ID: 932144301

View in Genome Browser
Species Human (GRCh38)
Location 2:69305246-69305268
Sequence CTCCCAGGGTGGTGGCTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932144301_932144312 24 Left 932144301 2:69305246-69305268 CCTAGTAGCCACCACCCTGGGAG No data
Right 932144312 2:69305293-69305315 GCTTGTCCAAGCCTCCAGGACGG No data
932144301_932144311 20 Left 932144301 2:69305246-69305268 CCTAGTAGCCACCACCCTGGGAG No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932144301 Original CRISPR CTCCCAGGGTGGTGGCTACT AGG (reversed) Intergenic
No off target data available for this crispr