ID: 932134896

View in Genome Browser
Species Human (GRCh38)
Location 2:69219738-69219760
Sequence TGTCCTCTGTTTTTAACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932134896 Original CRISPR TGTCCTCTGTTTTTAACAAG TGG Intronic
901386245 1:8911329-8911351 TTTGCTTTGTTTTTAACAAAAGG + Intergenic
901459827 1:9384847-9384869 TGTCCTCTGTTCTCAATAAATGG + Intergenic
902716266 1:18275098-18275120 TGTAATCGGTTTTTAAGAAGAGG - Intronic
905338704 1:37263590-37263612 TGACCTCAGTTCTTACCAAGTGG - Intergenic
905372730 1:37493470-37493492 TTGCCTCTGTTTTTTGCAAGGGG - Exonic
905619914 1:39435795-39435817 TGTCTACTGTTCTAAACAAGAGG + Intronic
906554031 1:46692997-46693019 TGTCCTTTGCTCCTAACAAGTGG - Intronic
908651924 1:66343207-66343229 AGTCCACTGTTTTAATCAAGAGG - Intronic
908677131 1:66617854-66617876 TGTTTTTTGTTTTTAATAAGAGG + Intronic
909412061 1:75365811-75365833 TTTCCTCTGTTGTTACCAGGGGG + Intronic
909710684 1:78646161-78646183 TGTCTTCTGTTTTGATAAAGTGG + Intergenic
909960368 1:81832870-81832892 TGTTCTCTGATGTTAAGAAGGGG + Intronic
910104832 1:83620571-83620593 TGTCCTATGATTTTAACAAAAGG - Intergenic
916489853 1:165292235-165292257 TTTTTTCTTTTTTTAACAAGTGG + Intronic
916507420 1:165440701-165440723 TGTCTTCTACTTTTAAAAAGAGG + Intronic
916716463 1:167450993-167451015 TGTCTCCTGTTTTTCACAGGTGG + Intronic
919067467 1:192711557-192711579 TGACTTATCTTTTTAACAAGTGG - Intergenic
920323546 1:205143374-205143396 TGACCTCAGGTTTTAAAAAGTGG + Exonic
922624892 1:227029561-227029583 AGTTCTCTGTTTTTAAAAATGGG - Intronic
922950720 1:229556952-229556974 TCTCCAATGTTTTTAAAAAGAGG + Intronic
923518476 1:234717663-234717685 TGTCCTCTCTTTGCAACACGAGG + Intergenic
1065116820 10:22491303-22491325 TTTCATCTTTTTCTAACAAGAGG + Intergenic
1065208618 10:23381232-23381254 TGTCCTGCTTTTTGAACAAGGGG + Intergenic
1065224410 10:23528290-23528312 TGTCCTCTGTTTTGGAAAACTGG + Intergenic
1066055377 10:31675931-31675953 TGACCTCTGTTTATACCATGAGG - Intergenic
1066435363 10:35392639-35392661 TCTCCTCTGCTTTCAACCAGTGG - Intronic
1067964407 10:50893190-50893212 TTTCTTCTGTTTTGAAGAAGAGG + Intergenic
1068784292 10:60953524-60953546 TCACCTCTGTTATTAAAAAGAGG - Intronic
1070864951 10:79702782-79702804 TGTTCTGTGTTGTGAACAAGGGG - Intergenic
1070878739 10:79840913-79840935 TGTTCTGTGTTGTGAACAAGGGG - Intergenic
1071631846 10:87225003-87225025 TGTTCTGTGTTGTGAACAAGGGG - Intergenic
1071645300 10:87357223-87357245 TGTTCTGTGTTGTGAACAAGGGG - Intergenic
1073165054 10:101439972-101439994 TATCCAGTGTCTTTAACAAGTGG + Intronic
1078035858 11:7804618-7804640 TTTCATCTGTTTTTAACATTGGG - Intergenic
1080181019 11:29426358-29426380 TGTTCTCTGTTTTTAAAATATGG - Intergenic
1081200804 11:40213051-40213073 TGTCCTGTCCTTTTAACAAAAGG + Intronic
