ID: 932141150

View in Genome Browser
Species Human (GRCh38)
Location 2:69279377-69279399
Sequence TTCTAAGAGCAGTGACTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 2, 1: 0, 2: 1, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932141149_932141150 -3 Left 932141149 2:69279357-69279379 CCAGACAGTAATCTGTGTTATTC No data
Right 932141150 2:69279377-69279399 TTCTAAGAGCAGTGACTATATGG 0: 2
1: 0
2: 1
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932141150 Original CRISPR TTCTAAGAGCAGTGACTATA TGG Intergenic
900729682 1:4247408-4247430 TTCTAATTGCAGTGAATCTATGG + Intergenic
907167524 1:52427616-52427638 TTCTAAGATCAGAGGATATATGG - Intronic
908531994 1:65042672-65042694 TTCTGAGAGCACTGACTCAACGG + Intergenic
908686546 1:66726308-66726330 TTCTCAGAGCAGTCAGTAAAGGG + Intronic
911942062 1:104059105-104059127 TTCTAATAGCAGTAACCACATGG - Intergenic
912333192 1:108838028-108838050 TTCTAAGAACTGTGATTCTATGG + Intronic
914356418 1:146888308-146888330 GTCTTGGAGCAGTGACTATGGGG - Intergenic
915606576 1:156955691-156955713 TTCTCAAAGCAGTGAGTATTTGG - Exonic
918679216 1:187330656-187330678 TTCTATGACCAGTGACTATCTGG + Intergenic
921050643 1:211508940-211508962 TTCCAAGAGGAGGGATTATAGGG + Intergenic
921270360 1:213463258-213463280 TTCTAAGAGCACAGACTCTGGGG + Intergenic
921576174 1:216837497-216837519 GTCTAATAGCTGTGACTATGGGG + Intronic
921664228 1:217848108-217848130 TTCTAAGAACAGTAAATATTTGG + Intronic
922064931 1:222127434-222127456 TTCTCAGAACAGTGCCTACAGGG + Intergenic
923424258 1:233853301-233853323 TTGGAAGGGCAGGGACTATATGG + Intergenic
1062986666 10:1775486-1775508 TTCTTAGGGCATTGACTATTAGG - Intergenic
1065188087 10:23188503-23188525 TTCTAGGAACAATGACTAGAGGG - Intergenic
1065227593 10:23560705-23560727 CTCTAGGAGCTGGGACTATAGGG - Intergenic
1068366109 10:56052108-56052130 TTCTAAGGGCAGCCACTATGAGG + Intergenic
1070186679 10:74070264-74070286 TTTTAATAGCAGTGTGTATAGGG + Intronic
1074366374 10:112860752-112860774 TTGTAAGCGCAGTGATTATTGGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1083247086 11:61437094-61437116 TTCTAATTGCAGTTACTATTTGG + Intronic
1085066178 11:73498098-73498120 AGCTAAGAGCAGTGACTCTGGGG + Intronic
1085671527 11:78469007-78469029 TTGGAATAGCAGTGACTAAAGGG - Intronic
1090589150 11:128246679-128246701 TTCCAAGAGCAGTGAGAATCCGG - Intergenic
1091992949 12:4971546-4971568 TTCTAATAGCATTGCCTATCTGG - Intergenic
1092490818 12:8943337-8943359 TTTTAAGGTCAGTAACTATATGG - Intronic
1096789386 12:54035478-54035500 TTCTAGGGGCAGTGAGTAGAGGG + Intronic
1097570235 12:61323231-61323253 TTCTAACAGTGGTGACTATCTGG + Intergenic
