ID: 932131418

View in Genome Browser
Species Human (GRCh38)
Location 2:69190779-69190801
Sequence TCTCCTGGTATTATACATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932131416_932131418 5 Left 932131416 2:69190751-69190773 CCACAAAGAAACATCATTTTCTA 0: 1
1: 0
2: 3
3: 55
4: 587
Right 932131418 2:69190779-69190801 TCTCCTGGTATTATACATCTAGG 0: 1
1: 0
2: 1
3: 4
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932131418 Original CRISPR TCTCCTGGTATTATACATCT AGG Intronic
901390909 1:8945480-8945502 TCTCCTGACATTAGAGATCTGGG - Intergenic
904763773 1:32825672-32825694 TCTCTTGGTAATAGACATTTAGG + Intronic
909117793 1:71561292-71561314 GCCCATGTTATTATACATCTAGG + Intronic
910332823 1:86095304-86095326 TCTTCATGTGTTATACATCTGGG + Intronic
912914422 1:113798771-113798793 TCCCCTGTTATTAGACATTTAGG - Intronic
915202192 1:154239321-154239343 GCTCCTGGTATGATACATCCAGG + Intronic
917580554 1:176373597-176373619 TCTGCTGGAATTCTACATGTTGG - Intergenic
918314080 1:183308181-183308203 TCCCCTGGGATCATACCTCTGGG - Intronic
919240766 1:194913710-194913732 TTTCCTGTTATTTTGCATCTTGG - Intergenic
920232009 1:204476821-204476843 CCTCCTGGAGTTATACACCTTGG + Intronic
923539486 1:234877761-234877783 TCTGCTGGAATTGTGCATCTTGG + Intergenic
923625597 1:235611436-235611458 TGTGCTGGGATTATACATGTGGG + Intronic
923829075 1:237535058-237535080 TCTCTTGGATTTATACATCATGG + Intronic
1064549667 10:16486505-16486527 TGTCCTGTTATTATCCATCCTGG + Exonic
1065632690 10:27697108-27697130 ACTCCTGGTATTTTACAAATAGG + Intronic
1068215474 10:53977502-53977524 TCCCCATGTGTTATACATCTTGG - Intronic
1071426171 10:85555435-85555457 TCACCTGTTATTATACACCTAGG - Intergenic
1072300562 10:94057150-94057172 TCTTCTGGTTATATATATCTAGG + Intronic
1072759392 10:98043471-98043493 TCTCCTGGCATTATTTAACTGGG - Intergenic
1073067751 10:100773749-100773771 TCTGCTGGAATCATACACCTGGG - Intronic
1076168410 10:128300632-128300654 TCTCCTGGAATTTGATATCTCGG - Intergenic
1077909345 11:6560537-6560559 AATCCTGGTATTAATCATCTTGG - Intronic
1078823007 11:14901399-14901421 TCTCCTGTTGATATATATCTGGG - Intergenic
1079579685 11:22048042-22048064 TCTCATTGATTTATACATCTAGG - Intergenic
1081199778 11:40202090-40202112 TCTCTTGCTGTTATACATATGGG - Intronic
1085279865 11:75323003-75323025 TTTGCTGATATTATTCATCTGGG + Intronic
1085373372 11:76033715-76033737 TCTTATGTTATTAAACATCTAGG - Intronic
1086828019 11:91523907-91523929 TCACCTTCTATTATATATCTTGG - Intergenic
1089465661 11:118684155-118684177 TCTCCTGGTATCAAGCATTTTGG + Intergenic
1089482582 11:118819037-118819059 TCTCTTGGGATTATACATGGAGG + Intergenic
1091358902 11:134958741-134958763 ACTCCTGGAATTCTACTTCTCGG + Intergenic
1094109900 12:26851223-26851245 TCTACTCCTATAATACATCTTGG - Intergenic
1103965351 12:124635594-124635616 TCTCCTGTTGATAGACATCTGGG + Intergenic
1104706532 12:130951631-130951653 CCTCCAGGTATTATTCATGTGGG + Intergenic
