ID: 932136658

View in Genome Browser
Species Human (GRCh38)
Location 2:69237012-69237034
Sequence CTGTGTAATCAGATGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 465}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932136654_932136658 19 Left 932136654 2:69236970-69236992 CCCTTCCTTTTTTTGTGTATTTT 0: 1
1: 2
2: 26
3: 1005
4: 8830
Right 932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG 0: 1
1: 0
2: 3
3: 38
4: 465
932136656_932136658 14 Left 932136656 2:69236975-69236997 CCTTTTTTTGTGTATTTTTCAAA 0: 1
1: 0
2: 21
3: 266
4: 2569
Right 932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG 0: 1
1: 0
2: 3
3: 38
4: 465
932136652_932136658 26 Left 932136652 2:69236963-69236985 CCCTTCTCCCTTCCTTTTTTTGT 0: 1
1: 4
2: 76
3: 1110
4: 8883
Right 932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG 0: 1
1: 0
2: 3
3: 38
4: 465
932136653_932136658 25 Left 932136653 2:69236964-69236986 CCTTCTCCCTTCCTTTTTTTGTG 0: 1
1: 0
2: 11
3: 175
4: 1628
Right 932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG 0: 1
1: 0
2: 3
3: 38
4: 465
932136655_932136658 18 Left 932136655 2:69236971-69236993 CCTTCCTTTTTTTGTGTATTTTT 0: 1
1: 6
2: 41
3: 1629
4: 19269
Right 932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG 0: 1
1: 0
2: 3
3: 38
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932136658 Original CRISPR CTGTGTAATCAGATGGAAAA AGG Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900695607 1:4007997-4008019 CTGTGTGATCATCTGGCAAAAGG - Intergenic
900818357 1:4867796-4867818 CTCTTCAATCATATGGAAAAAGG - Intergenic
901851013 1:12015594-12015616 CTGTGTAATCAGAGGCATAAGGG - Intergenic
903870771 1:26432806-26432828 CTGGGGAATCAGATGGACTATGG - Intronic
905253923 1:36667872-36667894 CTGTGTAATGACATTTAAAAAGG + Intergenic
906332562 1:44899330-44899352 CTCTTTAATCAGATGGAAAGGGG - Intronic
907360604 1:53911125-53911147 CTGGGTAATCAGATACAAATTGG - Intergenic
907727269 1:57031354-57031376 CAGTATTATCAGATGGAACATGG - Intronic
907955223 1:59221803-59221825 CTGTGTCCTCACATGGCAAAAGG - Intergenic
908076158 1:60521204-60521226 CTGTGTCTTCAGATGGTGAAAGG + Intergenic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
909878833 1:80847465-80847487 CTGTGTACTCACATGGCAGAAGG + Intergenic
910726991 1:90349791-90349813 CTGTGAAAGCAGATGGGAAGGGG + Intergenic
910832144 1:91471671-91471693 CTGAGTCCTCACATGGAAAAAGG - Intergenic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
911747166 1:101452739-101452761 CTGTGTACTAAGAGGCAAAATGG + Intergenic
912843040 1:113055951-113055973 CTTTTTAATCATATGTAAAATGG + Intergenic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
913137970 1:115911123-115911145 CTATATAAACTGATGGAAAAAGG - Intergenic
913658573 1:120985296-120985318 CTGTTTCATCAAATGGAAATGGG - Intergenic
914009937 1:143768416-143768438 CTGTTTCATCAAATGGAAATGGG - Intergenic
914523185 1:148436540-148436562 CTGTTTCATCAAATGGAAATGGG - Intergenic
914648558 1:149677077-149677099 CTGTTTCATCAAATGGAAATGGG - Intergenic
918025490 1:180740886-180740908 CTGTGTCCTCACATGGTAAAAGG + Intronic
919394267 1:197024585-197024607 CTGTGCAATCAAAAGGAAAGTGG - Intergenic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
919743935 1:200996892-200996914 CTGTGTACTGAGATGGGAGAGGG - Intronic
922111523 1:222561718-222561740 CTGTTTAGTGAAATGGAAAATGG - Intronic
922304473 1:224331983-224332005 CTGTGTCATCCCATGGCAAAAGG - Intergenic
922688310 1:227665289-227665311 ATGTGTAATTAGCTGGAAGATGG - Intronic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923726833 1:236513250-236513272 CTGTGTAAACACAGGGTAAATGG - Intergenic
924806765 1:247367505-247367527 CTTTGTAAGCAGAGTGAAAATGG + Intergenic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1063757055 10:9024004-9024026 CTGTGAAACCAGCTAGAAAATGG + Intergenic
1064069124 10:12210513-12210535 CTTTGCAATCAAAGGGAAAAAGG - Intronic
1064235713 10:13572714-13572736 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1064434155 10:15296143-15296165 CTGTGTAATCTGATGAAATTAGG + Intronic
1064630973 10:17310382-17310404 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1064990387 10:21251733-21251755 CTGTGTCCTCATATGGCAAAAGG - Intergenic
