ID: 932142012

View in Genome Browser
Species Human (GRCh38)
Location 2:69287392-69287414
Sequence ATGTGGGTAGGGAGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932142012_932142020 -6 Left 932142012 2:69287392-69287414 CCCTGTTCCCTCCCTACCCACAT No data
Right 932142020 2:69287409-69287431 CCACATCTCCATACTTTTTATGG No data
932142012_932142021 -2 Left 932142012 2:69287392-69287414 CCCTGTTCCCTCCCTACCCACAT No data
Right 932142021 2:69287413-69287435 ATCTCCATACTTTTTATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932142012 Original CRISPR ATGTGGGTAGGGAGGGAACA GGG (reversed) Intergenic
No off target data available for this crispr