ID: 932137287

View in Genome Browser
Species Human (GRCh38)
Location 2:69242405-69242427
Sequence AGATATTGGCAGAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 522}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932137282_932137287 8 Left 932137282 2:69242374-69242396 CCCTGGGAATCCTAACATGGATT 0: 1
1: 0
2: 0
3: 12
4: 113
Right 932137287 2:69242405-69242427 AGATATTGGCAGAAGAAGGCTGG 0: 1
1: 0
2: 3
3: 36
4: 522
932137281_932137287 9 Left 932137281 2:69242373-69242395 CCCCTGGGAATCCTAACATGGAT 0: 1
1: 0
2: 0
3: 12
4: 107
Right 932137287 2:69242405-69242427 AGATATTGGCAGAAGAAGGCTGG 0: 1
1: 0
2: 3
3: 36
4: 522
932137284_932137287 -2 Left 932137284 2:69242384-69242406 CCTAACATGGATTATGAACAGAG 0: 1
1: 0
2: 0
3: 7
4: 129
Right 932137287 2:69242405-69242427 AGATATTGGCAGAAGAAGGCTGG 0: 1
1: 0
2: 3
3: 36
4: 522
932137283_932137287 7 Left 932137283 2:69242375-69242397 CCTGGGAATCCTAACATGGATTA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 932137287 2:69242405-69242427 AGATATTGGCAGAAGAAGGCTGG 0: 1
1: 0
2: 3
3: 36
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932137287 Original CRISPR AGATATTGGCAGAAGAAGGC TGG Intronic
900989598 1:6092274-6092296 GGATCTGGGCAGAAGCAGGCTGG - Intronic
901179400 1:7330847-7330869 AGATACTGGGGGAAGCAGGCAGG + Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903535795 1:24065422-24065444 AGATCTGGGCAGAATAAAGCAGG - Intronic
903662315 1:24985615-24985637 AGACAATGGCAGAAGAAGGGAGG - Intergenic
904030651 1:27531632-27531654 GGAAAGTGGCAGAAGTAGGCTGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904570751 1:31462789-31462811 TGATATTGGTTGAAGAAAGCAGG + Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906697317 1:47831827-47831849 ACATACTGGAAGAAGAAGCCTGG - Intronic
906718923 1:47991707-47991729 AGACAGTGAGAGAAGAAGGCGGG - Intronic
906885392 1:49640000-49640022 GGAAACTGGCAGAAGAAGGAAGG + Intronic
907435428 1:54442873-54442895 AGAAGATGGCTGAAGAAGGCCGG - Intergenic
907462687 1:54614646-54614668 AGGTGTTGACAGAAGAGGGCTGG + Intronic
907895663 1:58687797-58687819 AGGTATCGGCAGAAGAGGTCTGG - Intronic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
908778168 1:67661942-67661964 AGATAGTAGCTGAAGAAGCCAGG + Intergenic
909123411 1:71634326-71634348 TGTTATTGGCAGAATAAGCCAGG + Intronic
909240019 1:73201033-73201055 AGAAGTTGGGAGAACAAGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910932374 1:92455218-92455240 AGATATTGGTAGACTGAGGCAGG + Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911446669 1:98002440-98002462 AGACATTGGAAGCAAAAGGCTGG + Intergenic
911561249 1:99408725-99408747 AAATTTTGGCAGTAGAAGCCAGG - Intergenic
911681905 1:100726518-100726540 AGATTTTGCCAGATGAAGGAAGG - Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
913657629 1:120976318-120976340 AGATATGGGAAGTATAAGGCAGG - Intergenic
913686617 1:121238123-121238145 AAAGAATGGCAGGAGAAGGCAGG - Intronic
914008980 1:143759400-143759422 AGATATGGGAAGTATAAGGCAGG - Intergenic
914038471 1:144025763-144025785 AAAGAATGGCAGGAGAAGGCAGG - Intergenic
914150984 1:145042145-145042167 AAAGAATGGCAGGAGAAGGCAGG + Intronic
914647608 1:149668052-149668074 AGATATGGGAAGTATAAGGCAGG - Intergenic
915213912 1:154327972-154327994 AGAGACTGGGAGAAGGAGGCTGG + Intronic
915602587 1:156931601-156931623 TGATATTGTCAGATGAAGACGGG - Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916585095 1:166143403-166143425 AGAGACTGGCAGATGAAGACAGG + Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918041707 1:180917592-180917614 AGATTTTGGAATGAGAAGGCGGG - Intronic
918662389 1:187105989-187106011 AGAAATAGGGAGAAAAAGGCTGG + Intergenic