1081442099 11:43092044-43092066 ATTCTTCTGTTTTTAACAATGGG + Intergenic
1081827345 11:46069256-46069278 TGTCCTCTGATGTACACAAGTGG + Intronic
1083495651 11:63050322-63050344 TGTACTCTTTTTTTAAGAAAAGG - Intergenic
1085266031 11:75238648-75238670 TGTCGTCTGTTTTGCACAAATGG - Intergenic
1086777037 11:90849733-90849755 TGTCCTCTGTTTTGAAGGAAGGG + Intergenic
1087194719 11:95293735-95293757 TGTTCTTTGTTTTTAACATAAGG + Intergenic
1087327307 11:96739466-96739488 TGTCCCTTGTTTTTAACATTTGG + Intergenic
1088896301 11:114081131-114081153 TGTTCTCTGCTTCTACCAAGGGG + Intronic
1089738959 11:120568853-120568875 TGTCTTCTTTTTTTAACAGAAGG - Intronic
1090432893 11:126661581-126661603 TGTCCTCTGCTTTTGATTAGAGG - Intronic
1091549762 12:1529049-1529071 TGTCCTCTGGATTTTACAACAGG - Intergenic
1093594884 12:20948247-20948269 TGACCTCTGTTGTTGACATGTGG + Intergenic
1093631064 12:21409938-21409960 TGTGCTCTATTTTTAAAATGTGG + Intronic
1094746765 12:33353686-33353708 TGTCCTTTGTCTATAAGAAGAGG + Intergenic
1095653420 12:44641070-44641092 TTTTCTCTCTTTTTAACTAGCGG - Intronic
1097544384 12:60980589-60980611 TGTCCTTTGCTTTTGACCAGAGG - Intergenic
1098252093 12:68580688-68580710 TGTCATCTGTTTGTAAAAAATGG - Intergenic
1099258891 12:80350998-80351020 TTTCCTCTGTTTTTGTCTAGTGG + Intronic
1100108996 12:91214192-91214214 TTTCTCCTGTTATTAACAAGGGG + Intergenic
1100519400 12:95358762-95358784 TGTCCTCTGAGTAGAACAAGAGG - Intergenic
1100872684 12:98927253-98927275 TCTCCTTTGTTTTTAACTGGTGG - Intronic
1101174551 12:102135724-102135746 TGTCTTCTGTTTTGAAGAAACGG + Intronic
1101196484 12:102388313-102388335 TGATCTCTATTTTTAAAAAGAGG + Intergenic
1101491420 12:105213256-105213278 TGTCATCAGCTTTTAACATGGGG + Intronic
1102225453 12:111225120-111225142 GGTCCTCTGTTTTTAAATGGTGG + Intronic
1105061669 12:133157957-133157979 TGTGCTCTGTTTATCACATGAGG - Exonic
1105565368 13:21541043-21541065 TCTTATCTGTTTTTAAAAAGCGG + Intronic
1106964075 13:35038406-35038428 ACTCTTCTGTTTTTATCAAGCGG + Intronic
1107145003 13:37052015-37052037 TGTCCTCTCTTATTAATAAGAGG - Intronic
1107726736 13:43306727-43306749 TGTCCTTCCTTTTTAACAAGTGG + Intronic
1107736899 13:43408240-43408262 TATCCTCTGATTTTATCAAAAGG - Intronic
1107801832 13:44115718-44115740 AGTTCTCTGTTTTGAATAAGAGG + Intergenic
1108153622 13:47562890-47562912 TGACTTCTCTTTGTAACAAGAGG + Intergenic
1109605049 13:64683102-64683124 TGTGCTCTGTTTTTTTCATGTGG + Intergenic
1110328604 13:74245798-74245820 TGTCCCCTCTTATTTACAAGAGG - Intergenic
1110551025 13:76811670-76811692 TGGCCTCTATTTTTAACATAAGG - Intergenic
1112579558 13:100666587-100666609 TGTCTTCTGCTTTACACAAGTGG + Intronic
1113357624 13:109597748-109597770 TGTCTTCTGCTTTTAACATGAGG + Intergenic