1068524774 10:58116080-58116102 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069766460 10:70864253-70864275 CTGTGAAATCATATGAAAAGCGG - Intronic
1070376397 10:75835469-75835491 CTGTGAATTCATATGGAAAAAGG - Intronic
1070583575 10:77743480-77743502 CTGTGTCCTCACATGGTAAAGGG - Intergenic
1072705153 10:97675693-97675715 CTCTGTGATCAGAAGGAAATTGG + Exonic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1073959602 10:108911706-108911728 GTGTGTAAACAGATGAAAGATGG - Intergenic
1075290992 10:121230788-121230810 CTGTGTCATCCCATGGAACAGGG + Intergenic
1075532734 10:123243775-123243797 CTGTGTCATCATCTGTAAAAGGG - Intergenic
1076017483 10:127039856-127039878 CTGTCCCATTAGATGGAAAATGG + Intronic
1076364418 10:129912634-129912656 CTGTGAAATCAGTTGGGAACAGG - Intronic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1078445349 11:11400657-11400679 CTGTGTCCTCACATGGCAAAAGG + Intronic
1078464589 11:11540873-11540895 CTGGGTTGTCAGAAGGAAAATGG + Intronic
1078471944 11:11595321-11595343 CTGTGTCCTCACATGGTAAAAGG - Intronic
1081320485 11:41686394-41686416 CTGTGTTATATGATGGAAAAAGG - Intergenic
1081445576 11:43128785-43128807 CTGTGTCATCACATGGAGGAAGG - Intergenic
1082873209 11:57962552-57962574 CTGTGTGATCAGAAGAAAATTGG - Intergenic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1084464890 11:69316838-69316860 CTGTGTTGTCACCTGGAAAATGG + Intronic
1084600520 11:70142814-70142836 CTGTGTCCTCAGGTGGCAAAGGG + Intronic
1084862097 11:72025747-72025769 CTGTGTAATCACATGGGGTATGG - Intronic
1085564121 11:77497497-77497519 CTGTGAAAGCAGTTGGTAAAAGG - Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086847976 11:91775211-91775233 CTTATTAATCACATGGAAAAGGG - Intergenic
1087366794 11:97230335-97230357 CAAAGTAATGAGATGGAAAATGG + Intergenic
1087494933 11:98879543-98879565 CTGTGTATTCACAAGGCAAAAGG + Intergenic
1087729854 11:101766843-101766865 TTGTGTAAGCAGATGAAAATAGG + Intronic
1087917539 11:103828649-103828671 CTGTGTCATCACATGGTGAAAGG - Intergenic
1088857813 11:113772303-113772325 CTGTTTAATGTGATGGAAAGAGG - Intronic
1089173549 11:116532748-116532770 CTGTGTCTTCAGATGGTGAAAGG - Intergenic
1089825455 11:121271832-121271854 CTGTGTTCTCACATGGTAAAAGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090335510 11:125960533-125960555 CTGGGTTTTCAGGTGGAAAATGG - Exonic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1090886446 11:130881022-130881044 CTGTGTCCTCATATGGCAAAAGG - Intronic
1092986360 12:13849733-13849755 CTTTGAAATCAGATGGGAACAGG - Intronic
1093536782 12:20231788-20231810 CTGTGTCAGCAGTTTGAAAATGG - Intergenic
1093681010 12:22003447-22003469 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1094034644 12:26055225-26055247 CTGTGTAGTCAGCTAAAAAAGGG - Exonic
1094270360 12:28607955-28607977 CAGTCTAACAAGATGGAAAAAGG - Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1095640046 12:44477076-44477098 CTGTCTTATCAGCAGGAAAATGG + Intergenic
1096350188 12:50891771-50891793 CTGTGTCCTCACATGGCAAAAGG + Intergenic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100816727 12:98394019-98394041 GTCTGTAATCAGATGGAATTGGG - Intergenic
1101396168 12:104349930-104349952 CTGTGTAAAGAAATGGGAAAAGG + Exonic
1101801078 12:108022397-108022419 ATGGGTAAGCAGATGGGAAATGG - Intergenic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1104502089 12:129295765-129295787 GTGTATAATCAGATGTACAAAGG - Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1106782723 13:33075887-33075909 CTGTGTACTCACATGGTAGAAGG + Intergenic
1107892602 13:44927399-44927421 CTGTGTACACAGATGGGCAATGG - Intergenic
1108057029 13:46495299-46495321 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1108399942 13:50030624-50030646 GTGTGTAACTACATGGAAAATGG + Intergenic
1108519418 13:51233208-51233230 CGGTGTAGTCAGATGACAAAAGG - Intronic
1108617822 13:52151690-52151712 ATGTGTTCTCAGATGGAAAACGG - Intronic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109874259 13:68378754-68378776 CTGTGTACTCACATGGCAGAAGG + Intergenic
1110466359 13:75806702-75806724 ATATGTAATCAGCAGGAAAAAGG - Intronic
1112195266 13:97219561-97219583 CTGTGTCTTCACATGGTAAAGGG + Intergenic