918823247 1:189286720-189286742 AGAGTTTGCCAGAGGAAGGCGGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919036129 1:192311486-192311508 ATCTATTGGCAAAAGTAGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920473943 1:206256681-206256703 AAAGAATGGCAGGAGAAGGCAGG - Intronic
920837209 1:209522226-209522248 AGATAATGAGTGAAGAAGGCTGG + Intergenic
921367706 1:214389446-214389468 AAATATAGACAGAAGAGGGCAGG + Intronic
921563760 1:216691012-216691034 AGAAAATGGCAAATGAAGGCAGG - Intronic
922404695 1:225299732-225299754 TGATATGGCCAGAAGAAGCCTGG - Intronic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065173150 10:23051858-23051880 AGAAAGTGGCAGAAGCAGACAGG + Intergenic
1067010561 10:42708964-42708986 AGATATGGGAAGTAGAAGCCTGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068051247 10:51951653-51951675 AGACATTGGGATGAGAAGGCAGG + Intronic
1068164534 10:53311864-53311886 AAATTTTGGAAGAAGAAAGCAGG + Intergenic
1068310377 10:55266717-55266739 AGGTACTGGCAGATGCAGGCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069144762 10:64876888-64876910 GGTTATTGGCATAAGGAGGCTGG - Intergenic
1069547881 10:69341749-69341771 AGAAATTGCCAGAAGAGGCCAGG - Intronic
1069588123 10:69623050-69623072 AAAGATGGACAGAAGAAGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070221716 10:74455002-74455024 AGAAAATGGCAGAAGCAGGAAGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072271903 10:93784758-93784780 AGATCTTTGCAGAGGAAGGAGGG + Intronic
1073182604 10:101594095-101594117 GGAGATATGCAGAAGAAGGCAGG + Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074104689 10:110380003-110380025 AGGAAATGACAGAAGAAGGCAGG + Intergenic
1075009958 10:118859218-118859240 AGAAAGTCCCAGAAGAAGGCAGG + Intergenic
1075438988 10:122464437-122464459 AAATATTTGCAAAAGAAGGAGGG - Intronic
1076121453 10:127940028-127940050 AGATGTGGGCAGATGGAGGCAGG + Intronic
1076270348 10:129147211-129147233 AGAAATGGGCAGAAGAAGAGAGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077649195 11:3954155-3954177 AGAGAATGGGAGAAGAAGGAAGG - Intronic
1078126175 11:8565793-8565815 AGAGATAGGCAGAAGCAGACAGG - Intronic
1078252356 11:9626737-9626759 AGAAAATGGCAGAAAATGGCAGG + Intergenic
1078953530 11:16163521-16163543 AGATATTGGCTGAGAAAGCCTGG - Intronic
1079304816 11:19312591-19312613 AGACATTGGCTAAAGAAGGCAGG - Intergenic
1080131469 11:28800326-28800348 AGTAAGTGGCAGAAGAAGTCTGG - Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081001657 11:37680802-37680824 AACTCTGGGCAGAAGAAGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1082194491 11:49285656-49285678 AGTTATTGGCAGGCCAAGGCAGG - Intergenic
1082635346 11:55586833-55586855 ACTTATTAGCAGAAGAAGGTGGG + Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083803651 11:65060859-65060881 AGCCATTGGGAGAATAAGGCAGG - Intergenic
1084931370 11:72559168-72559190 AGAGATTGGGAGAAAGAGGCAGG - Intergenic
1086200110 11:84192432-84192454 AGAGATTGGCAAAGAAAGGCTGG + Intronic
1086346447 11:85902157-85902179 AGATTCTGGCAGAAGCAGGTGGG + Intronic
1087430699 11:98050248-98050270 GGATATAAGCAGAAGTAGGCTGG - Intergenic
1088027057 11:105198500-105198522 ATATGTGGGCAAAAGAAGGCTGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089418350 11:118312580-118312602 GGAAATTGGCAGAAGAAACCAGG - Intronic
1089516172 11:119033143-119033165 GGATATTGGAAGACCAAGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091107244 11:132934253-132934275 AGATCCTGGCAGGACAAGGCAGG + Intronic
1091335823 11:134764917-134764939 AGCAATAGACAGAAGAAGGCAGG - Intergenic
1091603588 12:1932433-1932455 AGATCGTGACAGAAGAACGCAGG + Intergenic
1091622777 12:2101759-2101781 GGATGGTGGCAGAAGGAGGCTGG + Intronic
