ID: 932135865

View in Genome Browser
Species Human (GRCh38)
Location 2:69228098-69228120
Sequence ACAAGCTGGGTCCACTATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932135865_932135870 16 Left 932135865 2:69228098-69228120 CCACTATAGTGGACCCAGCTTGT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 932135870 2:69228137-69228159 TTGTCCCTTAGAAAGCACAGAGG 0: 1
1: 0
2: 1
3: 27
4: 208
932135865_932135875 27 Left 932135865 2:69228098-69228120 CCACTATAGTGGACCCAGCTTGT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 932135875 2:69228148-69228170 AAAGCACAGAGGATTATAAGGGG 0: 1
1: 0
2: 0
3: 36
4: 300
932135865_932135874 26 Left 932135865 2:69228098-69228120 CCACTATAGTGGACCCAGCTTGT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 932135874 2:69228147-69228169 GAAAGCACAGAGGATTATAAGGG 0: 1
1: 0
2: 3
3: 63
4: 599
932135865_932135869 -8 Left 932135865 2:69228098-69228120 CCACTATAGTGGACCCAGCTTGT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 932135869 2:69228113-69228135 CAGCTTGTGGATCTGATTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 118
932135865_932135873 25 Left 932135865 2:69228098-69228120 CCACTATAGTGGACCCAGCTTGT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 932135873 2:69228146-69228168 AGAAAGCACAGAGGATTATAAGG 0: 1
1: 0
2: 3
3: 33
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932135865 Original CRISPR ACAAGCTGGGTCCACTATAG TGG (reversed) Intronic