1106154047 13:27135765-27135787 TCTGCTGCTATTATACATATGGG + Intronic
1106641821 13:31592567-31592589 TCTCCTTGTGTTACACATTTGGG - Intergenic
1114135866 14:19849485-19849507 TCCCCAGGGATTATACAACTAGG - Intergenic
1115795184 14:36927248-36927270 CCTCCTGGGAATATACATTTAGG - Intronic
1118352763 14:64985377-64985399 TCTCTTGGTATTATAATTTTTGG + Intronic
1118973347 14:70655752-70655774 TCTAGTGAAATTATACATCTGGG - Intronic
1119202501 14:72766997-72767019 TCTACTGGTATTATCCTACTTGG - Intronic
1119490956 14:75032774-75032796 TTTCCTGGTATTTTACCACTTGG + Intronic
1120356481 14:83440960-83440982 TCTCCTTGTTTTATACATACAGG - Intergenic
1124662056 15:31557907-31557929 ACTCCTGGGATGACACATCTGGG + Intronic
1125253107 15:37729291-37729313 TCACCTGTTATTGGACATCTAGG + Intergenic
1127572646 15:60259307-60259329 TTTCCTGGTATGATAATTCTGGG - Intergenic
1128501842 15:68232076-68232098 TCCTTTGGTATTATGCATCTTGG + Intronic
1129263839 15:74383483-74383505 CCCCCTGGTATTTTAAATCTTGG - Intergenic
1129488486 15:75901438-75901460 ACTCCAGGTACTGTACATCTGGG + Intergenic
1130171365 15:81518255-81518277 TCTCCTTATATTTTGCATCTAGG - Intergenic
1130303524 15:82698333-82698355 TCTCCTGGTGGTATATGTCTGGG - Intronic
1131781002 15:95859121-95859143 TCTACTGACATTAAACATCTAGG - Intergenic
1132062798 15:98706232-98706254 TCTCGTGGTATCATACATGTTGG + Intronic
1133354889 16:5128750-5128772 CCTCCTGGTATTATTCATTATGG - Intergenic
1134258539 16:12631199-12631221 TCTCCTGGTAATAAAGAGCTTGG - Intergenic
1137303010 16:47172069-47172091 TATGCTGGAATTATACATTTGGG - Intronic
1138948263 16:61879036-61879058 TTTCCTGGCATTATAAATTTAGG - Intronic
1139141367 16:64266589-64266611 TCTGCTGCTATTATAACTCTTGG - Intergenic
1140256533 16:73341564-73341586 TCTCCTGGGTGTGTACATCTAGG - Intergenic
1142760270 17:2037843-2037865 TCGCCTAGTATTAAACAGCTAGG - Intronic
1144837067 17:18162096-18162118 TCTGCTGCTTTTATGCATCTGGG - Intronic
1145859429 17:28195755-28195777 CCTCCTGGAGTTATACAACTTGG + Exonic
1145917640 17:28585204-28585226 TCCCCTGGTAGTATACAACATGG - Exonic
1151394305 17:73811414-73811436 TCTCCTGTTGGTAGACATCTGGG - Intergenic
1151774845 17:76193503-76193525 TCTACTGGAATTTAACATCTTGG + Intronic
1153697165 18:7655638-7655660 TCACCTGGTAAAAGACATCTTGG - Intronic
1153961533 18:10144141-10144163 TCTCCTTTTATTTTAGATCTAGG + Intergenic
1156200894 18:34830400-34830422 ACTCCTGGCATTATTCACCTAGG + Intronic
1164407344 19:27962803-27962825 TCTCCTGGAATATTACATTTAGG + Intergenic
1165147657 19:33741885-33741907 TCTATTCGGATTATACATCTGGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166625940 19:44356321-44356343 TCGCCTGTTATTATACTGCTAGG + Intronic
1167720909 19:51179689-51179711 TCACCTGGTGTAATAGATCTTGG - Intergenic
926937849 2:18104008-18104030 TCTCCTCTTATTAGTCATCTTGG + Intronic
927039993 2:19219344-19219366 TCTCCTGGTATTATTGCCCTTGG - Intergenic
930672086 2:54162225-54162247 TCTCCTGGCATTATTCATAAAGG - Intronic
