ID: 932132979

View in Genome Browser
Species Human (GRCh38)
Location 2:69204334-69204356
Sequence ATGGAGATGCTGAACGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932132979_932132987 17 Left 932132979 2:69204334-69204356 CCATCTTCGTTCAGCATCTCCAT 0: 1
1: 0
2: 0
3: 13
4: 177
Right 932132987 2:69204374-69204396 CTGACCCTCAGTCTCGGAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 140
932132979_932132985 11 Left 932132979 2:69204334-69204356 CCATCTTCGTTCAGCATCTCCAT 0: 1
1: 0
2: 0
3: 13
4: 177
Right 932132985 2:69204368-69204390 CTCAACCTGACCCTCAGTCTCGG 0: 1
1: 0
2: 0
3: 18
4: 150
932132979_932132990 22 Left 932132979 2:69204334-69204356 CCATCTTCGTTCAGCATCTCCAT 0: 1
1: 0
2: 0
3: 13
4: 177
Right 932132990 2:69204379-69204401 CCTCAGTCTCGGAGTTGGACTGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932132979 Original CRISPR ATGGAGATGCTGAACGAAGA TGG (reversed) Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
913318233 1:117570857-117570879 TTGGAGATGCTGCAAGAAGCAGG - Intergenic
915580653 1:156811081-156811103 AAGGAGATGCTGAGAGAGGAGGG - Intronic
915589673 1:156863383-156863405 ATGGAAAGGCTCAACGAGGAGGG - Intronic
916486440 1:165263952-165263974 ATGGTAGTGCTGAATGAAGAAGG + Intronic
920077015 1:203344589-203344611 AGGGAGATACTGATGGAAGAGGG + Intronic
921195694 1:212755362-212755384 ATGGAGATGTTAATGGAAGATGG + Intronic
1064587469 10:16852590-16852612 ACGGAGTTGCTGAAAGAAGTGGG + Intronic
1067570008 10:47364852-47364874 ATGGAGAGGCTGAGCACAGAAGG - Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1067949675 10:50720750-50720772 CAGGAGATGCTGAATAAAGATGG - Intergenic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069780783 10:70954103-70954125 ATGGATGTGCTGAGGGAAGAAGG - Intergenic
1070884983 10:79885790-79885812 CAGGAGATGCTGAATAAAGATGG - Intergenic
1073063813 10:100746876-100746898 CTGGAGATGCTGAGAGATGAGGG - Intronic
1073212146 10:101813193-101813215 ATGGAGATGCTCCAAGAAGAGGG - Intronic
1074289182 10:112125526-112125548 ATGCAGATTCTGACCGCAGAGGG - Intergenic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1075968098 10:126630297-126630319 CTGCAGATGCTGGATGAAGAGGG + Intronic
1076160161 10:128237535-128237557 TTACAGATGCTGAAGGAAGATGG + Intergenic
1076920965 10:133454484-133454506 ATGGAGATGCTGCACCCAGGTGG + Intergenic
1080110366 11:28559959-28559981 ATGGATATGCTGGACAAAAAGGG - Intergenic
1081706597 11:45185638-45185660 ATGGAGATACTGGACAAAAAAGG + Intronic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083225672 11:61282969-61282991 ATGGAGATGAGGGAGGAAGAGGG - Intronic
1083336381 11:61924112-61924134 ATGGAGATGGTGGTCGAAGGAGG - Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1089049248 11:115531870-115531892 ATGGAGATTCTGTACTTAGAGGG - Intergenic
1089097024 11:115927690-115927712 TTCGAGAAGCTGAAAGAAGATGG + Intergenic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092976905 12:13753974-13753996 ATGGAGATTTTGAACCAAGTGGG + Intronic
1094266678 12:28567701-28567723 ATGAACATGCTAAACAAAGATGG + Intronic
1096020047 12:48316448-48316470 GTAGAGATGCTGCAGGAAGAAGG - Intergenic
1099691514 12:85959316-85959338 TTGGATATGCTGAAAAAAGAGGG + Exonic
1104469570 12:129018665-129018687 AAGGAGATGGTGCAGGAAGAAGG - Intergenic
