ID: 932142744

View in Genome Browser
Species Human (GRCh38)
Location 2:69294110-69294132
Sequence TCACCCAAGAGGAGATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932142742_932142744 -2 Left 932142742 2:69294089-69294111 CCTCTGTCAGTGAAAAGATGATC No data
Right 932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG No data
932142740_932142744 25 Left 932142740 2:69294062-69294084 CCTTCACTCTCAGGTGGAGATCT No data
Right 932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG No data
932142738_932142744 27 Left 932142738 2:69294060-69294082 CCCCTTCACTCTCAGGTGGAGAT No data
Right 932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG No data
932142739_932142744 26 Left 932142739 2:69294061-69294083 CCCTTCACTCTCAGGTGGAGATC No data
Right 932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG No data
932142741_932142744 1 Left 932142741 2:69294086-69294108 CCTCCTCTGTCAGTGAAAAGATG No data
Right 932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932142744 Original CRISPR TCACCCAAGAGGAGATCAGC TGG Intergenic
No off target data available for this crispr