1112297583 13:98201903-98201925 CTGTTTGATCATTTGGAAAAAGG - Intronic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1113031723 13:106000677-106000699 CCGTGTAATCACATAGCAAAGGG + Intergenic
1113363817 13:109657039-109657061 TTGTTTAATCTGATGGAAGAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114719637 14:24867194-24867216 CTGTGTCCTCATATGGCAAAAGG - Intronic
1114731290 14:24995184-24995206 CTGTGTACTCACATGGTAGAAGG + Intronic
1116360098 14:43983421-43983443 ATGAGTAGTCATATGGAAAAGGG + Intergenic
1116900850 14:50361564-50361586 CTGTGTCCTCACATGGCAAAAGG + Intronic
1117095787 14:52296044-52296066 CTGGGTGACCAGATGGCAAAAGG - Intergenic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1118318496 14:64739734-64739756 CTGTGTCCTCACATGGCAAAGGG + Intronic
1121745725 14:96289488-96289510 CTGTGTGAGGTGATGGAAAAGGG - Intronic
1123404987 15:20014083-20014105 CTGTGTCATCATATGGCAGAAGG - Intergenic
1123514318 15:21020731-21020753 CTGTGTCATCATATGGCAGAAGG - Intergenic
1124987012 15:34629693-34629715 ATGTGTACTAATATGGAAAAGGG + Intergenic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1126264032 15:46731349-46731371 CTGTGTGCTCATATGGCAAAAGG + Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1126991193 15:54377704-54377726 CTGTGTCCTCACATGGCAAAAGG + Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1130036681 15:80367495-80367517 CTGTCTCATCAGCAGGAAAATGG + Intronic
1131975592 15:97942806-97942828 CTGTGTCATCCCATGGCAAAAGG - Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133953153 16:10415581-10415603 CTTGGTAATCAAATGAAAAATGG + Intronic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1134183056 16:12062984-12063006 CTGTGTCCTCATCTGGAAAATGG + Intronic
1134492637 16:14706914-14706936 ATGTGTAATCAGGTGGCAAATGG - Intergenic
1134498018 16:14746036-14746058 ATGTGTAATCAGGTGGCAAATGG - Intronic
1134582550 16:15383044-15383066 ATGTGTAATCAGGTGGCAAATGG + Intergenic
1135313872 16:21427108-21427130 ATGTGTAATCAGGTGGCAAATGG + Intronic
1135366796 16:21859388-21859410 ATGTGTAATCAGGTGGCAAATGG + Intronic
1135445019 16:22511770-22511792 ATGTGTAATCAGGTGGCAAATGG - Intronic
1136079306 16:27841154-27841176 CTGTGTCCTCAGCTGGAAAATGG - Intronic
1136193740 16:28636309-28636331 ATGTGTAATCAGGTGGCAAATGG - Intergenic
1136310538 16:29405811-29405833 ATGTGTAATCAGGTGGCAAATGG + Intergenic
1136323984 16:29507595-29507617 ATGTGTAATCAGGTGGCAAATGG + Intergenic
1136438669 16:30247578-30247600 ATGTGTAATCAGGTGGCAAATGG + Intronic
1136492780 16:30621310-30621332 CTGGGCAAACAGATAGAAAAGGG - Intronic
1137030518 16:35519579-35519601 CTGGGCAAACAGATAGAAAAGGG + Intergenic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1137982070 16:53078416-53078438 CTGTGTCATCAGGTGGCAGAAGG - Intronic
1139858220 16:69998197-69998219 ATGTGTAATCAGGTGGCAAATGG + Intergenic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1140898412 16:79346457-79346479 CTCTGAAATCAGAAGAAAAAGGG + Intergenic
1141263296 16:82473258-82473280 GTGGGTATTCAGATGGTAAAAGG - Intergenic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1141547998 16:84785248-84785270 CTGTGTCTTCTGATGGAAACAGG - Intergenic
1142347211 16:89561485-89561507 CTCAGCAATCAGATGGAAAAGGG - Intronic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1145254529 17:21315378-21315400 CTGTGTCCTCAGATGTAGAAGGG - Intergenic
1145322066 17:21772587-21772609 CTGTGTCCTCAGATGTAGAAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146730359 17:35187992-35188014 CTGGGACATCAGCTGGAAAAGGG + Exonic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148520294 17:48267875-48267897 CTGTATAATCACATGAGAAATGG - Intronic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1148985821 17:51620266-51620288 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1150926715 17:69539998-69540020 CTGTGTCCTCAGATGGGCAAAGG + Intronic
1151000625 17:70371099-70371121 CTGTTTATTCAATTGGAAAATGG - Intergenic
1151376736 17:73694389-73694411 CTGTGTCATCACATAGTAAAAGG - Intergenic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153166810 18:2270958-2270980 CTGTGTTCTCAAATGGCAAAAGG - Intergenic
1153432974 18:5038957-5038979 GTTTGTAATCAGACGTAAAAAGG + Intergenic