1104510269 12:129371372-129371394 ATGGTGATGATGAATGATGATGG + Intronic
1106383398 13:29262179-29262201 ACAGAGCTGCTTAACGAAGAAGG - Intronic
1108056082 13:46486771-46486793 ATGGAGATGCTTTCTGAAGATGG + Intergenic
1109489766 13:63082014-63082036 TTGGACATGATGAATGAAGATGG + Intergenic
1115912775 14:38274925-38274947 ATGGAGGTGGAGAACAAAGAGGG + Intergenic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1121285481 14:92732160-92732182 ATGAAGATGTTGAACTAAGTGGG + Intronic
1124049340 15:26180432-26180454 ATGGAGTTGATAAAGGAAGAAGG + Intergenic
1125243320 15:37602332-37602354 ATGGAGACACTAAACGATGATGG + Intergenic
1126723679 15:51608836-51608858 ATGGAGATTCTCCAGGAAGAAGG + Intronic
1132128954 15:99256392-99256414 AAGCACATGCTAAACGAAGATGG - Intronic
1137741058 16:50774645-50774667 GTGGAGATGCTGGACGGGGATGG + Intronic
1138741742 16:59318603-59318625 ATGGAGATTCTGAAGGGTGAGGG - Intergenic
1138833016 16:60398704-60398726 ATGGAGAGGCTGACTAAAGAAGG - Intergenic
1138881912 16:61026966-61026988 ATGGAGATAGTGAAGGAAAAGGG + Intergenic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1140355773 16:74304867-74304889 ATTGAGAAGCTTAACTAAGATGG - Intronic
1141325039 16:83048897-83048919 ATAGAGATGTTGAGTGAAGATGG - Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1146093253 17:29903568-29903590 AGGGAGATGCAGAACAGAGAAGG - Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147705064 17:42420737-42420759 ATGGAGATTCTGAGAGAAGAGGG - Intronic
1149083530 17:52686485-52686507 ATAAAGATGCTGAACAAACAGGG + Intergenic
1152468482 17:80478106-80478128 GCTGAGATGCTGAACGCAGACGG - Intergenic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1155165933 18:23232507-23232529 ATGGAGATGATGAATGCACAGGG - Intronic
1155416117 18:25601559-25601581 TTGGAGGTGCTGAAGGAAGCAGG - Intergenic
1155662442 18:28265734-28265756 AGCGAGATGCTTAAGGAAGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156455397 18:37290510-37290532 CTGGAAATGCTGATCCAAGAAGG + Intronic
1157400226 18:47381155-47381177 CTGGATATGCTGAATGAACATGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1158720959 18:59924071-59924093 AGTGAGATGCTGAAAAAAGATGG - Intergenic
1161348867 19:3781567-3781589 TTGGGGGTGCTGAAGGAAGATGG - Intronic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1165663321 19:37602317-37602339 ATCGAGATGTTGAACAGAGATGG + Intronic
1165689026 19:37848500-37848522 GAGGAGATGCTGAAAGAACAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166355403 19:42224549-42224571 CTGGTGATGCTGGAAGAAGAGGG - Exonic
1166853592 19:45771576-45771598 ATGGAGTTGCTGCAGGCAGAGGG - Exonic
926528516 2:14012115-14012137 AAGGAGATGGTGCAGGAAGAAGG - Intergenic
927354119 2:22153348-22153370 TTGGAGATGCTGGATGAAGGAGG + Intergenic
930449069 2:51511265-51511287 ATGGAGCAGCTGAACAGAGAGGG - Intergenic
930794660 2:55376023-55376045 ATGTAGATTCTGAACGTACAAGG + Intronic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
935807539 2:106763686-106763708 CAGGAGATGCTGATAGAAGATGG - Intergenic
935914983 2:107939584-107939606 ATGGAGATCCTGAATAATGATGG - Intergenic
936932412 2:117803856-117803878 ATGGAGATGCAGAAATCAGATGG - Intergenic
942528351 2:176880702-176880724 ATGGAGATTCTGAAATAAGGAGG + Intergenic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