1114072673 14:19127053-19127075 TTCCTTCTGTTTTTATCAAGTGG + Intergenic
1114089584 14:19272919-19272941 TTCCTTCTGTTTTTATCAAGTGG - Intergenic
1114819778 14:26004777-26004799 TGGCCACTGGTTTTAACAAATGG - Intergenic
1115531526 14:34332555-34332577 TGTTTTGTTTTTTTAACAAGAGG + Intronic
1116073226 14:40075326-40075348 TGTCCTTTGTTTAGAACAAGAGG + Intergenic
1117042923 14:51784002-51784024 TGTCCTCTGTATTTAGACAGAGG + Intergenic
1117242721 14:53851105-53851127 TATCCTCTATCTTTAATAAGAGG - Intergenic
1119437532 14:74607359-74607381 TATCTTCTCTTTATAACAAGTGG + Intronic
1120146385 14:80982996-80983018 TGTGCTCTTTTATGAACAAGAGG - Intronic
1120434262 14:84460429-84460451 TGTCATCTGTTTTTAATCATTGG - Intergenic
1121429150 14:93874632-93874654 TGTCCCCTCTTCTTAAAAAGGGG + Intergenic
1121868315 14:97383657-97383679 TGCTCTGTGTTTTTAACAAGCGG + Intergenic
1125406507 15:39357701-39357723 TGTCCCCTGTTCTAAGCAAGTGG - Intergenic
1126378879 15:48025448-48025470 TGTCCCCTGTTTTTTAGATGAGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1130285182 15:82548846-82548868 TGACCTCTGTGATTAACATGTGG - Intronic
1132771163 16:1564333-1564355 TGTTCTCAGATTTTAACAACTGG + Intronic
1133327817 16:4952874-4952896 TGTCCCCTCCTTTTAACATGGGG - Intronic
1133369414 16:5236685-5236707 TTTCCCCTGTTATTAACATGTGG - Intergenic
1134191594 16:12125529-12125551 CGTCCTCTGTTTCTCACAGGTGG + Intronic
1136844909 16:33568593-33568615 TGTCCACTGTTCTTCACAGGTGG - Intergenic
1137059596 16:35777672-35777694 CAGCCTCTGTTTTTAACAATAGG + Intergenic
1137384652 16:48030258-48030280 TGACCTCTGTGTTTTGCAAGGGG - Intergenic
1139090417 16:63639633-63639655 TGTCCTCTCTTTTGAAAAACTGG - Intergenic
1139253698 16:65520818-65520840 TTTCCTCTGTGCTTAACAATAGG + Intergenic
1139657859 16:68399822-68399844 TGTACTGTGTTTATAGCAAGGGG - Intronic
1140606215 16:76542169-76542191 TCTCTTTTGTTTTTAACAAAGGG - Intronic
1141142569 16:81506368-81506390 TGACCTCTGTTCTTAAGAGGTGG + Intronic
1141398531 16:83726237-83726259 TGACCTCTGTTTTTTAGATGGGG + Intronic
1203155077 16_KI270728v1_random:1868891-1868913 TGTCCACTGTTCTTCACAGGTGG - Intergenic
1142741893 17:1936416-1936438 TTTCTTCTTTTTTTAACAAGTGG - Exonic
1144044150 17:11439882-11439904 TGTCCTCTCTTCTTAATAAAGGG - Intronic
1146547758 17:33753936-33753958 TTTCCCCTGTTATTAACAACAGG - Intronic
1147158442 17:38557310-38557332 TCACCTCTCTTTTCAACAAGGGG - Intronic
1147343330 17:39768941-39768963 TAATCTCTGTTTTTAACAAAGGG - Intronic
1149043370 17:52216877-52216899 TGTGCCATGTTTTTAAAAAGTGG - Intergenic
1152246437 17:79187109-79187131 TGGCCTGTGTTTTTAACAAAAGG + Intronic
1153883483 18:9440907-9440929 TGACCACTATTTTTAAAAAGTGG + Intergenic
1155426228 18:25710426-25710448 GTTCCTTTGTTTTTAACATGGGG + Intergenic
1156033257 18:32737852-32737874 TTTCCTCTATCTTTAACAAAGGG + Intronic