1097579638 12:61438979-61439001 CTCTAGAAGCAGTGACCATATGG + Intergenic
1097623038 12:61964687-61964709 TTTAAAGAGCTCTGACTATAGGG + Intronic
1099604395 12:84783655-84783677 TTCTTAGTCCAGTGACTAGATGG + Intergenic
1099614912 12:84921779-84921801 TTCTACGGGAAGTGACTTTAAGG - Intergenic
1101639614 12:106578626-106578648 TTCTAGGACCAGTGACTACGTGG + Intronic
1102219608 12:111185740-111185762 TTAGAAGAGCTGTGACTGTAGGG - Intronic
1102382068 12:112475218-112475240 TGCTAAGAACAGTGACTTTGGGG - Intronic
1104137225 12:125952192-125952214 TTCCAAGAGGCGTGACTATGAGG + Intergenic
1107388921 13:39942929-39942951 TTCTGACAGCAGTCACTAGAGGG + Intergenic
1108205982 13:48090982-48091004 TTGTTACAGCAGAGACTATATGG + Intronic
1108420330 13:50242493-50242515 TTCCAAGGGCAGTGATCATATGG + Intronic
1108676939 13:52745286-52745308 TTATAAGAGCAGCGACCATTTGG + Intergenic
1109199557 13:59414980-59415002 TTTTAAAAGCAGTAACTAAAAGG - Intergenic
1109984859 13:69966814-69966836 TGCTAAAAGCTGTGATTATATGG - Intronic
1110987407 13:81987807-81987829 TCCTAAGAGCATTTACTTTAGGG + Intergenic
1112104830 13:96229532-96229554 TTTTAAGAGCAGACACTAGAGGG - Intronic
1112772036 13:102802035-102802057 TTCTAAGAGCAGAGGCTTTCAGG + Intronic
1115950936 14:38720437-38720459 TTCTAAGACCATTTACTACAAGG + Intergenic
1118358885 14:65039177-65039199 TTCTCAAAGCAGTGTCTGTAGGG + Intronic
1119741861 14:77018874-77018896 TTCTATGAGGAGTGATGATAAGG - Intergenic
1120410728 14:84152282-84152304 ATCTAAGAGCAGTGACAAGGAGG + Intergenic
1120670953 14:87361958-87361980 TTCAAATAACAGTCACTATAAGG - Intergenic
1123834810 15:24178390-24178412 TTATAAGAGGAGTTTCTATAAGG + Intergenic
1123870529 15:24567237-24567259 TTATAAGAGGAGTTTCTATAAGG + Intergenic
1124397430 15:29315977-29315999 ATCTAAGAGTAGTTACTATAGGG + Intronic
1124969948 15:34478200-34478222 TTCTTAGAGTTGTGACTCTAAGG - Intergenic
1125558688 15:40608826-40608848 TCCTAAGGGCAGAGAATATATGG - Exonic
1130156078 15:81351234-81351256 GTCCTAGAGCATTGACTATAAGG - Intronic
1130830240 15:87591756-87591778 TTCTAATATCAGTGGCCATAGGG - Intergenic
1131415832 15:92256799-92256821 TTCTTTGAGCAGTGGTTATATGG - Intergenic
1131664404 15:94555229-94555251 CTCTAAGAGTAGTGAGTAAAGGG + Intergenic
1132189371 15:99837556-99837578 TTCTTAGAGTTGTGACTATAAGG + Intergenic
1139977598 16:70827155-70827177 GTCTTGGAGCAGTGACTATGGGG + Intronic
1144460447 17:15454419-15454441 TTCTCATGCCAGTGACTATACGG - Intronic
1146064031 17:29621555-29621577 TTCTAGGACCAGACACTATATGG - Intronic
1149003603 17:51781750-51781772 TTCTAACAGCAAAGTCTATATGG - Intronic
1151808181 17:76419804-76419826 TGCTCAGAGCTGTGACTAGAAGG + Intronic
1157760449 18:50259952-50259974 TTCTAAGAGCTGTAGCTCTAGGG + Intronic