1154119667 18:11641469-11641491 CTGTGTAATCAGGTGGCAAATGG + Intergenic
1155071659 18:22322112-22322134 TTGTGGAATCACATGGAAGAAGG + Intergenic
1155821160 18:30379132-30379154 CTGCGTAATGGGATGGAATAGGG + Intergenic
1156423324 18:36980031-36980053 CTGTGTCATCACATGGCAGAAGG - Intronic
1156770165 18:40710888-40710910 CTTTGTTTTCAAATGGAAAAAGG + Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157412295 18:47473289-47473311 CTGTGTTATAACATGGCAAAAGG - Intergenic
1157439817 18:47702152-47702174 CAGTGTGATCATCTGGAAAATGG + Intergenic
1157661401 18:49448207-49448229 CTGTCTCATCAGCAGGAAAATGG + Intronic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158062369 18:53360967-53360989 CTGTGACCTTAGATGGAAAAGGG + Intronic
1158580734 18:58680239-58680261 GTGTGTATTCATATGAAAAAAGG - Intronic
1158592924 18:58792500-58792522 CTGTGTACTCAGCTGTGAAATGG + Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159106346 18:64005518-64005540 CTGTGTACTCACATGGCAGAGGG - Intronic
1159471396 18:68860986-68861008 CTGTGTAATCAGATAGATTTGGG + Intronic
1160053804 18:75461115-75461137 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1161786712 19:6331021-6331043 CTGTTTTATCACCTGGAAAATGG + Intronic
1165875282 19:39002276-39002298 CTGTGTCATAATATGGCAAAAGG + Intronic
1167171327 19:47834249-47834271 CTGTGTCCTCACATGTAAAATGG - Intronic
1167209890 19:48127606-48127628 CTGGCCAATGAGATGGAAAAGGG + Intronic
1167812814 19:51849489-51849511 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
1168576249 19:57513523-57513545 CTGGGCAAACAGATAGAAAAGGG + Intronic
925869478 2:8256597-8256619 ATGTGATATCAGCTGGAAAAAGG - Intergenic
926489492 2:13506439-13506461 CTGTGTCATCACATGGCAGAAGG + Intergenic
926863457 2:17333789-17333811 CTGTGTTATCACATGGCAGAAGG - Intergenic
928334497 2:30384787-30384809 AAGGGAAATCAGATGGAAAAGGG + Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
928968461 2:37001094-37001116 CTGTGTAATGAAAACGAAAAAGG + Intronic
929386640 2:41415495-41415517 ATTTGTATTCAGATGGACAATGG - Intergenic
929615231 2:43301517-43301539 CTGGGTACTGAGATGGAATAGGG - Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
931831453 2:66055920-66055942 CTGTGTTCTCACATGGAAGAAGG - Intergenic
932023154 2:68108472-68108494 GTGTGTAATGAGCTAGAAAATGG - Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932487349 2:72092204-72092226 CTGAGTAATCAGGTTCAAAAGGG + Intergenic
932994244 2:76829565-76829587 CTCTGTAATAACATGTAAAATGG + Intronic
933169826 2:79112913-79112935 CTGTGTTATCTCATGGTAAAAGG + Intergenic
933537412 2:83593467-83593489 CTTTGTAATAAGATTGAAATAGG - Intergenic
935207318 2:100907403-100907425 CCTTGTACTCAGATGGAAAAAGG + Intronic
935463657 2:103368799-103368821 CTGGGTACTCACATGGTAAAAGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
935985207 2:108665966-108665988 GTGTGCAAGCAGAGGGAAAATGG - Intronic
936137642 2:109909610-109909632 GTGTGCAAGCAGAGGGAAAATGG - Intergenic
936207055 2:110461875-110461897 GTGTGCAAGCAGAGGGAAAATGG + Intronic
936579061 2:113680344-113680366 CTGTGTTTTCACATGGTAAAAGG + Intergenic
936579072 2:113680425-113680447 CTGTGTTTTCACATGGTAAAAGG + Intergenic
936954576 2:118011877-118011899 CACTGAAATCAAATGGAAAAGGG + Intronic
938575765 2:132602697-132602719 CTGAATAATCTGATGTAAAATGG + Intronic
938737811 2:134202362-134202384 CTGTGTACTCAAATGGCAGAAGG - Intronic
938775281 2:134536404-134536426 CTATGTACTCAGGAGGAAAAAGG - Intronic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939477423 2:142703662-142703684 ATGTGTAATAACATGGAGAAAGG + Intergenic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
941072760 2:160972785-160972807 CTGTGTGAAGAGATAGAAAATGG - Intergenic
941446088 2:165601697-165601719 TTGTGTATTCAGAGAGAAAAGGG - Intronic
942023451 2:171889957-171889979 CTGTGTAATAATATTGACAATGG - Intronic
942140730 2:172974974-172974996 CTGTGCAATCAGTTTGACAATGG - Intronic
942841395 2:180365957-180365979 CTGTGTCATGAGACAGAAAATGG + Intergenic
943165792 2:184324047-184324069 CAGTTTAATTAGATGAAAAAAGG - Intergenic
943493161 2:188581991-188582013 TTCTGTAATGAAATGGAAAAAGG - Intronic
944779078 2:202999051-202999073 GTGAATAATCAGATGAAAAATGG - Intronic
945195486 2:207233526-207233548 CTGTGTCTTCACATGGCAAAAGG - Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
