ID: 932143436

View in Genome Browser
Species Human (GRCh38)
Location 2:69298876-69298898
Sequence TTAATTAGAAGCAGCTCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932143436_932143437 2 Left 932143436 2:69298876-69298898 CCTACGGAGCTGCTTCTAATTAA No data
Right 932143437 2:69298901-69298923 GAATACAGCAAAATCATGCTTGG No data
932143436_932143439 4 Left 932143436 2:69298876-69298898 CCTACGGAGCTGCTTCTAATTAA No data
Right 932143439 2:69298903-69298925 ATACAGCAAAATCATGCTTGGGG No data
932143436_932143438 3 Left 932143436 2:69298876-69298898 CCTACGGAGCTGCTTCTAATTAA No data
Right 932143438 2:69298902-69298924 AATACAGCAAAATCATGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932143436 Original CRISPR TTAATTAGAAGCAGCTCCGT AGG (reversed) Intergenic
No off target data available for this crispr