1091872810 12:3909188-3909210 AAATATTACCTGAAGAAGGCCGG + Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092235863 12:6809098-6809120 AGAAATTGGGAGAACAAGGAGGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092664830 12:10784348-10784370 AGAAATTGTCAGCTGAAGGCAGG + Intergenic
1092943341 12:13430598-13430620 AGAGGTTGGCAAATGAAGGCCGG + Intergenic
1092993332 12:13924484-13924506 GGCTTTTGGGAGAAGAAGGCAGG + Intronic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093484012 12:19634252-19634274 AGAAAATGGCAGAAGTAGGAAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095356113 12:41277521-41277543 AGAGATTGGGATAAGAAGGCCGG - Intronic
1095486025 12:42685527-42685549 AGATATTGTCAGCAGAAGCCTGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096404801 12:51335881-51335903 AGATTTTGGCAGATTGAGGCAGG - Intronic
1096422140 12:51468075-51468097 ATTTATTGGTAGAAGAAGCCAGG + Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096590659 12:52656942-52656964 AGATCATTGCAGAAGAAGGCAGG + Intergenic
1097076998 12:56402414-56402436 AGTTATCGCCAGAAGATGGCAGG - Intergenic
1097419300 12:59354213-59354235 ACATATTGGAGGATGAAGGCTGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097820942 12:64128762-64128784 AGATATTTGAAGAACAAGTCTGG + Intronic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098682046 12:73368324-73368346 ACATATTGTCATAAGAAGTCTGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100507911 12:95238462-95238484 AGATAATGGCAAGAGAAGACAGG - Intronic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102376710 12:112427599-112427621 AGATAATGCCAGATGATGGCTGG + Intronic
1102974088 12:117193664-117193686 AGATAGTGAAAGAAGAGGGCTGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104015020 12:124956162-124956184 AGATGGTGGCAGCAGAAGCCTGG + Intronic
1104410900 12:128556823-128556845 AGATAGTGGCAGGAGCAGTCAGG - Intronic
1105246069 13:18651178-18651200 AAATACTGGTAGAAGAGGGCAGG - Intergenic
1106670579 13:31900342-31900364 AGAGAGTGGTAGAAGAAGGCCGG - Intergenic
1107278758 13:38708689-38708711 AAATTATGGCAGAAGAAGGGAGG - Intronic
1107293147 13:38880352-38880374 AGGTATTGGCAAAAGAAGTGTGG + Exonic
1108078501 13:46708120-46708142 AGATCTTGGCAGAAGAAGAGCGG + Intronic
1108260810 13:48653970-48653992 AGATAGAGGCAGCAGAAGCCAGG + Intronic
1108830129 13:54467332-54467354 ACATAGTTGGAGAAGAAGGCAGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109067248 13:57713149-57713171 AGAAATTGGTAGAAGAGGTCAGG - Intronic
1110467063 13:75814312-75814334 ACATATTAGCAGCACAAGGCAGG - Intronic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112545443 13:100364753-100364775 AGAAATTGTTAGAAAAAGGCTGG + Intronic
1112980205 13:105374783-105374805 AGAGATTGACAGATGGAGGCGGG + Intergenic
1114134282 14:19829167-19829189 AGAGAGTGGCAAAAGAAAGCTGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114242395 14:20880475-20880497 GAATATTGGGAGATGAAGGCAGG + Intergenic
1114700027 14:24667490-24667512 AGCCCTTGGCAGAAGAAAGCTGG + Intergenic
1115704044 14:35979854-35979876 AGTTGTTGGCAGAAGCAGCCTGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118082158 14:62373040-62373062 AGATATTGGGAGAATAAGACAGG - Intergenic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119843247 14:77809070-77809092 ATATTTTGGGAGAAAAAGGCTGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1121047553 14:90799203-90799225 GGATATTGGCAGGAGAAGGGAGG - Intronic
1122032874 14:98926440-98926462 AGACCTTGGCAGGAGTAGGCTGG - Intergenic
1123436351 15:20257323-20257345 CGCTATTGGCAGATGCAGGCTGG - Intergenic
1123577338 15:21684763-21684785 AGAGAGTGGCAAAAGAAAGCTGG + Intergenic