1156640577 18:39092030-39092052 TTTACTTTGTTTTAAACAAGAGG + Intergenic
1156934613 18:42688567-42688589 TATGCTCTGTTTTTAAACAGTGG - Intergenic
1158796936 18:60857521-60857543 TTTCCTTTGTTATTAATAAGTGG + Intergenic
1164687886 19:30180973-30180995 TGTTTTCTGTTTTTAACAGATGG - Intergenic
1165225993 19:34355672-34355694 TGTCCTCTGATTCTAGCAAGGGG + Intergenic
1167095740 19:47374119-47374141 TATCCTCTCTTTTTATCGAGGGG - Intronic
925215068 2:2087249-2087271 TGTCTTCTTTTTTTAAAAAAAGG + Intronic
927915262 2:26931621-26931643 TGTCCTTTGTTTCTAACAGCTGG + Exonic
932134896 2:69219738-69219760 TGTCCTCTGTTTTTAACAAGTGG + Intronic
932330846 2:70897548-70897570 TGTCCTCTGTCTCTAGGAAGGGG + Intergenic
933450401 2:82442180-82442202 TGTCCTCAGTAATTAAGAAGAGG - Intergenic
937566847 2:123303436-123303458 TCTCATTTGTTTTTAACAACAGG - Intergenic
937672289 2:124550975-124550997 TGTCCTCTGCTTTGAAGAACTGG + Intronic
938112418 2:128577894-128577916 ATTCCTTTGTTTTTAATAAGTGG - Intergenic
939684242 2:145177961-145177983 TGTTCTCAGATTTTAACAAATGG - Intergenic
941657428 2:168159112-168159134 TGTGCACTGTTTTTAAGAAAGGG - Intronic
943389957 2:187252926-187252948 TTTCCTCTGATTTTAATAATGGG - Intergenic
944000148 2:194824676-194824698 TTTTGTCTATTTTTAACAAGAGG + Intergenic
945028818 2:205644450-205644472 TGTGCTCTGAGTTTAACAAAAGG - Intergenic
945931680 2:215861573-215861595 TATCTTCTGTTTTATACAAGAGG - Intergenic
945955306 2:216081407-216081429 TCTCTTCAGTTTTTAACGAGTGG + Intronic
946615955 2:221510209-221510231 TTTCTTCTGTTATTAACATGGGG + Intronic
946955273 2:224922819-224922841 TGTCCTCCTTTTTGAACAGGGGG - Intronic
948510491 2:238461013-238461035 TGTCATCTGTTAGTAACAATAGG - Intergenic
949016093 2:241711896-241711918 TGTGTTTTGTTTTTAAAAAGGGG - Intronic
1168917230 20:1500147-1500169 TTCCCTCTGTTTTTCTCAAGTGG + Intergenic
1170022858 20:11854896-11854918 TTTCCTCTGCTTTTAACATGGGG + Intergenic
1171216053 20:23353116-23353138 GGTCCACTGTCTTTACCAAGGGG + Intronic
1172790038 20:37496867-37496889 TGTTCTCTTTTTTAAAAAAGGGG + Intronic
1175753855 20:61516923-61516945 AGTCCTGTGTTTGTAACATGGGG + Intronic
1176018771 20:62952359-62952381 TGTCCTCTGTCTATAAAATGGGG - Intergenic
1176853471 21:13941343-13941365 TGTCTTCTGTCTTTACCACGTGG + Intergenic
1179382570 21:40912848-40912870 TGTTCTGTGTTTTTATCATGAGG - Intergenic
1180491119 22:15849428-15849450 TTCCTTCTGTTTTTATCAAGTGG + Intergenic
1182105423 22:27685702-27685724 TGGCCTCTCTTTTTGACATGGGG - Intergenic
1183355184 22:37355018-37355040 TGTCATCTGTTCTCAACCAGGGG - Intergenic
949293712 3:2495825-2495847 TTTCCTATGTTTTCAACCAGTGG - Intronic
951075285 3:18383460-18383482 GGGCCTCTGCTTTTAACATGTGG + Intronic
951607185 3:24448879-24448901 TGTCATTTATTTTTAACTAGTGG - Intronic