931848427 2:66228754-66228776 TCTCCTGGTCCCATATATCTAGG + Intergenic
932131418 2:69190779-69190801 TCTCCTGGTATTATACATCTAGG + Intronic
932700140 2:73986008-73986030 TCTCCTGGTATTTTTCCTCCAGG - Intergenic
933475580 2:82785801-82785823 TCTTCTGGAATTTTTCATCTAGG - Intergenic
937113349 2:119384623-119384645 TCTCCTGATTTTATTCATGTTGG - Intergenic
937490932 2:122366484-122366506 TCTCCTGTTATTTGACTTCTGGG - Intergenic
937757278 2:125555677-125555699 TCACCTGGTAATTTACAGCTGGG + Intergenic
944782261 2:203031856-203031878 CCTCCTGGTATTCTACCTCCTGG + Intronic
945420406 2:209629080-209629102 TCTTTTGGTATTATACATTATGG - Intronic
946687708 2:222288207-222288229 TCTCCTGGCATTCAACAACTGGG + Intronic
948110035 2:235447248-235447270 TCACCTAGTAGTATATATCTTGG + Intergenic
1169327730 20:4688615-4688637 TGCCCTGGTGTTATACATTTAGG - Intronic
1174012290 20:47459822-47459844 TCTCCTGCCATTGGACATCTCGG + Intergenic
1177481937 21:21701326-21701348 CCTCCTAGTGTTGTACATCTTGG - Intergenic
1184881340 22:47306376-47306398 GGTCCTGGTGTTAGACATCTTGG + Intergenic
949389716 3:3545300-3545322 TCTCCTGTTAGTAAAAATCTAGG - Intergenic
949646471 3:6100874-6100896 TCTCCAGGTTATATACACCTAGG + Intergenic
951176961 3:19613715-19613737 TCTCCTGATCTTATAAAACTGGG + Intergenic
952428083 3:33195622-33195644 TCTCCTGTTATTAGACGTTTTGG - Intronic
956207921 3:66772985-66773007 TCTGCTGTTATTATTCTTCTAGG + Intergenic
957800962 3:85080743-85080765 TATCCTTGTATTATTCCTCTAGG + Intronic
957953661 3:87156256-87156278 TATCCTGGTATTGAACATTTAGG + Intergenic
961025995 3:123558025-123558047 TCTCCTAGTAAAGTACATCTTGG - Intronic
961843792 3:129742667-129742689 TCTCCTGGGTGTATACATGTAGG - Intronic
962141094 3:132791662-132791684 TGTCCTGGTATTTTACAAATGGG + Intergenic
962242757 3:133765183-133765205 TCGTCTAGGATTATACATCTAGG + Intronic
963704631 3:148670521-148670543 TCCCCTGGTCTTACATATCTAGG + Intergenic
967789887 3:193536814-193536836 TATCCTGGTAGTAAACATATGGG + Intronic
967799958 3:193646179-193646201 TCTCCTGTCAATATATATCTAGG - Intronic
973566495 4:52194029-52194051 TCTGCTTGTATTAGATATCTTGG + Intergenic
974163995 4:58176764-58176786 TCACCTGTTAATAGACATCTGGG + Intergenic
974358862 4:60849477-60849499 TATTCTGGTATTAGACATTTGGG - Intergenic
974510928 4:62839561-62839583 TCTCTTGGTATTCTACCTTTTGG + Intergenic
974956574 4:68648442-68648464 TCCCCTTGTATGATACCTCTTGG + Intronic
978779773 4:112538758-112538780 TCTCCAGGTATTGTATTTCTAGG + Intergenic
978913382 4:114093305-114093327 TCCCCTGGGATTATACATTATGG - Intergenic
988132940 5:27129310-27129332 TTTCCTGGTTGTAGACATCTGGG - Intergenic
989707721 5:44357748-44357770 TCTCCTGCTTTTCAACATCTTGG + Intronic
990167218 5:53008066-53008088 TCTCCTTGTATTAGTCAGCTCGG + Intronic
996628623 5:125600858-125600880 TCTGCTAGTATTATTCCTCTTGG - Intergenic
1004024409 6:11805187-11805209 ACGCCTGGTTTTATACATTTTGG - Intronic
1007615114 6:43175042-43175064 TCTTTTGGTAGTTTACATCTTGG + Intronic