1123613961 15:22127233-22127255 AGAGAGTGGCAAAAGAAAGCTGG + Intergenic
1124199378 15:27664867-27664889 AGATAATGGCAGTGGAAGGAAGG - Intergenic
1124394910 15:29293038-29293060 AGATAATGGCACAAAAAGGCTGG + Intronic
1124933094 15:34143004-34143026 AGAAATTGAAAGAAGAGGGCCGG - Intronic
1125060370 15:35413597-35413619 AGATATTAGCAAAAGAAAGCTGG - Intronic
1125237005 15:37526455-37526477 ATATATGGGGAGAAGAAGGGAGG + Intergenic
1126277744 15:46903872-46903894 AGATTTAGGCAGACCAAGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1130145382 15:81270016-81270038 AGATGTTGGCATAATAAAGCAGG + Intronic
1130821166 15:87497164-87497186 AGATATTTGCAGAAAAATGTGGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202986206 15_KI270727v1_random:419008-419030 AGAGAGTGGCAAAAGAAAGCTGG + Intergenic
1134595629 16:15493586-15493608 AGATCATGGCAGAAGAAGGAAGG - Intronic
1134771907 16:16816330-16816352 CAATCTTGGAAGAAGAAGGCTGG - Intergenic
1135109414 16:19679114-19679136 AGCTGTTAGCAAAAGAAGGCTGG + Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136411436 16:30079766-30079788 AGAGATTGGCAGAAAGAGGGGGG + Intronic
1137569590 16:49556940-49556962 AAATATTGGTGGGAGAAGGCAGG + Intronic
1138125263 16:54433273-54433295 AGATACTGGCAGATGAAAGTTGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139348233 16:66318301-66318323 AGACCTTGGCAGCAGAAGGAAGG + Intergenic
1140070992 16:71649447-71649469 AGAAGGTAGCAGAAGAAGGCTGG + Exonic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143304973 17:5939329-5939351 TGCTGTTGGCAGAAGAAGGGAGG - Intronic
1143926848 17:10378694-10378716 AGAAAATGGCAGAAGTAAGCTGG - Intergenic
1145011547 17:19371082-19371104 TGATACAGGGAGAAGAAGGCAGG + Intronic
1145858903 17:28189897-28189919 AGATAATCACAGAAGAAAGCGGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146839649 17:36141778-36141800 AGATATTGGCTGGAGAAGACAGG - Intergenic
1147316221 17:39621675-39621697 AGAGGTTGGGGGAAGAAGGCAGG + Intergenic
1150471425 17:65440749-65440771 AGATGTTAGCTGAAAAAGGCAGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151246365 17:72798032-72798054 AGATGTTGGAAGGAGAGGGCTGG + Intronic
1151536710 17:74743087-74743109 AGAAATGGTCAGAAGGAGGCAGG - Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153528739 18:6021971-6021993 AGAGAGTGGCAGAAGATGCCTGG - Intronic
1154442850 18:14408486-14408508 AAATACTGGTAGAAGAGGGCAGG + Intergenic
1154472888 18:14722072-14722094 AGATTTTGGTAGAAGCAGGGAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1154945406 18:21157455-21157477 AGATGCTGGCAGAGGTAGGCAGG + Intergenic
1155459879 18:26066744-26066766 AGATATTTGAAAAAGAAGGTAGG + Intronic
1155478671 18:26261906-26261928 AGATATTGGGAGCAGAGGTCGGG + Intronic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157520350 18:48341256-48341278 AGATGTGGGCAGAGGAAGGAAGG + Intronic
1157958462 18:52125631-52125653 ATACAATGGCAGAGGAAGGCAGG + Intergenic
1159223581 18:65500050-65500072 AGATAATGTAAGCAGAAGGCAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160014602 18:75130861-75130883 GGATAATGGCAGAGGAAAGCTGG - Intergenic
1161820467 19:6527784-6527806 ATAAATTTGCAGAAGAAGGCCGG - Intergenic
1162026011 19:7894585-7894607 GGATGTTGGCAGAAGTGGGCTGG + Intronic
1168383569 19:55944360-55944382 AGGTAACGGTAGAAGAAGGCAGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
928092668 2:28385147-28385169 GGATGTTGGCAGGTGAAGGCAGG - Intergenic
928182041 2:29075005-29075027 AGATAGTGAATGAAGAAGGCAGG + Intergenic
929054871 2:37867882-37867904 AAATATTGGCATAAAAATGCAGG + Intergenic
929181651 2:39046791-39046813 AGAAATTGGTAGATGTAGGCCGG - Intronic
929548178 2:42870280-42870302 AGATATTGTGAGAAGAAAGTTGG + Intergenic
