ID: 932135950

View in Genome Browser
Species Human (GRCh38)
Location 2:69228810-69228832
Sequence TAGCAGACACCTACCCATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932135950 Original CRISPR TAGCAGACACCTACCCATTT AGG Intronic
902197200 1:14806452-14806474 CTGCAGACACCTTCTCATTTGGG + Intronic
906982016 1:50641818-50641840 TACCAGGCACATACACATTTAGG + Intronic
909525396 1:76616471-76616493 GAGCAGATAGCTCCCCATTTAGG + Intronic
911591283 1:99751043-99751065 TAGATGATACCTACCCACTTTGG - Intronic
911821047 1:102422514-102422536 TAGCAGATACATACCTATTCAGG - Intergenic
914448753 1:147772472-147772494 TAGCAGACACATCCCCATGCTGG - Intronic
916336854 1:163681920-163681942 TCACAGACAGCTACCCATTTTGG + Intergenic
923001601 1:230010600-230010622 TAGCAGACAATTACACATTATGG - Intergenic
1063909400 10:10814133-10814155 TAGCAGGCACTTATCCCTTTGGG + Intergenic
1067859037 10:49825518-49825540 TAGCACACAACAACCTATTTAGG - Intronic
1078738737 11:14046456-14046478 TGGGGGACAACTACCCATTTGGG - Intronic
1079919253 11:26411368-26411390 TAGCAAACACTTTCCCATGTTGG - Intronic
1080753276 11:35170377-35170399 TAGCAGACCTCTTCCCATGTGGG + Intronic
1080867120 11:36205148-36205170 TAACAGAAACCTACGAATTTAGG + Intronic
1088134610 11:106539459-106539481 TAGCAGTCATCTACCCCTCTAGG + Intergenic
1088880944 11:113972818-113972840 TAGCAGTAACAAACCCATTTGGG - Intergenic
1090953752 11:131496733-131496755 TGGCAGCCACACACCCATTTGGG - Intronic
1093473731 12:19532561-19532583 TATCAGAGACCAACCAATTTGGG - Intronic
1097156382 12:57015263-57015285 TAGCACACAAATAACCATTTGGG + Intronic
1102425198 12:112838533-112838555 CTGCAGACACCTGCCCATGTTGG + Intronic
1102575089 12:113851090-113851112 TAGCAGACAGCTACCCTGTGAGG - Intronic
1108256049 13:48612006-48612028 CAGCTGACACCTACCCATGGAGG - Intergenic
1112635871 13:101217809-101217831 TTGCAGGTACCTACCTATTTGGG + Intronic
1115480896 14:33860071-33860093 TAGCAGACACATGCAGATTTAGG - Intergenic
1116238031 14:42306569-42306591 AAGCATACACCTAACTATTTTGG - Intergenic
1120084327 14:80252378-80252400 TTCCAGACACCTCACCATTTTGG - Intronic
1121462302 14:94090552-94090574 TAGCAGATACCTACGAGTTTGGG + Intronic
1126713079 15:51483361-51483383 TAGCATTCAGCTACCCATGTAGG - Intronic
1135137530 16:19895981-19896003 TTCCAGACCCCTACCCATTCAGG + Intergenic
1137390949 16:48081190-48081212 TAGCAGACACCTACCCCACAGGG + Intergenic
1144642644 17:16946081-16946103 AAGCACACACCTCCGCATTTGGG + Intronic
1145854747 17:28143855-28143877 TAACAGACAGCTAACCATTGTGG - Intronic
1146670578 17:34734648-34734670 TAGTAGACAGCAACCCCTTTAGG - Intergenic
1159237564 18:65696964-65696986 TATCACTCACCTACCTATTTTGG - Intergenic
1159891950 18:73961352-73961374 TAGAAGCCACCCACCCTTTTAGG - Intergenic
927960800 2:27239625-27239647 TTGCTGACATCTACCCCTTTAGG + Intronic
930031170 2:47058893-47058915 AAGCAGACACACACCCCTTTGGG - Intronic
932135950 2:69228810-69228832 TAGCAGACACCTACCCATTTAGG + Intronic
939747319 2:145991864-145991886 TAGCTCATACCTACACATTTGGG - Intergenic