946642042 2:221794430-221794452 CTGGAGATACTGAACCTAGATGG - Intergenic
1169151701 20:3294661-3294683 GTGTATATGCTGAAGGAAGATGG - Intronic
1169554743 20:6737232-6737254 ATGGAGATGTGGGAGGAAGAAGG + Intergenic
1172322613 20:34008272-34008294 ATGGAGATGCTGAAGGAATCTGG + Intronic
1173388748 20:42612339-42612361 ATGGAGATTCTGAAAGAATGGGG + Intronic
1173809802 20:45948856-45948878 CTGGAGATCCTAAATGAAGAGGG + Exonic
1173823866 20:46035160-46035182 ATGGGGAGGCTCAAGGAAGAAGG - Intronic
1175392703 20:58637136-58637158 ATGGAGAGGCAGAGCCAAGATGG - Intergenic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1177471627 21:21567143-21567165 ATGGACAGGCTGAACAAAGAAGG + Intergenic
1179398328 21:41061294-41061316 GTGGGGATGCTGGACAAAGAGGG - Intergenic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183356155 22:37360851-37360873 ATGGAGATGAAGAACCAAGATGG + Intergenic
1184391451 22:44205778-44205800 CTGGAGCTGCTGAAGGACGAGGG + Exonic
950312446 3:11970307-11970329 ATGGAGAAGCTGAGCCCAGAGGG + Intergenic
952563062 3:34618509-34618531 ATAGAGAAGCTGAATGAATAAGG - Intergenic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
955116558 3:56010983-56011005 ATGGAGAGGCTAAGCAAAGAGGG - Intronic
955600865 3:60643605-60643627 ATGTAGATGCTGTACGCAGATGG + Intronic
959437520 3:106334880-106334902 ATGGAGATGCTGGAAAAAAATGG - Intergenic
961779531 3:129313616-129313638 GTGGAGATGGTGAATGATGAGGG - Intergenic
962235140 3:133700845-133700867 AAAGAGATGGTGAAGGAAGAAGG - Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
966934202 3:184695141-184695163 ATGGAGATGCTTGAGGAAGATGG - Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969141275 4:5076004-5076026 CTGGAGATGCTGAATTAACATGG + Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
972267483 4:37476416-37476438 ATGAAGATGCTGAAGGGATATGG - Intronic
978154692 4:105475098-105475120 TTGGAGATGCTGAAAGAACCTGG - Intergenic
979442608 4:120769357-120769379 ATGGATATGCTGACCTAACAAGG + Intronic
981403904 4:144344499-144344521 ATGGAGATGATGCAACAAGAAGG - Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
982918018 4:161238670-161238692 ATGGAGATGCTGATAGCACAAGG - Intergenic
983164029 4:164452363-164452385 ATGGAGTTGCTGATGGAAGCAGG - Intergenic
984128825 4:175847459-175847481 ATGGAGAGGCTGATCAAAGGGGG - Intronic
985268346 4:188171207-188171229 ATAGAGATGATGACTGAAGAGGG + Intergenic
987200631 5:15573516-15573538 ATGGTGATGTTGGCCGAAGAAGG + Intronic
988322134 5:29712542-29712564 AGGGAAATGCTGAATGAAAACGG + Intergenic
993045212 5:82858632-82858654 AGGGAGACACTGAAGGAAGAAGG - Intergenic
995638763 5:114228020-114228042 ATGATGATGATGAAAGAAGAAGG + Intergenic
996469594 5:123844557-123844579 GTGAGGATGCTGAAAGAAGATGG - Intergenic
996924129 5:128802816-128802838 TTGGAGATGGTGAACAAAGAGGG + Intronic
996945504 5:129062278-129062300 GTGGAGATGCTGAACAGAGGGGG + Intergenic
997916876 5:137935515-137935537 ATGGAGATGCTAAAGGGAAAAGG + Intronic
1000100058 5:158007734-158007756 AAGGAGATGCTGTGGGAAGAAGG - Intergenic
1000112067 5:158117729-158117751 ATGGACATGATGGAAGAAGAGGG + Intergenic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1000759676 5:165206810-165206832 ATGGAGACGGAGAACAAAGAGGG + Intergenic