945817088 2:214618807-214618829 ATGTTTAATGACATGGAAAATGG - Intergenic
946898898 2:224354043-224354065 TAGTGTAATAAGATGCAAAATGG + Intergenic
948645867 2:239404054-239404076 GTGTATAATCAGTGGGAAAATGG + Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1174043549 20:47717025-47717047 ATGGGTATGCAGATGGAAAAGGG + Intronic
1174673582 20:52331726-52331748 TTAGGTAATTAGATGGAAAAGGG + Intergenic
1176029351 20:63004239-63004261 GTGTGAAATCATAAGGAAAAGGG - Intergenic
1176427015 21:6554230-6554252 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178220953 21:30659386-30659408 CTGGGTAATCATATGCAAATAGG + Intergenic
1178310325 21:31524900-31524922 CTGTGTAATTACAAAGAAAAGGG + Intronic
1178811203 21:35883138-35883160 CTGTGTCATCTGATGGCCAATGG + Intronic
1179702506 21:43162552-43162574 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1181145688 22:20844809-20844831 CTGTTTCATCATATGTAAAAGGG - Intronic
1181826654 22:25521985-25522007 CTGTGTCATCCCATGGCAAAAGG + Intergenic
1182446149 22:30390712-30390734 CTGTGTCCTCAGTTGTAAAATGG + Intronic
1185356946 22:50378993-50379015 CTGTGTCCTCACATGGCAAAAGG - Intronic
949258022 3:2073187-2073209 CTGTGTAAACACATGAAATATGG + Intergenic
949432315 3:3991130-3991152 CTGTGTCCTCACATGGCAAAAGG + Intronic
949838240 3:8292263-8292285 GTCTGTAAGCAGATGAAAAATGG - Intergenic
951035475 3:17927533-17927555 CTGTGTACTCGCATGGCAAAGGG - Intronic
951843566 3:27061408-27061430 CTGCCCAATTAGATGGAAAAGGG - Intergenic
954468460 3:50672661-50672683 CTCTGTAGTCAGATGGAGAGAGG + Intergenic
955046061 3:55360834-55360856 CTGAGAAATCTGATGGATAATGG + Intergenic
955478704 3:59366954-59366976 CTATGTCCTCAGATGGCAAAAGG - Intergenic
955909391 3:63844728-63844750 CTGTGTCATAACATGGCAAAAGG - Intronic
955998062 3:64698364-64698386 CTGTGTCATCACATGGCAGAAGG + Intergenic
956458793 3:69450828-69450850 ATGTACCATCAGATGGAAAAAGG - Intronic
956766574 3:72489299-72489321 CTGTGTCTTCATCTGGAAAATGG - Intergenic
958256763 3:91333528-91333550 GTGTGTACTCAGATTAAAAATGG + Intergenic
959470382 3:106742740-106742762 ATGTGTCCTCAGATGGAAGAAGG + Intergenic
959983119 3:112540450-112540472 ATGTGTAAGAAGTTGGAAAAAGG - Intronic
960124162 3:113979993-113980015 CTGTGAAATCACATTGCAAAGGG - Intronic
960221478 3:115115017-115115039 CTTTGTAATAAGATGGAGAATGG - Intronic
960638690 3:119808011-119808033 CTGGGCATTCAAATGGAAAAGGG + Intronic
962016653 3:131447932-131447954 ATGTGTCTTCACATGGAAAAAGG + Intergenic
963662164 3:148140727-148140749 CTCAGTAATCATATGTAAAACGG + Intergenic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
964467531 3:157012638-157012660 CTGTGTACCCTGATGGACAAGGG - Intronic
964615138 3:158655818-158655840 CTGTCTAGTGAGACGGAAAAAGG - Intronic
964898789 3:161631651-161631673 CTGTGTAATTGGATGGAGCAAGG - Intergenic
965138424 3:164804425-164804447 CTGTGTCATCACATGGTAAAAGG - Intergenic
965230901 3:166051835-166051857 CTGTGTCATCACATGGTAAGAGG - Intergenic
965731651 3:171778588-171778610 CTCTGTAATCATCTGGGAAAAGG + Intronic
965779336 3:172267551-172267573 ATGTGTATTCACATGTAAAATGG + Intronic
965780564 3:172281489-172281511 AGGTGGAATCAGGTGGAAAATGG + Intronic
966390210 3:179444540-179444562 CTGTGTATTTAAATGGAACATGG - Intronic
966486588 3:180477947-180477969 ATGTGGAATCAGAAGGAAAAAGG - Intergenic
967226147 3:187293255-187293277 CTGTGTCTTCATTTGGAAAATGG + Intergenic
967260698 3:187638921-187638943 CTGTGTCTTCACATGGCAAAAGG + Intergenic
967822194 3:193848548-193848570 CTGTGTCCTCACATGGCAAAAGG - Intergenic
968128719 3:196179403-196179425 CTGTGTAGTCAGATCTAAACTGG + Intergenic
968926745 4:3552340-3552362 CTGTGTCATCACATGGCAGAAGG - Intergenic
970209878 4:13698080-13698102 CTGTGTCCTCACATGGTAAAAGG + Intergenic
970471350 4:16382238-16382260 CTGTGTCTTCACATGGCAAATGG - Intergenic
971096320 4:23408803-23408825 CTGTGTGATCAGGAAGAAAATGG + Intergenic
971098549 4:23435850-23435872 CTGTGTTCTCACATGGCAAAAGG - Intergenic
971674008 4:29600958-29600980 ATGTGTAATTACATGTAAAATGG + Intergenic
972628627 4:40824345-40824367 CTGTGGAAACAGCTGGCAAAAGG - Intronic
972847704 4:43009650-43009672 CTGTGTCATCACATGGTAGAAGG + Intronic
972992201 4:44834530-44834552 CTGTGTCTTCACATAGAAAAAGG + Intergenic