954332886 3:49900265-49900287 TCTCCCCTGCTTTTAGCAAGGGG + Intronic
956325503 3:68048127-68048149 AGTACTCTGTTTCTGACAAGTGG + Intronic
958721732 3:97851955-97851977 TTTTCTCTGACTTTAACAAGTGG + Intronic
960124530 3:113984042-113984064 TGTCCTCTATATTCAGCAAGAGG - Intronic
960765687 3:121127550-121127572 TCTCCTCTTTTTATAACAACAGG + Intronic
961234701 3:125356143-125356165 AGTCCTCTGTTTTTAAAGAAAGG + Intronic
962371506 3:134824479-134824501 TGGCCTCTGCTTTTGACAACAGG - Intronic
962678671 3:137776318-137776340 TGTACTCTGTTTGCAATAAGAGG + Intergenic
962826447 3:139104272-139104294 TGTCCCCTGTTTTACAGAAGAGG + Intronic
963895231 3:150678710-150678732 TGTTCTCATTTTTTGACAAGGGG - Intronic
964473565 3:157078691-157078713 TGCCCTGTGTTTTTGTCAAGTGG + Intergenic
965080579 3:164025818-164025840 CCTCCTCTGCTTTTATCAAGAGG - Intergenic
965165778 3:165193668-165193690 TTGTCTCTGTTTTTAAAAAGTGG - Intronic
965481376 3:169223497-169223519 AGTCCTATATTTTTAACAGGAGG + Intronic
966756052 3:183372345-183372367 TGTCCTCTTTTTATGATAAGTGG - Intronic
967259651 3:187629497-187629519 TGTCTTCAGTTTTGAGCAAGGGG - Intergenic
970318862 4:14856043-14856065 TTTCATCTCTATTTAACAAGGGG - Intergenic
970762263 4:19504847-19504869 TGCCCTCTATATTTAAAAAGTGG - Intergenic
974940801 4:68465419-68465441 TGTCCTCTAGCTTTAATAAGTGG + Intronic
974982742 4:68980256-68980278 TTCCCTCTGATTTTAACAATCGG - Intergenic
975017810 4:69445753-69445775 TTCCCTCTGATTTTAACAATCGG + Intergenic
975049605 4:69843739-69843761 TGTCAACATTTTTTAACAAGTGG - Intronic
975931978 4:79535464-79535486 TGTCCTCATTTTTTAAAATGAGG + Intergenic
977300986 4:95267423-95267445 TATTTTCTGTTTCTAACAAGAGG + Intronic
977365510 4:96063219-96063241 GGTTCACTGTTTTTAACAATAGG + Intergenic
979159051 4:117435509-117435531 GTTTCTCTGTTTTGAACAAGGGG + Intergenic
979284773 4:118909960-118909982 GGTCATCTGTTTTCAACAAATGG - Intronic
980089272 4:128425191-128425213 AGTCCCCTAATTTTAACAAGTGG - Intergenic
983097752 4:163584559-163584581 TGTGGTCTTTTTTTAACAATGGG - Intronic
983296762 4:165876037-165876059 TCTTCTCTGTTTTTGAGAAGAGG + Intronic
983764918 4:171467230-171467252 TGTTCTCTGTTTTTAACAAACGG + Intergenic
983931832 4:173460975-173460997 TGTCCTCTGCTTTTAGAAAGGGG + Intergenic
984446327 4:179841464-179841486 CATTCTCTGTTTTGAACAAGAGG - Intergenic
990470645 5:56112067-56112089 GATCATCTGTTTTCAACAAGAGG + Intronic
990814844 5:59772347-59772369 AGGCCTCAGGTTTTAACAAGTGG + Intronic
991187017 5:63820926-63820948 AGTCCTCTGTATTTACCAAGAGG + Intergenic
991188604 5:63841123-63841145 TATACTATGTTTTTAACAAATGG + Intergenic
992406562 5:76463254-76463276 TGCCTCCTGTTTTTAACAAGTGG + Intronic
993041615 5:82821300-82821322 TGCCTTCTGTGTTTTACAAGTGG - Intergenic