1157779888 18:50428864-50428886 GTTTAAGAGCAGAGACCATAGGG - Intergenic
1158466418 18:57694207-57694229 TTCTAAGAGAACTGCCTCTATGG + Intronic
1159017919 18:63116897-63116919 TTCATAGAGCAATGCCTATAAGG + Intergenic
1163461174 19:17438533-17438555 TTCTAAGAGCAATGAGTAGGGGG + Intronic
1165171941 19:33899481-33899503 TTCTAGGAGCAGTGATTTAAAGG - Intergenic
1165383666 19:35497843-35497865 TTCTCAGAGCTGTGCCTATGTGG + Intronic
925483670 2:4304295-4304317 TTCTGGGAGCAGTGCCTCTAGGG + Intergenic
927887829 2:26729302-26729324 TTCTAAGGGCAGTGTCTGGAAGG - Exonic
929078629 2:38099373-38099395 ACCTAAGAGCAGTGACTCTCTGG + Intronic
930719651 2:54626840-54626862 TGCTAAGAGCAGTCAATAAATGG - Intronic
932024763 2:68121722-68121744 TTTTAAAAACAGTGGCTATATGG + Intergenic
932141150 2:69279377-69279399 TTCTAAGAGCAGTGACTATATGG + Intergenic
932962228 2:76426705-76426727 TTGTAAGAGCATAGACTATAAGG - Intergenic
936668503 2:114627688-114627710 TTCAAAGAACACTGACTACAAGG + Intronic
937727414 2:125183764-125183786 TTCTAATTGCAATGACAATAGGG - Intergenic
938997056 2:136691329-136691351 TTTAAAGAGCAGTGAATAGAGGG + Intergenic
939724916 2:145706199-145706221 TTCTAACAAGAGTGACAATATGG + Intergenic
943838039 2:192540624-192540646 TTCTTAGAGAAGTGACTATGTGG - Intergenic
943902789 2:193462765-193462787 TTCTACCAGCAGTTACTTTAAGG - Intergenic
943966576 2:194341785-194341807 TTGTATGAGCAGTGACTTTAAGG + Intergenic
944789113 2:203105738-203105760 ATCTTAAAGCAGTGCCTATAGGG - Intronic
944993508 2:205266916-205266938 TTTTAACAGCCCTGACTATAGGG - Intronic
945414304 2:209552512-209552534 TTTTAAAAGAAGAGACTATATGG - Intronic
946364098 2:219237825-219237847 GTCTAACAGCAGTGACTTCAAGG - Exonic
946505233 2:220293134-220293156 TTATAAGAGCAGTGGCAAGAGGG - Intergenic
946977573 2:225170254-225170276 TTCTAAGAGCAGTGGCTCCAAGG + Intergenic
947112951 2:226739115-226739137 TTCAAAGAGCAGGGAATAAAAGG + Intronic
947698795 2:232215587-232215609 GTCTAGGAGCAGTGCCTGTAAGG + Intronic
1171144230 20:22767587-22767609 TTCTGAGACCACTGACTATTTGG + Intergenic
1172689074 20:36778168-36778190 TTCCAAGAGGAGCGACTATAGGG + Exonic
1172945931 20:38689187-38689209 TTTTAAGAACTGTGTCTATATGG + Intergenic
1175150916 20:56933411-56933433 TTGTTGGAACAGTGACTATATGG - Intergenic
1180010124 21:45043866-45043888 TTCCAAGAGCAGGGACAACATGG + Intergenic
949340886 3:3029663-3029685 TGTTAAGAACAGGGACTATATGG + Intronic
950831985 3:15883951-15883973 TTCTTAGAGCAGAGATGATAAGG - Intergenic
951429053 3:22584914-22584936 TATTAACAGCAGTGAATATAAGG - Intergenic
958466749 3:94469479-94469501 CTAAAAGAGCACTGACTATAAGG - Intergenic
