ID: 932142224

View in Genome Browser
Species Human (GRCh38)
Location 2:69290012-69290034
Sequence AAATTCCAAAATACAGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932142224_932142229 11 Left 932142224 2:69290012-69290034 CCAAGACCTGTATTTTGGAATTT No data
Right 932142229 2:69290046-69290068 TTGCTTTTTTTAGGGACTGGTGG No data
932142224_932142226 2 Left 932142224 2:69290012-69290034 CCAAGACCTGTATTTTGGAATTT No data
Right 932142226 2:69290037-69290059 TACTTTGAGTTGCTTTTTTTAGG No data
932142224_932142228 8 Left 932142224 2:69290012-69290034 CCAAGACCTGTATTTTGGAATTT No data
Right 932142228 2:69290043-69290065 GAGTTGCTTTTTTTAGGGACTGG No data
932142224_932142227 3 Left 932142224 2:69290012-69290034 CCAAGACCTGTATTTTGGAATTT No data
Right 932142227 2:69290038-69290060 ACTTTGAGTTGCTTTTTTTAGGG No data
932142224_932142230 14 Left 932142224 2:69290012-69290034 CCAAGACCTGTATTTTGGAATTT No data
Right 932142230 2:69290049-69290071 CTTTTTTTAGGGACTGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932142224 Original CRISPR AAATTCCAAAATACAGGTCT TGG (reversed) Intergenic