ID: 932144311

View in Genome Browser
Species Human (GRCh38)
Location 2:69305289-69305311
Sequence CTGTGCTTGTCCAAGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932144300_932144311 21 Left 932144300 2:69305245-69305267 CCCTAGTAGCCACCACCCTGGGA No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data
932144301_932144311 20 Left 932144301 2:69305246-69305268 CCTAGTAGCCACCACCCTGGGAG No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data
932144306_932144311 6 Left 932144306 2:69305260-69305282 CCCTGGGAGGTGGACTGCACCTC No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data
932144307_932144311 5 Left 932144307 2:69305261-69305283 CCTGGGAGGTGGACTGCACCTCA No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data
932144305_932144311 9 Left 932144305 2:69305257-69305279 CCACCCTGGGAGGTGGACTGCAC No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data
932144304_932144311 12 Left 932144304 2:69305254-69305276 CCACCACCCTGGGAGGTGGACTG No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data
932144297_932144311 28 Left 932144297 2:69305238-69305260 CCTATGGCCCTAGTAGCCACCAC No data
Right 932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932144311 Original CRISPR CTGTGCTTGTCCAAGCCTCC AGG Intergenic
No off target data available for this crispr