ID: 932142021

View in Genome Browser
Species Human (GRCh38)
Location 2:69287413-69287435
Sequence ATCTCCATACTTTTTATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932142014_932142021 -9 Left 932142014 2:69287399-69287421 CCCTCCCTACCCACATCTCCATA No data
Right 932142021 2:69287413-69287435 ATCTCCATACTTTTTATGGTTGG No data
932142013_932142021 -3 Left 932142013 2:69287393-69287415 CCTGTTCCCTCCCTACCCACATC No data
Right 932142021 2:69287413-69287435 ATCTCCATACTTTTTATGGTTGG No data
932142012_932142021 -2 Left 932142012 2:69287392-69287414 CCCTGTTCCCTCCCTACCCACAT No data
Right 932142021 2:69287413-69287435 ATCTCCATACTTTTTATGGTTGG No data
932142015_932142021 -10 Left 932142015 2:69287400-69287422 CCTCCCTACCCACATCTCCATAC No data
Right 932142021 2:69287413-69287435 ATCTCCATACTTTTTATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932142021 Original CRISPR ATCTCCATACTTTTTATGGT TGG Intergenic
No off target data available for this crispr