ID: 932142020

View in Genome Browser
Species Human (GRCh38)
Location 2:69287409-69287431
Sequence CCACATCTCCATACTTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932142011_932142020 27 Left 932142011 2:69287359-69287381 CCTAAGCTGCAAGCTTCTTGAAG No data
Right 932142020 2:69287409-69287431 CCACATCTCCATACTTTTTATGG No data
932142013_932142020 -7 Left 932142013 2:69287393-69287415 CCTGTTCCCTCCCTACCCACATC No data
Right 932142020 2:69287409-69287431 CCACATCTCCATACTTTTTATGG No data
932142012_932142020 -6 Left 932142012 2:69287392-69287414 CCCTGTTCCCTCCCTACCCACAT No data
Right 932142020 2:69287409-69287431 CCACATCTCCATACTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932142020 Original CRISPR CCACATCTCCATACTTTTTA TGG Intergenic
No off target data available for this crispr