993261679 5:85665292-85665314 TGTCCTTTGTTTCTATCATGGGG + Intergenic
994840527 5:104919784-104919806 TGTGTTTTATTTTTAACAAGAGG + Intergenic
996683880 5:126258469-126258491 TTTCATCTGTTTTTAAAAATAGG - Intergenic
998154591 5:139777351-139777373 TGGCATCTGTTTGCAACAAGAGG - Intergenic
998769805 5:145530055-145530077 TTTCCTCTGATTTTCAGAAGAGG + Intronic
998882928 5:146662460-146662482 AGGCATCAGTTTTTAACAAGAGG - Intronic
999301882 5:150496367-150496389 TCTCCTTTGGTTCTAACAAGAGG + Intronic
1000384823 5:160665051-160665073 TCCCCTCTTTTTTTAACAATGGG + Intronic
1001020533 5:168178771-168178793 TGTTCTCGGTTTTTCACAGGGGG - Intronic
1003754627 6:9102972-9102994 TGTACTCAATTTTTAATAAGTGG + Intergenic
1004419033 6:15451248-15451270 TGTACTCTGTAGTTAACAAATGG + Intronic
1006758506 6:36438881-36438903 GGTTCTCTGTTTTTAAAGAGAGG + Exonic
1007605376 6:43114080-43114102 TGTCCTGTGTTTCTAGCAGGGGG - Intronic
1009402273 6:63271046-63271068 TGTCCCCTGTATTTAACAAGTGG + Intergenic
1009807126 6:68614259-68614281 GGTCAGCTGTTTTTTACAAGTGG - Intergenic
1010337786 6:74707972-74707994 TATGCTCTATTTTTAAAAAGCGG - Intergenic
1010410102 6:75551762-75551784 TGTCTCCTGTTTTTGACAAGTGG - Intergenic
1011749356 6:90439676-90439698 TGTCTTTTCTCTTTAACAAGAGG - Intergenic
1012988725 6:105902915-105902937 CCTTCTCTGTATTTAACAAGAGG - Intergenic
1013489523 6:110632308-110632330 TTTCCTCCCTTTTTAACCAGAGG + Intronic
1014200659 6:118605649-118605671 CTTCCTCTGTTTTTCCCAAGGGG + Intronic
1019973132 7:4558195-4558217 ATTACTCTGTTTTTAAGAAGGGG - Intergenic
1021321228 7:19214785-19214807 TGTCTTCTTTTTTCAAAAAGAGG + Intergenic
1021816897 7:24455883-24455905 TGTGTTCTGTTTTTAAAAACTGG + Intergenic
1021841059 7:24722265-24722287 TGTCTTCTGTCTTTCACACGTGG - Intronic
1022770716 7:33469720-33469742 TCTCCTCTTTTTTTAACAGCTGG - Intronic
1024049937 7:45612462-45612484 TGTCCTTATTTTGTAACAAGAGG - Intronic
1024492497 7:50001569-50001591 TGTTTTTTGTTTTTATCAAGTGG - Intronic
1024696157 7:51858685-51858707 TGTCCTCTGCTGATAACAGGTGG - Intergenic
1027557076 7:79678335-79678357 TGTCATCTGTCTTTTCCAAGTGG + Intergenic
1030210958 7:106995373-106995395 TGTCCATTGTTTTTCACAGGAGG - Intergenic
1031707608 7:125000706-125000728 TGGCATCTGTTTTTAAGAAAAGG + Intergenic
1031782732 7:125990142-125990164 TGTCCTCTCTTTCTATCAGGAGG + Intergenic
1032520925 7:132544448-132544470 GGACCTCTGTTACTAACAAGTGG - Intronic
1033228174 7:139576908-139576930 TCTCTTCTGCTTTTATCAAGGGG - Intronic
1034481856 7:151327820-151327842 TGTCTTCTGATGTTAACAAGTGG + Intergenic
1034595498 7:152186804-152186826 TATCATCTGTTTTTTTCAAGAGG + Intronic
1036237636 8:7054640-7054662 TGTCCTTTAATTTTAAAAAGTGG - Intergenic
1037900591 8:22686098-22686120 TGTCCTTCCTTTTTAACAAAGGG - Intergenic
