ID: 932142228

View in Genome Browser
Species Human (GRCh38)
Location 2:69290043-69290065
Sequence GAGTTGCTTTTTTTAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932142224_932142228 8 Left 932142224 2:69290012-69290034 CCAAGACCTGTATTTTGGAATTT No data
Right 932142228 2:69290043-69290065 GAGTTGCTTTTTTTAGGGACTGG No data
932142225_932142228 2 Left 932142225 2:69290018-69290040 CCTGTATTTTGGAATTTTTTACT No data
Right 932142228 2:69290043-69290065 GAGTTGCTTTTTTTAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932142228 Original CRISPR GAGTTGCTTTTTTTAGGGAC TGG Intergenic