGCTCTTCAGG - Intronic
985897802 5:2759523-2759545 CTGCTGTGATTGGAAACTTCTGG + Intergenic
988609989 5:32714236-32714258 CCGCTGACATTGGGATCTACAGG - Intronic
989709660 5:44381958-44381980 ATGATGTCATTGAGCTCTTAAGG - Intronic
990284213 5:54284030-54284052 CTGCTGTCATTTGCATCTTTGGG - Intronic
991101817 5:62801647-62801669 CTCCTGTTATTGGTCTATTCAGG + Intergenic
993343597 5:86754973-86754995 CTCCTGTTATTGGTCTATTCAGG + Intergenic
993709553 5:91211170-91211192 CTGCTGTGACTGTGCTGTTCTGG + Intergenic
994583950 5:101682305-101682327 CAGTTGTCACTGGGCTTTTCAGG + Intergenic
995076144 5:107985342-107985364 CTGCTGGCATTGGGCTGATATGG + Intronic
995646550 5:114319321-114319343 CTGTCTTCATAGGGCTCTTCAGG - Intergenic
995955606 5:117772911-117772933 TTGCTGTTATTGGTCTGTTCAGG - Intergenic
1001002163 5:168017862-168017884 TTGATGTCATTTGACTCTTCAGG + Intronic
1012005970 6:93713666-93713688 CTTTTGTTATTGGTCTCTTCAGG + Intergenic
1012999411 6:106007702-106007724 CTGCTGTCATTCGTCCCTTGAGG + Intergenic
1014058143 6:117040443-117040465 GAGCTGTCATTGGTCTGTTCAGG + Intergenic
1014421277 6:121248768-121248790 TTGCTGTTATTGGTCTGTTCAGG - Intronic
1015473133 6:133629010-133629032 TTGCTGACCTTGGGCTCTGCTGG + Intergenic
1019200996 6:170315105-170315127 CTGCTGTCCAGGGGCTCTCCTGG + Intronic
1020100820 7:5393531-5393553 CTGCAGGCTTAGGGCTCTTCCGG - Intronic
1020239026 7:6378023-6378045 CTGCTTACACTGGGCTCTTAAGG + Intronic
1022142483 7:27504853-27504875 CTCCTGTTATTGGTCTATTCAGG + Intergenic
1022444289 7:30457042-30457064 ATGATGTCATTGATCTCTTCAGG - Exonic
1022643102 7:32206523-32206545 CTCCTGACATTGGGGACTTCTGG - Intronic
1023595663 7:41827177-41827199 CTGCTCTCAGTGGGCTGTTGTGG - Intergenic
1023705005 7:42932164-42932186 CGGCTGTGCTTTGGCTCTTCGGG - Exonic
1024528543 7:50371304-50371326 CTGGTGTCATTGCCTTCTTCAGG + Intronic
1025023506 7:55497844-55497866 CTGATGTCATTCTGCTCTGCTGG - Intronic
1026733048 7:72927884-72927906 CTGCTCTCATGGGACTCTTGAGG + Intronic
1027110982 7:75439703-75439725 CTGCTCTCATGGGACTCTTGAGG - Intronic
1028123524 7:87084823-87084845 CTGCTGTGAATTGGCTATTCTGG - Intergenic
1028650530 7:93145989-93146011 TTGCTGTTATTGATCTCTTCAGG + Exonic
1029415913 7:100443161-100443183 CAGCTGTCCCTGGGCTCTTTGGG - Intergenic
1029791102 7:102843859-102843881 CTTCTCTCATTGTCCTCTTCAGG - Intronic
1030955442 7:115845922-115845944 CTGCTGCAGTTGGGCTCTTCAGG - Intergenic
1032257433 7:130308427-130308449 CTGCTGTCCCTGGGCTCGCCTGG + Intronic
1032515693 7:132504476-132504498 CTCCTCCCATGGGGCTCTTCAGG - Intronic
1032880234 7:136082486-136082508 CTGGAGTTATTGGCCTCTTCAGG + Intergenic
1033171258 7:139086530-139086552 CTGTAGTCAATGGGCTCTTCTGG + Intronic
1038061382 8:23917609-23917631 CTGTTGTCACTGGGCTTTCCTGG + Intergenic
1038436549 8:27540574-27540596 CTGCTGAGGCTGGGCTCTTCTGG - Exonic
1039769928 8:40675043-40675065 CTGCTGTCAATGAACTCTTGGGG - Intronic
1045256367 8:100527067-100527089 CTGATGTCACTGGGCTCAACAGG - Intronic
1045488365 8:102651809-102651831 CTGCTTTCATTGGGCAGGTCTGG + Exonic
1045490725 8:102666943-102666965 CTGTTTTCATGGGGCTCTTCTGG + Intergenic
1047268123 8:123327654-123327676 TTGTTGTCATTTGGATCTTCTGG - Intronic
1048640654 8:136356001-136356023 CTGCTGCTATTGGAGTCTTCTGG - Intergenic
1049120218 8:140730104-140730126 CTTCTATCATTGAGCTCTTTAGG - Intronic
1050560542 9:6830421-6830443 CAGCTGTCAGTGGGCTTTTGGGG + Intronic
1052429792 9:28351464-28351486 CTCCTGTTATTGGTCTATTCAGG - Intronic
1052688093 9:31779093-31779115 CTGCTGTCAGTGGGGTTTTGAGG - Intergenic
1053583843 9:39435931-39435953 ATGCTGTCATGGGGCTCGTATGG - Intergenic
1054105424 9:60994675-60994697 ATGCTGTCATGGGGCTCGTATGG - Intergenic
1055101168 9:72467157-72467179 CTGCTTTCACTGGGATCTGCTGG + Intergenic
1055346715 9:75347034-75347056 CTGCTGTTATTGGTCTGTTCAGG + Intergenic
1056063329 9:82907441-82907463 CTACTGTGATTGGACTCGTCTGG - Intergenic
1057037243 9:91820363-91820385 CTGCTTCCATTGGTCTCTGCTGG - Intronic
1057074074 9:92125913-92125935 GTGCCGTCATAGGGGTCTTCTGG + Intergenic
1057936905 9:99247923-99247945 CTGCTGTCATTGTGGTTTACAGG + Intergenic
1059747213 9:117214631-117214653 CTTCTGTGCTTGCGCTCTTCTGG + Exonic
1203790488 EBV:148944-148966 CTGCTGTCATCGGGATCCGCAGG - Intergenic
1186352260 X:8751792-8751814 CTGCTGTCAATGGCATCTGCTGG + Intergenic
1190442701 X:50491298-50491320 CTCCTGTTATTGGTCTATTCAGG + Intergenic
1192503779 X:71668920-71668942 CTGCTGTGCTTGGGCTCCTTGGG - Intergenic
1192522541 X:71814972-71814994 CTGCTGTGCTTGGGCTCCTTGGG - Intergenic
1195997607 X:110746700-110746722 CTGCTATCATTGGGATCTAGAGG + Intronic
1196474466 X:116066573-116066595 CTCCTGTTATTGGTCTATTCAGG + Intergenic
1197354489 X:125420243-125420265 CTGCTGTTTTTGGGTTCTTGAGG - Intergenic
1199496921 X:148462567-148462589 CTGATGTCATTGGGCCATTAGGG - Intergenic
1199812803 X:151367368-151367390 CTCCTGTTATTGGTCTATTCAGG + Intergenic
1202046131 Y:20738663-20738685 CTGCCCTCCCTGGGCTCTTCTGG + Intergenic