1004698418 6:18055864-18055886 GTGAAGATGCTGAATGAATATGG - Intergenic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1009184752 6:60561519-60561541 ATGGAGCTGCTGTAAGTAGATGG - Intergenic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1013899619 6:115138827-115138849 ATGTAGCTGCTGAACGTAGTGGG - Intergenic
1014949588 6:127539107-127539129 ATGCAGATGCTGGAGGAAGCAGG - Intronic
1015225509 6:130852776-130852798 ATGGAGATGCAGGAGGAAGGAGG - Intronic
1015738998 6:136433386-136433408 GTGTAGATGCTGACAGAAGAAGG - Intronic
1017147144 6:151244627-151244649 ATGGAAATGGAGAACGAAGATGG + Intronic
1017641641 6:156500184-156500206 AAGGAGATGCTAAAGGAATAGGG - Intergenic
1018172906 6:161155608-161155630 ATGGAGATGCTAAACCTAGAAGG - Intronic
1021262101 7:18471129-18471151 ATGGAAATGCTGAAAGAACAAGG + Intronic
1021574514 7:22095014-22095036 AGAGAGATGGTGATCGAAGAGGG + Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1027395131 7:77746400-77746422 ATGGTGATGCAGAACCAAGGGGG + Intronic
1027462358 7:78470537-78470559 AAGGAAATGGTGAACGAAAAAGG - Intronic
1030058577 7:105604592-105604614 ATAGAGGTGCGGGACGAAGAAGG + Intergenic
1030630248 7:111887879-111887901 AGGGAGATCCTGAAGGAAGTAGG + Intronic
1030899316 7:115103017-115103039 GTGCAAATGCTGAATGAAGAAGG + Intergenic
1034393636 7:150803818-150803840 ATGGACATGCTGAAGGTAGGTGG + Exonic
1036124263 8:6048659-6048681 GTGGAGAGGCTGAATGCAGAGGG + Intergenic
1037127215 8:15365877-15365899 ATGTAGATGCTGCAGGAAGTGGG - Intergenic
1043817738 8:84823791-84823813 ATAGAGAAGCTGAAAGAAGGAGG - Intronic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044540146 8:93399516-93399538 ATGGGGAAGCTGCAAGAAGAGGG + Intergenic
1044670673 8:94677325-94677347 GTTGAGATGCTGAATGAATATGG - Intronic
1045106061 8:98893790-98893812 ATGGAGAAGCTGCAAGAACAAGG + Intronic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1051804147 9:20972900-20972922 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804156 9:20973002-20973024 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804174 9:20973211-20973233 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804182 9:20973316-20973338 CAGCAGATGCTGAAAGAAGACGG - Intronic
1051944326 9:22548747-22548769 ATGGAGATGGTGAAGGCAGTAGG - Intergenic
1052580968 9:30353261-30353283 ATGGAAAGGCTGAAAGAAAAAGG - Intergenic
1055101818 9:72473394-72473416 ATGGAAATACGGAAGGAAGAAGG + Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057894653 9:98899051-98899073 ATGGAGAGGCTGTAAAAAGAAGG + Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1186748585 X:12597054-12597076 ATAGAGATGCTGAACAGAGCTGG - Intronic
1189211425 X:39287260-39287282 AGGGAGAGGCAGCACGAAGAAGG + Intergenic
1190709085 X:53053347-53053369 AAGGAGATGATGAACAAACATGG - Intronic
1193624716 X:83804021-83804043 ATGGAGATGATGAAGAAAAATGG + Intergenic
1194054377 X:89113248-89113270 ATGGAAATGCTGTAAGAAAAAGG - Intergenic
1196089457 X:111724470-111724492 ATGGACATGCTAAATGAAGGAGG - Intronic
1196962492 X:121018341-121018363 AAGGAAATGCTGAAAGAAAAGGG + Intergenic
1197903561 X:131399183-131399205 ATGTAAATGCTGAAGGAAAAGGG + Intronic
1199585167 X:149407086-149407108 AAGGAGATGCAAAAAGAAGAAGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic