ID: 932144723

View in Genome Browser
Species Human (GRCh38)
Location 2:69307181-69307203
Sequence CCCGGGACGGCTGTGCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932144714_932144723 -4 Left 932144714 2:69307162-69307184 CCTGCCCTCCAGACGGCGCCCCG No data
Right 932144723 2:69307181-69307203 CCCGGGACGGCTGTGCCCCCAGG No data
932144717_932144723 -8 Left 932144717 2:69307166-69307188 CCCTCCAGACGGCGCCCCGGGAC No data
Right 932144723 2:69307181-69307203 CCCGGGACGGCTGTGCCCCCAGG No data
932144713_932144723 -3 Left 932144713 2:69307161-69307183 CCCTGCCCTCCAGACGGCGCCCC No data
Right 932144723 2:69307181-69307203 CCCGGGACGGCTGTGCCCCCAGG No data
932144718_932144723 -9 Left 932144718 2:69307167-69307189 CCTCCAGACGGCGCCCCGGGACG No data
Right 932144723 2:69307181-69307203 CCCGGGACGGCTGTGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932144723 Original CRISPR CCCGGGACGGCTGTGCCCCC AGG Intergenic
No off target data available for this crispr