1038998733 8:32955660-32955682 TGTCCTTCATTTTTAACCAGAGG - Intergenic
1039763100 8:40599555-40599577 GTTCCTCTATTTTTACCAAGGGG - Intronic
1040747108 8:50658232-50658254 TATTCTCTGTATTTAACTAGTGG + Intronic
1041332233 8:56739550-56739572 TGTCCTTTGCTATTTACAAGGGG - Intergenic
1041617017 8:59919112-59919134 TGTCTGCTGTTTTTTACAACAGG + Intergenic
1042268703 8:66934896-66934918 TGTCCTGTGTGGTTATCAAGGGG - Intergenic
1042657129 8:71112111-71112133 TGTGCTCTGTTTTTCACAGTAGG + Intergenic
1044264976 8:90171209-90171231 TGTTTTCTGCTTTGAACAAGTGG + Intergenic
1045822899 8:106362052-106362074 TGACCTCTGTGTTTAGCAGGTGG - Intronic
1046964476 8:120148676-120148698 TGTGCTCAGTTTTTAAGAAAAGG - Intronic
1047843839 8:128784724-128784746 TCACCTCTTTTTTTAACCAGTGG + Intergenic
1051576391 9:18620893-18620915 TGTACTCTATTTTTAAAATGTGG - Intronic
1052390431 9:27872638-27872660 TGTCCTCTTTCTCTAACAAGAGG - Intergenic
1053313011 9:37031303-37031325 TGTTCTCTGTATTAAACAAACGG - Intronic
1055081100 9:72268360-72268382 TGTCCAATGTTTTTAAAAATTGG + Intergenic
1055841431 9:80509601-80509623 AGTTCTCTGTTTTTACCAATAGG - Intergenic
1056065934 9:82934671-82934693 AGTCATCTTTTTTTAGCAAGGGG + Intergenic
1056201643 9:84282695-84282717 TGTACTCTGTTGTTCACCAGAGG + Intronic
1056991531 9:91416189-91416211 TGTAATCTGTTTTCAACATGAGG + Intronic
1057355818 9:94330608-94330630 TGTTCTGTGTTGTGAACAAGGGG + Intergenic
1057651940 9:96927021-96927043 TGTTCTGTGTTGTGAACAAGGGG - Intronic
1057772355 9:97980052-97980074 CCTCCTCTGTTTTTACCATGTGG + Intergenic
1059413258 9:114147353-114147375 TGTCCTCATTTTGTGACAAGGGG + Intergenic
1185792019 X:2934392-2934414 TTTCCTTTGTTTTTCACAGGGGG + Intergenic
1186782753 X:12929822-12929844 TGACTTCTGTTCTTAAGAAGAGG - Intergenic
1186822557 X:13305438-13305460 TCTCCTCTGCTTTGAGCAAGAGG - Intergenic
1186972229 X:14860051-14860073 TGTCCTCTATTTTAAACTTGAGG - Intronic
1187168283 X:16825669-16825691 TGTGCTGTGTTTTTAAAAAGTGG + Intronic
1187612931 X:20961698-20961720 GTTCCTCTGTTTATAAAAAGGGG + Intergenic
1189730802 X:44018482-44018504 TTTCCTGTTTTTTGAACAAGAGG - Intergenic
1193815205 X:86096746-86096768 TGTGCTCTTTTTTTCACAAAAGG - Intergenic
1194082320 X:89484281-89484303 TTTCATCTGTTTTAACCAAGAGG + Intergenic
1194323687 X:92482474-92482496 TTTCCTCTGTTTCTTAAAAGTGG - Intronic
1194749807 X:97671569-97671591 TGTCATCTCCTTTTCACAAGTGG + Intergenic
1196624155 X:117858984-117859006 TTTCCTCTGTATTTAAAAAGTGG - Intergenic
1199161016 X:144611837-144611859 TGTCCTCTGTTGCCAACAGGAGG - Intergenic
1199451403 X:147981989-147982011 TGTCCTCAATTTTTAAAAAGGGG - Intronic
1200434988 Y:3140467-3140489 TTTCATCTGTTTTAACCAAGAGG + Intergenic
1200631789 Y:5595635-5595657 TCTCCTCTGTTTCTTAAAAGTGG - Intronic