959687152 3:109159870-109159892 TTCTACCAGCAGTCACTCTAGGG - Intergenic
960382364 3:116979690-116979712 TTGTAACACCATTGACTATAAGG + Intronic
962928604 3:140017470-140017492 TTCCATGAGCATTGACTATGTGG + Intronic
963971359 3:151432666-151432688 TACTGAGAGCAGTGACAAGAGGG + Intronic
970424115 4:15930696-15930718 ATCTAAGAGCAGTGAAGGTAGGG + Intergenic
970898036 4:21125838-21125860 TTCTAAGAGGAGATTCTATAAGG + Intronic
972596924 4:40537647-40537669 GTGTAAGAGCAGTGAGTTTAAGG - Intronic
973026468 4:45279438-45279460 TTTTAAGAGCAGTCATTAAATGG - Intergenic
976062354 4:81143652-81143674 TTCTAAGAATTTTGACTATATGG + Intronic
978006101 4:103619124-103619146 GTCTTTGAGCAGAGACTATAGGG + Intronic
979560644 4:122097739-122097761 GTATAAGAGCAGTGGGTATATGG - Intergenic
982178359 4:152727725-152727747 TTCAATGAGCATTTACTATAGGG - Intronic
983004726 4:162469744-162469766 TTCTTAGAGAGGTGACTATGAGG + Intergenic
990350660 5:54912319-54912341 CTGTAGGAGGAGTGACTATATGG - Intergenic
994002220 5:94793518-94793540 TGCTAAGAGCACTGAATATGTGG + Intronic
995319887 5:110822378-110822400 TTCAAAGAGTAGAGACTATGTGG - Intergenic
995890408 5:116944747-116944769 TTCAAAGATCATTGACAATAAGG + Intergenic
1003042759 6:2703112-2703134 TCCTAAGACCAGTAACTATAGGG + Intronic
1003475462 6:6478064-6478086 CTCTAAGGGCAGCCACTATAAGG + Intergenic
1004428183 6:15520466-15520488 TTTTTAAAACAGTGACTATACGG - Exonic
1012239421 6:96855283-96855305 TTCAAAGAGGATTAACTATAAGG - Intergenic
1013493235 6:110671082-110671104 TTTGAAGAGTAGTGAGTATAAGG + Intronic
1013646505 6:112146962-112146984 TTCTAAGAGAATTGATTGTAGGG - Intronic
1015941535 6:138457633-138457655 TACAAAGAGCAGTGACTATATGG - Intronic
1016085169 6:139904542-139904564 TTCTAAAAACAGTGGCTTTAAGG + Intergenic
1017132046 6:151115683-151115705 TGCCATGAGCAGTGTCTATACGG - Intergenic
1017237626 6:152133139-152133161 TTGTAAGAGCAGTGGCTGAAAGG + Intronic
1017301382 6:152863529-152863551 TTCTTGGCGCAGTGACTAGATGG + Intergenic
1021176175 7:17452151-17452173 ACCTAAGAGCAGAGACTGTAGGG - Intergenic
1022445207 7:30464721-30464743 TTATAAGATCACTGATTATAAGG + Intronic
1023257610 7:38327591-38327613 TTCTAGGAGCCAGGACTATAAGG + Intergenic
1037517655 8:19649304-19649326 TTCTAAGAGTAGTCACTCTAAGG + Intronic
1038507682 8:28099677-28099699 TTTTAAGATCTGTGACTATCAGG - Intronic
1038854842 8:31320002-31320024 TTCTTAGAGTAGAGACTCTAGGG + Intergenic
1040620527 8:49086817-49086839 TTCTAACAGCAATAACTACATGG - Intergenic
1041340103 8:56836178-56836200 TTGTAGAAGCATTGACTATATGG + Intergenic
1042808880 8:72802317-72802339 TTCTAAGAGCAGTGACTATATGG - Intronic
1045127967 8:99114843-99114865 TTCTAAGAGACTTGACTTTATGG + Intronic
