ID: 932143848

View in Genome Browser
Species Human (GRCh38)
Location 2:69302036-69302058
Sequence GACACTGTAGTACCTAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932143841_932143848 30 Left 932143841 2:69301983-69302005 CCCTGGTTTTGTTTTGGTCTGCA No data
Right 932143848 2:69302036-69302058 GACACTGTAGTACCTAGGGCAGG No data
932143842_932143848 29 Left 932143842 2:69301984-69302006 CCTGGTTTTGTTTTGGTCTGCAC No data
Right 932143848 2:69302036-69302058 GACACTGTAGTACCTAGGGCAGG No data
932143843_932143848 2 Left 932143843 2:69302011-69302033 CCCAGCTAAATAACTCATTTCCT No data
Right 932143848 2:69302036-69302058 GACACTGTAGTACCTAGGGCAGG No data
932143844_932143848 1 Left 932143844 2:69302012-69302034 CCAGCTAAATAACTCATTTCCTA No data
Right 932143848 2:69302036-69302058 GACACTGTAGTACCTAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932143848 Original CRISPR GACACTGTAGTACCTAGGGC AGG Intergenic
No off target data available for this crispr