ID: 932142609

View in Genome Browser
Species Human (GRCh38)
Location 2:69293116-69293138
Sequence GTCCTCCAGGATCTCTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932142609_932142618 27 Left 932142609 2:69293116-69293138 CCAACACAGAGATCCTGGAGGAC No data
Right 932142618 2:69293166-69293188 CCTCACAATTACAATGCATTTGG No data
932142609_932142612 3 Left 932142609 2:69293116-69293138 CCAACACAGAGATCCTGGAGGAC No data
Right 932142612 2:69293142-69293164 TAATTACCCCATAAAGGCAAAGG No data
932142609_932142611 -3 Left 932142609 2:69293116-69293138 CCAACACAGAGATCCTGGAGGAC No data
Right 932142611 2:69293136-69293158 GACGAGTAATTACCCCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932142609 Original CRISPR GTCCTCCAGGATCTCTGTGT TGG (reversed) Intergenic
No off target data available for this crispr