ID: 932144305

View in Genome Browser
Species Human (GRCh38)
Location 2:69305257-69305279
Sequence GTGCAGTCCACCTCCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932144305_932144311 9 Left 932144305 2:69305257-69305279 CCACCCTGGGAGGTGGACTGCAC No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data
932144305_932144312 13 Left 932144305 2:69305257-69305279 CCACCCTGGGAGGTGGACTGCAC No data
Right 932144312 2:69305293-69305315 GCTTGTCCAAGCCTCCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932144305 Original CRISPR GTGCAGTCCACCTCCCAGGG TGG (reversed) Intergenic
No off target data available for this crispr