974194159 4:58549634-58549656 CTTTTTAATGAGTTGGAAAATGG - Intergenic
974225669 4:59039620-59039642 ATGTGTTCACAGATGGAAAAAGG - Intergenic
975713929 4:77187696-77187718 CTGTGTACTCACATGGTAAAAGG - Intronic
975817049 4:78229103-78229125 CTTTGAAATCAGATGGACACTGG + Intronic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
976224891 4:82788096-82788118 CTGTGTCTTCACATGGCAAAAGG - Intronic
976437341 4:85033285-85033307 CTGTGTCATCACATGGTAGAAGG + Intergenic
976468107 4:85394667-85394689 CTGTGTCATCACATGGCAGAAGG + Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
977942578 4:102874929-102874951 CTCTGGTATCAGATGGAAGATGG - Intronic
978156008 4:105489864-105489886 CTGTGTCCTCACATGGTAAAAGG - Intergenic
978913060 4:114088509-114088531 CAGTGTACTCATATGTAAAATGG - Intergenic
979291838 4:118986791-118986813 TGGTGAAATGAGATGGAAAAAGG - Intronic
979493679 4:121360226-121360248 CAGTGTAATCTAATGTAAAATGG + Intronic
979824011 4:125210619-125210641 CTGTGTCATCACATGGGAGACGG + Intergenic
979860366 4:125686100-125686122 CTGTGTCATCCGATGGTGAAAGG + Intergenic
979871128 4:125823498-125823520 CTGTGTAATCACATGGTGAAAGG + Intergenic
980054072 4:128062679-128062701 TTGTGAAATAAGATGAAAAAAGG + Intronic
980321073 4:131276744-131276766 TTTTGTAATCAAATGGATAAAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
981623370 4:146729542-146729564 CTGTGAAATCAGATGTCTAATGG + Intronic
982098248 4:151943134-151943156 CTGTGTCATAACATGGTAAATGG + Intergenic
983826526 4:172268789-172268811 CTGTGTTCTCACATGGAAGAGGG - Intronic
983990322 4:174110856-174110878 CTGTATAATAAGAATGAAAAAGG - Intergenic
984074195 4:175154297-175154319 CTGTGTCATCCCATGGCAAAAGG + Intergenic
984162876 4:176275531-176275553 CTGTGTAAACTGCTGGAGAAAGG - Intronic
984227886 4:177056894-177056916 CTGAGGAATTAAATGGAAAAAGG + Intergenic
984402767 4:179288007-179288029 CTGCATAATCAGGAGGAAAAGGG - Intergenic
985231407 4:187821864-187821886 CTGTGTACTCACAAGGCAAAAGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985980729 5:3460987-3461009 CTGTGTTTTCAGAATGAAAAGGG + Intergenic
987248072 5:16069813-16069835 TTGTTTTATCTGATGGAAAAAGG - Intronic
987575842 5:19726932-19726954 CTGTGTCATCATATGGCAGAAGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
989049466 5:37305202-37305224 CTGTTTAATCTGAAAGAAAATGG + Exonic
990145206 5:52751880-52751902 CTGTGTCCTCATATGGCAAAAGG + Intergenic
990645679 5:57841574-57841596 CTGTGTATTCAAATGTAATAAGG - Intergenic
991064200 5:62408490-62408512 GTGTGTAATAACTTGGAAAAGGG - Intronic
991524220 5:67538396-67538418 ATGTGTACTCAGAAGTAAAAAGG + Intergenic
992143638 5:73823327-73823349 CTGTGTAATTTTATGCAAAATGG - Intronic
992268176 5:75038620-75038642 CTGTGTTCTCACATGGCAAAGGG + Intergenic
992326223 5:75662922-75662944 CTGAGTAATAAGACAGAAAAGGG - Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993354932 5:86894118-86894140 CTGTGTCATCACATGGCAGAAGG - Intergenic
993453863 5:88105088-88105110 CTGTGTATTCACATGGTAGAAGG - Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
994015746 5:94962981-94963003 CTGTGTCCTCACATGGCAAAAGG + Intronic
995159520 5:108962229-108962251 TTGTGTAAACATATGGAAGATGG + Intronic
995579431 5:113580066-113580088 CTGTGTCCTCATATGGCAAAAGG + Intronic
996477403 5:123937161-123937183 CTGTCCCATCAGAAGGAAAATGG - Intergenic
996714120 5:126572868-126572890 CTGTGTATTCAGAAGGATATAGG - Intronic
999516333 5:152305534-152305556 CTGTGTCATCTCATGGAAAAAGG + Intergenic
999780469 5:154845724-154845746 CTGTTTCTTCAGTTGGAAAATGG - Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001487358 5:172129086-172129108 CTGTGTCCTCAGCTGTAAAATGG + Intronic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002758885 6:186551-186573 CTGTGTTTTCAGTTGAAAAATGG - Intergenic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1002843586 6:926253-926275 CTGTCTAATCACAAGGGAAAAGG + Intergenic
1002919584 6:1557406-1557428 CAGTGTACTCAGGTGGAAAATGG - Intergenic
1003692060 6:8364731-8364753 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692068 6:8364779-8364801 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003859626 6:10310468-10310490 CTTTGAAATGTGATGGAAAAAGG - Intergenic
