ID: 932144860

View in Genome Browser
Species Human (GRCh38)
Location 2:69307815-69307837
Sequence TGAACTACTTGGTAATTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932144860_932144865 -4 Left 932144860 2:69307815-69307837 CCAACCAATTACCAAGTAGTTCA No data
Right 932144865 2:69307834-69307856 TTCAGAAGTTCCAGGAGTCTGGG No data
932144860_932144864 -5 Left 932144860 2:69307815-69307837 CCAACCAATTACCAAGTAGTTCA No data
Right 932144864 2:69307833-69307855 GTTCAGAAGTTCCAGGAGTCTGG No data
932144860_932144866 5 Left 932144860 2:69307815-69307837 CCAACCAATTACCAAGTAGTTCA No data
Right 932144866 2:69307843-69307865 TCCAGGAGTCTGGGCCACTGTGG No data
932144860_932144870 30 Left 932144860 2:69307815-69307837 CCAACCAATTACCAAGTAGTTCA No data
Right 932144870 2:69307868-69307890 GTCGCCATCTTCTCCTGCTGAGG No data
932144860_932144868 8 Left 932144860 2:69307815-69307837 CCAACCAATTACCAAGTAGTTCA No data
Right 932144868 2:69307846-69307868 AGGAGTCTGGGCCACTGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932144860 Original CRISPR TGAACTACTTGGTAATTGGT TGG (reversed) Intergenic
No off target data available for this crispr