1008268994 6:49467291-49467313 ACTCCTGGTATTATACCACAAGG - Intronic
1011844426 6:91545788-91545810 TCTCCTGGTATTATCATTATTGG - Intergenic
1011939053 6:92819490-92819512 TGTCATTGTCTTATACATCTTGG + Intergenic
1013994379 6:116291221-116291243 TCTCCTAGTATTATAATTATTGG - Intronic
1014215890 6:118752370-118752392 TTGCCTGGTGTTATACATTTGGG + Intergenic
1015558951 6:134494327-134494349 TCTCCTGTTAATGGACATCTGGG - Intergenic
1016540815 6:145161813-145161835 TTTCCATGTATAATACATCTGGG - Intergenic
1016901823 6:149110496-149110518 TCTCTTGAAATTAAACATCTAGG - Intergenic
1018336921 6:162802160-162802182 TCTCCTAATAATATATATCTTGG + Intronic
1018702998 6:166442042-166442064 TCTCCTGGTCTTATGAGTCTGGG - Intronic
1020813787 7:12878935-12878957 TAGCCTGGTATTATAAATTTTGG + Intergenic
1021445850 7:20732678-20732700 GCACCTGGTATTAGACATATGGG - Intronic
1023014049 7:35948696-35948718 CCTCCTGGAATTAAACATTTTGG + Intergenic
1023162722 7:37312829-37312851 TCTACATGTATTATACATGTGGG + Intronic
1024066944 7:45746293-45746315 CCTCCTGGAATTAAACATTTTGG - Intergenic
1025115073 7:56250745-56250767 CCACCTGGAATTATACCTCTTGG + Intergenic
1026199327 7:68200616-68200638 TCTCCTGGAATTATACCTCTTGG + Intergenic
1032492056 7:132331130-132331152 CCTGCTGTTATTATACAGCTAGG - Intronic
1035916206 8:3626579-3626601 TCTCATGGTTTTCTAAATCTAGG - Intronic
1037053275 8:14403684-14403706 TCTCACAGTATTATACTTCTGGG + Intronic
1038052348 8:23825958-23825980 TCTCCTAGTTGTATACATTTGGG - Intergenic
1038245256 8:25849074-25849096 TCTCTAGGAATTAGACATCTGGG + Intronic
1042863769 8:73338901-73338923 TCTCCTGTTAATAGACATTTAGG - Intergenic
1043018066 8:74965965-74965987 TCTCCTGCTATTTTAAATCAAGG + Intergenic
1043741656 8:83821158-83821180 CCTCCTCCTAGTATACATCTGGG + Intergenic
1045040990 8:98224462-98224484 TCTACTGGTATTCTACCTCATGG + Intronic
1047044334 8:121034626-121034648 TATCATGGTCTTATAAATCTAGG - Intergenic
1048229256 8:132620972-132620994 TCTCCTGCTATTATCAGTCTTGG - Intronic
1051389752 9:16551556-16551578 TCTCCTGGTATTATCCTCATGGG + Intronic
1052959664 9:34284435-34284457 TCTCCTGTTAATAAACAACTGGG - Intronic
1053279646 9:36810410-36810432 TCTCCTGTTCATAGACATCTAGG + Intergenic
1055419719 9:76126029-76126051 TCTCCCTCTATTATATATCTTGG - Intronic
1055453964 9:76456014-76456036 TCTCCTAATATTATAGATGTGGG - Intronic
1058254234 9:102741193-102741215 ACTCCTGTTTTTATACATATGGG + Intergenic
1059520793 9:114939974-114939996 TCTCCTTGTATAATACATAGCGG + Intergenic
1186617037 X:11200269-11200291 TGTCCTGATAGAATACATCTTGG + Intronic
1187856552 X:23642153-23642175 TCTCCAGAAATTATTCATCTTGG - Intergenic
1192384468 X:70652142-70652164 TCTCCTAGTATTACACCTCATGG - Intronic
1198427496 X:136534547-136534569 TCTCCTGGTGATAAACATGTGGG + Intronic
1198776532 X:140185379-140185401 TCTCCTGGTATCACACTTTTGGG + Intergenic
1199539183 X:148939738-148939760 TTTCTTGGTATTAGCCATCTTGG + Intronic