1047276937 8:123412971-123412993 TTCTTAGAGCATTTACTAAAAGG + Intronic
1048655958 8:136536121-136536143 CTCTAAGGGCAGCCACTATAAGG + Intergenic
1048755017 8:137728775-137728797 TTATAAGAGCACTGATAATAAGG - Intergenic
1050515386 9:6438136-6438158 TTCTAAGAGCTTTTACAATATGG - Intronic
1050790963 9:9469340-9469362 TTCTAGGAGCAATGATTTTAAGG + Intronic
1051205093 9:14679718-14679740 TTTTAAAAGCATTTACTATAAGG - Intronic
1052680161 9:31680902-31680924 TTCAAAGGGCTGTGACTAAAAGG + Intergenic
1053469257 9:38334309-38334331 TTCTGAGAGCAGGGACCACATGG - Intergenic
1053554759 9:39124292-39124314 TTCTAGGAGAAGTGAGGATATGG + Intronic
1053818877 9:41944550-41944572 TTCTAGGAGAAGTGAGGATATGG + Intronic
1054109145 9:61088202-61088224 TTCTAGGAGAAGTGAGGATATGG + Intergenic
1054611712 9:67242923-67242945 TTCTAGGAGAAGTGAGGATATGG - Intergenic
1054750615 9:68901792-68901814 TTCTAAGACCAGAGAGTAGAAGG - Intronic
1055659340 9:78486761-78486783 TTCTAATAGCTGTGACTTTCTGG + Intergenic
1055804970 9:80082444-80082466 TTCTAAAAGCAGTGGCTGTAAGG - Intergenic
1059072871 9:111157650-111157672 TTCTAACAGCAGTGTATAAAAGG - Intergenic
1061399663 9:130361512-130361534 TTCTAAGAGCAGTGGGTAGCTGG + Intronic
1061945667 9:133907133-133907155 TGCCAAGAGCAGTGACGACAGGG + Intronic
1185646420 X:1618912-1618934 TTGGAAGAGCAGTCACTTTAAGG + Intronic
1187249752 X:17586211-17586233 GTCTGAGAGCAGTGACAATGAGG + Intronic
1187843394 X:23511359-23511381 TGCTAAGAGCTGTGACTCTTTGG - Intergenic
1187894579 X:23968380-23968402 TTCCAAGAGCAGTAAATAAAGGG + Intergenic
1188142550 X:26569636-26569658 TCCCAAGAGAAGTAACTATATGG - Intergenic
1188245509 X:27832019-27832041 TTCCTAGAGCAGTGACTTCAAGG + Intergenic
1188314064 X:28652183-28652205 TTCTAAGGGCAGTGATTAAGAGG + Intronic
1190948626 X:55120434-55120456 TTCTCTGAGGAGTGACTTTAGGG - Intronic
1192350871 X:70355243-70355265 TTCCAAGAGGAGAGACTATAGGG + Intronic
1193130755 X:77917174-77917196 TGATAAGAGCATGGACTATATGG + Intronic
1194089354 X:89565928-89565950 CTCTAAGGGCAGCCACTATAAGG - Intergenic
1194267683 X:91775819-91775841 TTCTCTGAACAGAGACTATAAGG + Intergenic
1194524596 X:94963758-94963780 TTATAAAATCAGTAACTATAAGG + Intergenic
1195170025 X:102258347-102258369 TAATAAGAGCAGGGACTACAGGG - Intergenic
1195188832 X:102428753-102428775 TAATAAGAGCAGGGACTACAGGG + Intronic
1196900553 X:120378786-120378808 TTCTGACAGCAATGACTAAAGGG - Intronic
1197027946 X:121778114-121778136 TTCTAAGAGCAGTGAGACAAAGG - Intergenic
1198440202 X:136655865-136655887 TTCTAAGGGCAGAGACTGTGTGG - Intronic
1200442015 Y:3221975-3221997 CTCTAAGGGCAGCCACTATAAGG - Intergenic
1200584891 Y:4996746-4996768 TTCTCTGAACAGAGACTATAAGG + Intergenic