1004210581 6:13638225-13638247 CAGTGTATTCATATGTAAAATGG - Intronic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1005042726 6:21613872-21613894 CTGTCTCATCAGAGGCAAAAAGG + Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1006324019 6:33339659-33339681 TTGTATAATCAGACTGAAAATGG + Intergenic
1006637676 6:35472211-35472233 CTTTGCAATCAGAAGGAAAAGGG + Intergenic
1006940867 6:37751564-37751586 CTGTGGAGTCAGATGACAAAGGG - Intergenic
1006972517 6:38061291-38061313 AAGGGTAATCAGAAGGAAAAAGG - Intronic
1007117881 6:39356685-39356707 CTCTGGCATCAGATGGACAATGG + Intronic
1007996966 6:46317862-46317884 CTGTGTAATCTTGTGTAAAAAGG + Intronic
1008402474 6:51079600-51079622 CTGTTTCTTCATATGGAAAAGGG + Intergenic
1008640549 6:53458139-53458161 CAGTGTCATCAGCTGGAACATGG + Intergenic
1008811300 6:55503531-55503553 GTGTGTAATGAGAATGAAAAAGG + Intronic
1008998573 6:57687634-57687656 GTGTGTACTCAGATTAAAAATGG - Intergenic
1009051636 6:58283173-58283195 CTGTGAAAGCAGATGTAAATGGG + Intergenic
1009399525 6:63237844-63237866 CTGTGTCATCCCATGGCAAAAGG + Intergenic
1010891119 6:81312228-81312250 CTGTGTCATAAAATTGAAAAAGG + Intergenic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1011571199 6:88737665-88737687 CTGTGTATTCACATGGCACAAGG - Intronic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012130835 6:95490707-95490729 CTATCTAATGACATGGAAAATGG - Intergenic
1012443232 6:99281671-99281693 CTGTGTCCTCACATGGTAAAAGG - Intronic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1012968079 6:105697101-105697123 CTGCCTAGTCAGATGGAATATGG + Intergenic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1013845437 6:114445091-114445113 CTGAGTAATAAGCTGGCAAAAGG - Intergenic
1013921382 6:115408524-115408546 TTGTTTAATCAAAGGGAAAAGGG - Intergenic
1013991331 6:116257689-116257711 CTGTGTCCTCACATGCAAAAAGG + Intronic
1014786943 6:125630385-125630407 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1014831936 6:126112996-126113018 CTGTCCACTCAGATGCAAAAAGG - Intergenic
1015094630 6:129400136-129400158 CTGTGTCCTCACATGGTAAAAGG + Intronic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017941209 6:159054902-159054924 CTGGGTATTGAGTTGGAAAATGG + Intergenic
1018234900 6:161714419-161714441 CTGTGTCTTCACATGGCAAAAGG - Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG + Intronic
1023058115 7:36305703-36305725 CAGTGGATTCAGATGGAAACTGG + Intergenic
1023197262 7:37655161-37655183 CAGTGTACTCACATGGTAAAAGG + Intergenic
1023596178 7:41831281-41831303 ATTTGTAAGCAGATGGAAACAGG + Intergenic
1023964288 7:44954406-44954428 CTGTGTCATCTCATGGCAAAAGG + Intergenic
1024384423 7:48735300-48735322 CTGTGTCATCCGATGATAAAAGG - Intergenic
1027338112 7:77175961-77175983 CAGTGTTATCAGAAGGGAAAGGG + Intronic
1027434065 7:78145621-78145643 CTGTGTCATCCCATGGCAAAAGG - Intronic
1028210581 7:88069274-88069296 CTGTGTCATCATATGGTAGAAGG - Intronic
1028350659 7:89843102-89843124 ATGTATAACCAGATGAAAAAGGG - Intergenic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1029777615 7:102694832-102694854 CAGTGTTATCAGAAGGGAAAGGG - Intergenic
1030292928 7:107890132-107890154 CTTTGTAATCAGATGGAATGAGG + Intergenic
1033027565 7:137790759-137790781 CTGTATTATCACCTGGAAAATGG + Intronic
1033366521 7:140676200-140676222 CTGTGTCATCACATGGTAGAAGG + Intronic
1034825239 7:154256395-154256417 CTGTGGAACCAAATGGAAACTGG + Intronic
1036461291 8:8955188-8955210 CTGTGTCATAACATGGCAAAAGG - Intergenic
1037333908 8:17773581-17773603 CTGTGTCATAACATGGAGAAGGG + Intronic
1037702444 8:21287367-21287389 CTGTGTCATCACATGACAAAAGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1038628003 8:29212914-29212936 ATGTATAATCAGATGGCACATGG + Intronic
1039398110 8:37244663-37244685 CTGTGGAATCACATGGTAAAGGG + Intergenic
1040678449 8:49780649-49780671 CTGTGTACACATATGGCAAAAGG + Intergenic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1041259427 8:56007632-56007654 CTGTGTCCTTAGATGAAAAAAGG + Intronic
1041403904 8:57474850-57474872 CTGTGTCGTCACATGGAATAAGG + Intergenic
1041716933 8:60941015-60941037 CTGTGTTCTCACATGGAAGAAGG + Intergenic