929572615 2:43032163-43032185 AGTTGTTGGCTGAGGAAGGCAGG - Intergenic
930178517 2:48326144-48326166 AGATCTTGGGAGAAGAAGGCCGG - Intronic
930532059 2:52601030-52601052 AGATATTGGAACAAGAGAGCAGG - Intergenic
932041255 2:68302342-68302364 AGAGTTTGGAGGAAGAAGGCAGG - Intronic
932137287 2:69242405-69242427 AGATATTGGCAGAAGAAGGCTGG + Intronic
932469677 2:71945636-71945658 AGACATCGGCAGTAGGAGGCGGG - Intergenic
932507350 2:72248102-72248124 AGATTCTGGCAGAGGAAGTCAGG - Intronic
932693654 2:73935310-73935332 AGAGATTGGCTGAAGAAGTATGG + Intronic
935418021 2:102838829-102838851 AGCCATTGGCAGAGGAAGGATGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935665582 2:105509500-105509522 GGATCTTGGCAAAAGAAGGGTGG + Intergenic
935719724 2:105969330-105969352 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
937276583 2:120688426-120688448 AGATTATGGCAGGAGTAGGCTGG + Intergenic
938934874 2:136118722-136118744 AGATACTTTCAGAAGAAGGTAGG + Intergenic
938984499 2:136560989-136561011 GAATATTGGCAGAAGAGAGCGGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939684667 2:145184401-145184423 ATATATTGGCAGCAGGAGGAAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941321923 2:164066312-164066334 AGCTATTAACAGGAGAAGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942601013 2:177641049-177641071 GGACAGTGGCAGAGGAAGGCTGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944837621 2:203595656-203595678 AGATGTTGGGACAAGAATGCAGG + Intergenic
945144937 2:206728264-206728286 AAATATTTGGAGAAAAAGGCAGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947563327 2:231177129-231177151 AGATCTAGGCAGAAAATGGCGGG - Intergenic
1168981024 20:2003692-2003714 AGAAATTGGCAAATGCAGGCAGG - Intergenic
1169474872 20:5922506-5922528 AGAAATGGGCAGAGGGAGGCGGG + Exonic
1169554744 20:6737236-6737258 AGATGTGGGAGGAAGAAGGCAGG + Intergenic
1172395708 20:34603015-34603037 AGATATGGGCAGGAGTAGGCTGG - Intronic
1172625905 20:36346592-36346614 ATATATTGGGAGAAGTAGGTGGG + Intronic
1173069734 20:39751565-39751587 AAATATTGCCAGGAGAAGGGAGG - Intergenic
1173986555 20:47266186-47266208 TGATATTGGGAGGACAAGGCAGG - Intronic
1174048563 20:47751258-47751280 AGCTAGTGCCAGAAGAAGGCAGG - Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176801596 21:13435777-13435799 AGATTTTGGTAGAAGCAGGGAGG - Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177767747 21:25477339-25477361 ACATATTGACAGAATAAGGTGGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178710629 21:34913268-34913290 AAATAATGGCAGGAGAAGGAGGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181897096 22:26120028-26120050 AGAACATCGCAGAAGAAGGCTGG - Intergenic
1183053085 22:35280812-35280834 AGATGTAGGCAGATGAAGGGTGG - Intronic
1184550110 22:45199968-45199990 AGGGATGGGGAGAAGAAGGCAGG + Exonic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949965677 3:9354108-9354130 CTATAATGGCAGAAGAAGGAAGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951836263 3:26986693-26986715 AGATAATAGGAGAAGCAGGCTGG - Intergenic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
951980802 3:28564274-28564296 AGGTACTGGTAGAAGATGGCAGG - Intergenic
952486141 3:33812168-33812190 AGATATTGGCAGAAGGAAATGGG - Intronic
952976739 3:38703000-38703022 AGATATGTGCAGATCAAGGCAGG - Intronic
953340807 3:42132733-42132755 GGATATAGACAGAAGCAGGCTGG - Intronic
953434216 3:42865805-42865827 AGAAAGTGGAGGAAGAAGGCGGG - Exonic
954560102 3:51549463-51549485 AGAAATCGGGAGAAAAAGGCTGG + Intronic
954980174 3:54738765-54738787 AGATAAGGGCTGAAGAAGGTAGG - Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957271120 3:78031281-78031303 AGAAAATGGCAGAAGCAGGAAGG + Intergenic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959008731 3:101049814-101049836 AGATATTAGCAAAAGCAGTCTGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959611876 3:108304385-108304407 AGAAGTTGGCAGAACAAGGAAGG - Intronic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960183964 3:114616192-114616214 AGCTATTGGCAAAACAAGCCAGG - Intronic
960306646 3:116070148-116070170 AGAGAATGACATAAGAAGGCTGG + Intronic
962367988 3:134798286-134798308 AGATGTGGCCAGAGGAAGGCAGG + Intronic
963932200 3:151015020-151015042 AGAAATACGCAGAAGAAGGCTGG - Intergenic
964602826 3:158521328-158521350 AGATGTGGGCAGTAGAAGGAAGG - Intronic
964628462 3:158782378-158782400 GGAGATTGGGAGAAGAAGGTGGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965122642 3:164582228-164582250 AGATATTTGAAAAAAAAGGCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966261301 3:177982620-177982642 TGATATTGGGAGAAGGAGCCAGG - Intergenic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966890113 3:184401100-184401122 AGACATTGTGAGAAGAAGGGAGG + Intronic
967304120 3:188044283-188044305 AGATATTGGGAGTAAAAGGAAGG - Intergenic
967334332 3:188325501-188325523 AGATAATGACAGAAGAATGATGG - Intronic
970406796 4:15771682-15771704 AGATATTGCCAGCCAAAGGCTGG - Intergenic
970756785 4:19437036-19437058 AGAAATTTGCAGAAGAAACCAGG + Intergenic
970979747 4:22082503-22082525 AGTTGTTGGCAGAAGCAGGCTGG - Intergenic
971794964 4:31215611-31215633 AGATTTTGGCAGAATAAGCATGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
972297570 4:37754784-37754806 AGATATAGGAAGAAGTTGGCTGG + Intergenic
972366627 4:38381874-38381896 ACAGATTGGCCAAAGAAGGCCGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973193884 4:47417558-47417580 AGAAATGGGAAGATGAAGGCTGG + Intronic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975317364 4:72970002-72970024 ACTTATTGGCAGAAGCAGGAGGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976216050 4:82716515-82716537 AAATATTTGCGGAAGAAGCCTGG + Intronic
977224176 4:94374820-94374842 AGAGAATGGGAGAAGAGGGCTGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977784232 4:101014339-101014361 ACATATTGGCAGGAAAAGTCTGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
977990927 4:103441659-103441681 ACTTGTTGGCAGAGGAAGGCAGG + Intergenic
978347974 4:107791687-107791709 AGCTATTGGCAAATGTAGGCTGG - Intergenic
978684255 4:111420041-111420063 AAAAATTGGATGAAGAAGGCTGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
985421849 4:189792373-189792395 AAATATTGGGAGATGAAAGCAGG - Intergenic
985884340 5:2664981-2665003 AGAGAGGAGCAGAAGAAGGCTGG + Intergenic
986495277 5:8335336-8335358 AGGTCTTGGCATAAGTAGGCCGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988941708 5:36153716-36153738 AGATCTGGGGAGAAGAAGGTTGG - Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989598664 5:43181650-43181672 AGACATTTGCAGGAGAGGGCCGG + Intronic
991638480 5:68730462-68730484 AAATATTGGGATAAGTAGGCTGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992120334 5:73586010-73586032 AGTTATTGCCACAAGAAGCCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992255189 5:74914282-74914304 ACATATTGGGAGGACAAGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993870948 5:93253260-93253282 AGATTTTGCCAGTGGAAGGCAGG + Intergenic
993990390 5:94649679-94649701 AGATTTTGGAATCAGAAGGCTGG + Intronic
994110370 5:95996171-95996193 AGATATAGGAAGATCAAGGCTGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994965515 5:106664970-106664992 AAATAGTGGCAGTTGAAGGCAGG - Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995680357 5:114711169-114711191 AGATATTGCCAGTGGAAGCCGGG - Intergenic
996043612 5:118844885-118844907 ACATTTTGGCAGGCGAAGGCAGG + Intronic
996329674 5:122314269-122314291 TGATATTAGCAGAAAAAGCCTGG + Intronic
996391787 5:122970457-122970479 AGATTTGTGCAGAATAAGGCTGG - Intronic
996465959 5:123803014-123803036 AGAAAATGGCAGAAGCAGGAAGG + Intergenic
998234449 5:140386143-140386165 AGAAAATGGCAGAGGAAGCCGGG - Intergenic
998615523 5:143736102-143736124 AGATTGAGGCAGAAGGAGGCAGG - Intergenic
998858665 5:146421473-146421495 AGATATTGGCATAAGAACGAAGG + Intergenic
999789172 5:154922449-154922471 AGATATAGGCTAAAGTAGGCCGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001529227 5:172450863-172450885 AGATGCTGGCAGAGAAAGGCAGG + Intronic
1001884533 5:175277525-175277547 AAGGATTGGCAGAAGAAGGCAGG - Intergenic
1002819048 6:706784-706806 AGGCAGTGGCAGATGAAGGCAGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003264326 6:4552170-4552192 AGATTTTTGCAGAAGGAAGCAGG - Intergenic
1003717254 6:8661156-8661178 AGTTATTGGCAGTAAAATGCGGG - Intergenic
1004079890 6:12381875-12381897 AGAGATGGGTAAAAGAAGGCAGG + Intergenic
1004611268 6:17242300-17242322 AGCTATTTGCAAAAGAAAGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005214975 6:23515247-23515269 AGATATTACCAGAAGGATGCTGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006049347 6:31329508-31329530 TGATACTAGCAGAAAAAGGCAGG - Intronic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006641198 6:35490713-35490735 GGATCTAGGGAGAAGAAGGCGGG - Intronic
1007074990 6:39060646-39060668 AGGCATTGGCAGAAGATGGAAGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008458289 6:51737886-51737908 AAATATTGGCAGGAGAATGAGGG + Intronic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010397017 6:75404342-75404364 AGATCTTGGGAGAAGTGGGCAGG - Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011097575 6:83683190-83683212 AGAGATTGGGGGAAGAAGGAAGG - Intronic
1012001905 6:93664421-93664443 AGATATTTGCAGAAGATAGTAGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013067804 6:106700421-106700443 AGAAAATGGCAGAAGCAGGAAGG + Intergenic
1013596428 6:111664754-111664776 AGGTCTGGGCAGAAGAAAGCAGG - Intronic
1013706354 6:112839555-112839577 AGAGCTTAGCAGAAGAAAGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015023438 6:128504665-128504687 AGATATTGCCAGAAGAACCCAGG - Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016846621 6:148574452-148574474 AGTTGTTGGAAGAAGCAGGCAGG + Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018186132 6:161266318-161266340 AGAGATGGGCACAAGAAGTCAGG - Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021238909 7:18176920-18176942 AGAAATTAGCAGAAAAATGCAGG + Intronic
1021968524 7:25945543-25945565 ATATTCTGGCAGCAGAAGGCAGG - Intergenic
1022545893 7:31188583-31188605 AGATGTTGGCAGCAGCAGCCTGG - Intergenic
1023155875 7:37251503-37251525 AGATTTTGTCACAACAAGGCTGG - Intronic
1023174397 7:37421792-37421814 AGACTTCGGCAGAAGAGGGCTGG + Intronic
1023206783 7:37759373-37759395 AGATATTCTCAGAAAAAGGCTGG + Intronic
1023397055 7:39761064-39761086 TGATATTAGCTGAAAAAGGCAGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024265057 7:47600103-47600125 AGAGCTGGGTAGAAGAAGGCGGG + Intergenic
1025791811 7:64694970-64694992 AGATATAGGCTGAAGAAAGTGGG - Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030352084 7:108500951-108500973 AGATGGTGGCAGTGGAAGGCAGG - Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031437190 7:121747255-121747277 AGATATCAGCAGCAGAAGGTTGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1034351261 7:150416293-150416315 AGAAAATGGCAGAAGCAGGAAGG + Intergenic
1034460016 7:151192981-151193003 AGATATGTGCAGCAGCAGGCTGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037652985 8:20856752-20856774 AAATATTGGCAGACTGAGGCAGG - Intergenic
1041916570 8:63145059-63145081 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042414079 8:68499365-68499387 AGATTTTGCCAGGAGAAGCCAGG - Intronic
1043291950 8:78613048-78613070 GGAAACTGGCAGAAGCAGGCAGG - Intergenic
1043856892 8:85274592-85274614 ACTTATTAGCAGAAGAAGGTGGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044513669 8:93113479-93113501 AGAAAATTGCAGAAGTAGGCTGG - Intergenic
1045064646 8:98434714-98434736 AGAGAAGGGGAGAAGAAGGCTGG + Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046744571 8:117862988-117863010 AGGTGTTGGCAGAGGAAGGAAGG + Intronic
1047422507 8:124718680-124718702 AGATATTTGCAGAAGGAGGCTGG - Intronic
1047698106 8:127423300-127423322 AGATGTTGGGAGAAGCAGTCAGG + Intergenic
1048794592 8:138138162-138138184 AGGGCTTGGCAGAAGAAGGTGGG - Intronic
1049274733 8:141714495-141714517 AGAAATTGGCAGAAAGAGGAAGG + Intergenic
1049448760 8:142647022-142647044 AGGTATAGGCAGAAAAAGCCTGG + Intergenic
1050291127 9:4156243-4156265 AGATAATGGAGGAAGAAGGGAGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1055028112 9:71744076-71744098 AGAATATGGCACAAGAAGGCTGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056810760 9:89762188-89762210 ATATATTAGAAGAAGCAGGCTGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058865426 9:109157623-109157645 AGATATAGGGAGACCAAGGCAGG - Intronic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059301036 9:113313765-113313787 AGATAGTGGGAGAGGAAGCCCGG - Exonic
1061192086 9:129087932-129087954 AGATTTTGGTAAATGAAGGCAGG - Intronic
1061459922 9:130729340-130729362 AGAGGTAGGCAGAAGAAGGTGGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062165018 9:135103328-135103350 AGGTCTTGGCAGAAGCAGTCTGG + Intronic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186781735 X:12919075-12919097 AGATATTAGCAGGAAAATGCAGG - Exonic
1186900009 X:14043927-14043949 AGAAAATGGCAGAAGCAGGAAGG - Intergenic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189118992 X:38373867-38373889 AGAAATTAGCAGAAGAGGCCGGG + Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189260164 X:39672886-39672908 AGCTGTTGGCAGAAGGAGTCAGG - Intergenic
1190980893 X:55455907-55455929 AGATAAAGGCTGAAGAAGGGCGG + Intergenic
1190987804 X:55517273-55517295 AGATAAAGGCTGAAGAAGGGCGG - Intergenic
1191616044 X:63169987-63170009 AGAAATTGGAACAAGAATGCTGG + Intergenic
1191620254 X:63208936-63208958 AGAAATTGGAACAAGAATGCTGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1194915036 X:99695837-99695859 AGATACAGGCTGATGAAGGCTGG - Intergenic
1195314069 X:103660636-103660658 AGATATTTCCAGAAAAAGGGTGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197416241 X:126177000-126177022 AGATGCTGGCAGGACAAGGCTGG - Intergenic
1198613219 X:138425169-138425191 TGATAGGGGCAGAAGAGGGCAGG + Intergenic
1198820297 X:140640127-140640149 AAACATGGGCAGAGGAAGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199540247 X:148950538-148950560 AGATATGGGGATAAGAAGGAGGG - Intronic
1199597879 X:149522435-149522457 AGAGATTGGCAGAGGCAGGAAGG - Intronic
1200337447 X:155365151-155365173 AGGAACTTGCAGAAGAAGGCAGG + Intergenic
1200349023 X:155476076-155476098 AGGAACTTGCAGAAGAAGGCAGG - Intergenic
1200761107 Y:7039903-7039925 AGAAAATGTCAGAAGCAGGCAGG - Intronic
1200955053 Y:8936480-8936502 AGATATTGGGAAAAGGATGCTGG + Intergenic
1202233186 Y:22677718-22677740 AGATACTGGGAAAAGAATGCTGG + Intergenic
1202309970 Y:23518440-23518462 AGATACTGGGAAAAGAATGCTGG - Intergenic
1202560831 Y:26152153-26152175 AGATACTGGGAAAAGAATGCTGG + Intergenic