941357387 2:164511030-164511052 CAGCTGACACCTACCCATGGAGG + Intronic
943995224 2:194754811-194754833 TAGAATACACATACCTATTTGGG + Intergenic
946510473 2:220350188-220350210 GAGCAGACACCTACCAATGTGGG - Intergenic
1181912961 22:26255115-26255137 TAACAAATACCTACACATTTTGG - Intronic
1182936197 22:34223916-34223938 TAGCAGACACCGAATCACTTGGG - Intergenic
949391301 3:3565566-3565588 TAGGAGACATGTACACATTTAGG - Intergenic
949642204 3:6049326-6049348 TAGCAGGCAACTGCCCATGTGGG - Intergenic
950312050 3:11967301-11967323 TAGATGACACCCACCCATATTGG - Intergenic
950525651 3:13521246-13521268 CAGCATACACCTGCCCATTGTGG + Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
963063746 3:141246047-141246069 GAGAAGACACCTAGCCTTTTGGG + Intronic
970686161 4:18570072-18570094 AAGCTGACACTAACCCATTTGGG - Intergenic
970847641 4:20561130-20561152 TACCAGACCCCTCCCCTTTTGGG - Intronic
971543670 4:27856337-27856359 TAGCAGACAGATACCAATATTGG + Intergenic
971672039 4:29574029-29574051 TAGAAGATACCTTCTCATTTAGG + Intergenic
972300030 4:37776477-37776499 TAGATGACACCTACCCACTTTGG - Intergenic
974399221 4:61379771-61379793 TAGAAGACACTTTCACATTTTGG - Intronic
976578174 4:86700929-86700951 AAGCAGACAACTATCCAGTTTGG - Intronic
981402904 4:144335179-144335201 TAGGAGACACCTCCCCATTTTGG + Intergenic
991656921 5:68913548-68913570 TACCAGTCACCCACCCATATGGG - Intergenic
992484115 5:77179590-77179612 TAGCAGCTACCTACCCAGATTGG + Intergenic
995661843 5:114493249-114493271 TACCAGACACATAACCAGTTTGG + Intronic
997632001 5:135375896-135375918 TAGCAGTCACCTTCCGATTGGGG - Intronic
1003351485 6:5321616-5321638 TAGAAGACACCTACCGAATGGGG - Intronic
1003903065 6:10673161-10673183 TAGCAGACAACTGCCCATAACGG - Intronic
1008203689 6:48626107-48626129 TAGCCGACAGCTTCCCACTTGGG + Intergenic
1009669914 6:66734567-66734589 TAGGAGACAAATACACATTTAGG - Intergenic
1011363475 6:86553122-86553144 TTTCAGAAACCTAACCATTTTGG - Intergenic
1017344880 6:153369402-153369424 TTCCAGAAACCTACCCATTCTGG + Intergenic
1022220140 7:28306423-28306445 TGGCAGACATCAACCCAATTAGG - Intronic
1025707630 7:63882124-63882146 TAGCAGACACTTACAGATTAGGG + Intergenic
1027509194 7:79057895-79057917 TTACAGTCACCTGCCCATTTTGG - Intronic
1028373876 7:90124154-90124176 AAGAAGAAACCTAACCATTTTGG - Intergenic
1044764694 8:95559054-95559076 CAGCTAAAACCTACCCATTTGGG + Intergenic
1045106630 8:98898977-98898999 TAGCACACTCCAACCCATTCTGG - Intronic
1052391237 9:27880996-27881018 TGGGTGACACCTACCCATGTTGG + Intergenic
1053235218 9:36447521-36447543 TATCAGATGCCTACACATTTAGG - Intronic
1056110335 9:83388664-83388686 CTGGAGACACCTACCCTTTTTGG - Intronic
1057165363 9:92921251-92921273 GAGCAGACACCAGCCCATTATGG + Intergenic
1188292792 X:28409881-28409903 TAGTAGGCACTTACCCAATTTGG + Intergenic
1190782978 X:53616168-53616190 TGGCACACACCTACCATTTTGGG - Intronic
1194857979 X:98957140-98957162 CAGCAGACACCTGCCCATGTAGG - Intergenic
1197963723 X:132033823-132033845 GACTAGACACCTACACATTTAGG + Intergenic