1042058776 8:64794553-64794575 CTGTGTCCTCACATGGACAAAGG + Intronic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042739406 8:72026619-72026641 CTGTGCTATCAGGTGCAAAATGG + Intronic
1043261749 8:78209154-78209176 CTGTTTAAGCAAATGCAAAATGG + Intergenic
1044541418 8:93412380-93412402 CTGTGTAATCAGATAGATTTGGG + Intergenic
1046212423 8:111094700-111094722 CTGTGTCCTCACATGGCAAAAGG + Intergenic
1047011384 8:120676451-120676473 CTTTGTAATCAGATGGACCTAGG - Intronic
1047322923 8:123805305-123805327 CTGTTTCATCAAATGGAAATGGG - Exonic
1047913969 8:129561693-129561715 CTGTGTCATCCCATGGAGAAAGG - Intergenic
1048127071 8:131647659-131647681 GTATGTAATCATATAGAAAAAGG - Intergenic
1048564765 8:135584013-135584035 CTTTGGTAGCAGATGGAAAAGGG - Intronic
1048919268 8:139213225-139213247 CTGTGTTATGAGATGAAAGAAGG - Intergenic
1051094356 9:13448745-13448767 CAGTGAAATCAGATGCCAAATGG - Intergenic
1051512276 9:17891464-17891486 CTAAGATATCAGATGGAAAAGGG - Intergenic
1052139620 9:24963564-24963586 CTGTTTCATAAGATGGCAAAGGG + Intergenic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053801662 9:41767722-41767744 CTGTGTCATCACATGGCAGAAGG - Intergenic
1054143542 9:61547104-61547126 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054190094 9:61979876-61979898 CTGTGTCATCACATGGCAGAAGG - Intergenic
1054463315 9:65478439-65478461 CTGTGTCATCACATGGCAGAAGG + Intergenic
1054648421 9:67608715-67608737 CTGTGTCATCACATGGCAGAAGG + Intergenic
1055453761 9:76454479-76454501 CTTTGTGGTCAGCTGGAAAAGGG + Intronic
1055541126 9:77306444-77306466 GTGTGTAAAGAGAGGGAAAAGGG + Intronic
1055669537 9:78588955-78588977 CTGTGTCATCACATGGCAGAAGG - Intergenic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1061084032 9:128389048-128389070 CTTTGTAGCCAGATGGAAAATGG - Intronic
1061513986 9:131077908-131077930 CAGTGTCATCAGATGGACACGGG + Intronic
1061654488 9:132078641-132078663 CTTAGTAACCAGATGGAAAGAGG - Intronic
1061775752 9:132962584-132962606 CAGTGGAATCAGATGAAAACTGG + Intronic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186179299 X:6957451-6957473 CTGTGTTATCACATGGCAAAAGG - Intergenic
1186257328 X:7736691-7736713 CTGTGTTTTCACATGGCAAAAGG + Intergenic
1186351314 X:8742459-8742481 CAGTGTTCTCAAATGGAAAATGG + Intergenic
1187437241 X:19283824-19283846 CTGTGTCATCAAAGAGAAAATGG + Intergenic
1187614589 X:20979661-20979683 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1188669355 X:32864243-32864265 CTGTTTCATCAGTTGTAAAATGG - Intronic
1188911194 X:35849550-35849572 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1188989320 X:36798560-36798582 CTGTGTCCTCATATGGCAAAAGG - Intergenic
1189025561 X:37390136-37390158 CTGTGTCCTCACATGGCAAAAGG + Intronic
1189140004 X:38593725-38593747 CTGTGTCATCCCATGGCAAAGGG - Intronic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1190244602 X:48683045-48683067 CTCTGTAATTAAAAGGAAAAGGG + Intronic
1190524874 X:51318771-51318793 CTGTGTATTCACTTTGAAAAAGG - Intergenic
1193370777 X:80694521-80694543 CTGTGAAAGCAGCTGGGAAAGGG + Intronic
1193978408 X:88151650-88151672 CTGTGTTCTCACTTGGAAAAAGG + Intergenic
1194047374 X:89024845-89024867 CTGTGTCTTCACATGGCAAAAGG + Intergenic
1194780254 X:98015870-98015892 CTGTGTCATCACATGGTGAAAGG + Intergenic
1194818883 X:98480828-98480850 CTGAGTAAGCAGATGGGAATTGG + Intergenic
1194979097 X:100422489-100422511 CTGTGTATTCACATGGTAGAAGG - Intergenic
1195309771 X:103620791-103620813 CTGTGTACTCACATGGTAGAAGG + Intronic
1195378875 X:104253267-104253289 CTGTTAAATAAGATAGAAAAAGG + Intronic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1196577203 X:117333157-117333179 CTGTGTCTTCACATGGTAAAAGG - Intergenic
1197966915 X:132073951-132073973 TTGTGAAATCAGATGCAGAAGGG + Intergenic
1198478621 X:137019667-137019689 CTGTTTTCTCAGCTGGAAAATGG - Intergenic
1198650130 X:138853645-138853667 GTGTGTAATCACATGAAAACAGG + Intronic
1198661638 X:138975267-138975289 CTGTGCCATCAACTGGAAAATGG - Intronic
1198891906 X:141405962-141405984 CTGTGTTTTCTGCTGGAAAAAGG - Intergenic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1200737044 Y:6811240-6811262 CTGTGTATCCACATGGTAAACGG + Intergenic
1201512514 Y:14780649-14780671 CTGTGTCCTCACATGGTAAAAGG - Intronic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic