ID: 932140455

View in Genome Browser
Species Human (GRCh38)
Location 2:69272942-69272964
Sequence CTCCCTGAGGGTGTGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932140455_932140463 8 Left 932140455 2:69272942-69272964 CCACTCAACACACCCTCAGGGAG No data
Right 932140463 2:69272973-69272995 CTGGAGGGCGCTCTCTGGTGCGG No data
932140455_932140460 -7 Left 932140455 2:69272942-69272964 CCACTCAACACACCCTCAGGGAG No data
Right 932140460 2:69272958-69272980 CAGGGAGTCAGCCTACTGGAGGG No data
932140455_932140467 29 Left 932140455 2:69272942-69272964 CCACTCAACACACCCTCAGGGAG No data
Right 932140467 2:69272994-69273016 GGCCAGGACAGAGGGATATGTGG No data
932140455_932140465 20 Left 932140455 2:69272942-69272964 CCACTCAACACACCCTCAGGGAG No data
Right 932140465 2:69272985-69273007 CTCTGGTGCGGCCAGGACAGAGG No data
932140455_932140466 21 Left 932140455 2:69272942-69272964 CCACTCAACACACCCTCAGGGAG No data
Right 932140466 2:69272986-69273008 TCTGGTGCGGCCAGGACAGAGGG No data
932140455_932140461 3 Left 932140455 2:69272942-69272964 CCACTCAACACACCCTCAGGGAG No data
Right 932140461 2:69272968-69272990 GCCTACTGGAGGGCGCTCTCTGG No data
932140455_932140459 -8 Left 932140455 2:69272942-69272964 CCACTCAACACACCCTCAGGGAG No data
Right 932140459 2:69272957-69272979 TCAGGGAGTCAGCCTACTGGAGG No data
932140455_932140464 13 Left 932140455 2:69272942-69272964 CCACTCAACACACCCTCAGGGAG No data
Right 932140464 2:69272978-69273000 GGGCGCTCTCTGGTGCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932140455 Original CRISPR CTCCCTGAGGGTGTGTTGAG TGG (reversed) Intergenic
No off target data available for this crispr