ID: 932142020 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:69287409-69287431 |
| Sequence | CCACATCTCCATACTTTTTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 932142011_932142020 | 27 | Left | 932142011 | 2:69287359-69287381 | CCTAAGCTGCAAGCTTCTTGAAG | No data | ||
| Right | 932142020 | 2:69287409-69287431 | CCACATCTCCATACTTTTTATGG | No data | ||||
| 932142013_932142020 | -7 | Left | 932142013 | 2:69287393-69287415 | CCTGTTCCCTCCCTACCCACATC | No data | ||
| Right | 932142020 | 2:69287409-69287431 | CCACATCTCCATACTTTTTATGG | No data | ||||
| 932142012_932142020 | -6 | Left | 932142012 | 2:69287392-69287414 | CCCTGTTCCCTCCCTACCCACAT | No data | ||
| Right | 932142020 | 2:69287409-69287431 | CCACATCTCCATACTTTTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 932142020 | Original CRISPR | CCACATCTCCATACTTTTTA TGG | Intergenic | ||
| No off target data available for this crispr | |||||