ID: 932152774

View in Genome Browser
Species Human (GRCh38)
Location 2:69387687-69387709
Sequence AAGAATTAGGTTGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 470}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932152769_932152774 8 Left 932152769 2:69387656-69387678 CCTGGGGAACATAAGGCTGAAAA 0: 1
1: 0
2: 3
3: 19
4: 205
Right 932152774 2:69387687-69387709 AAGAATTAGGTTGAGGTGGGAGG 0: 1
1: 0
2: 1
3: 48
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932152774 Original CRISPR AAGAATTAGGTTGAGGTGGG AGG Intergenic
901105185 1:6749938-6749960 AGGAGGAAGGTTGAGGTGGGAGG - Intergenic
901312519 1:8280334-8280356 AAAAATTAGGTTGAGCACGGTGG + Intergenic
903094793 1:20960648-20960670 AAGGCTGAGGTGGAGGTGGGAGG + Intronic
903138080 1:21322319-21322341 AAGCATTTGCTAGAGGTGGGTGG - Intronic
903255182 1:22092827-22092849 AAGAATTAGGTTTGGGAAGGTGG - Exonic
903678427 1:25081374-25081396 AAGAATTGGGTTGAGACAGGAGG + Intergenic
903914143 1:26750882-26750904 AAAAATTAGGTTGAAGTTGAAGG + Intronic
905150045 1:35920220-35920242 AGGAATAAGGGTAAGGTGGGGGG - Exonic
905632647 1:39527224-39527246 AGTAATTAGGCTGAGTTGGGTGG + Intergenic
905665161 1:39759193-39759215 AGTAATTAGGCTGAGTTGGGTGG - Exonic
905685523 1:39904845-39904867 AAAAATTAGGGGGAGGGGGGAGG - Intergenic
907859533 1:58338314-58338336 AAGAGTGAGGTGGAAGTGGGAGG - Intronic
908104040 1:60822932-60822954 AAGTATTATGTGGTGGTGGGAGG - Intergenic
908422911 1:63977053-63977075 AAGAATGAGAGTGAAGTGGGGGG + Intronic
909519001 1:76545806-76545828 AAAAATTAGCTGGATGTGGGGGG - Intronic
909618661 1:77642642-77642664 AAGTACTTGGTTGAGGTGGGAGG + Intronic
909883258 1:80907038-80907060 AAAGATTAGGCTGAGGTGGGCGG - Intergenic
910563133 1:88613900-88613922 AATTTATAGGTTGAGGTGGGAGG + Intergenic
911497001 1:98644082-98644104 AAGAATTAGGGTGAGGTATGGGG + Intergenic
911840002 1:102670158-102670180 AGTAATTAGGCTGAGGTGGGTGG + Intergenic
912164866 1:107031060-107031082 AAGAATGAGGATGAGGGAGGAGG - Intergenic
912524581 1:110271756-110271778 AAGAAGGGGGTTGAGGTGTGAGG + Intronic
913053354 1:115136099-115136121 AAGATATAGATTGAGGTAGGTGG + Intergenic
913079915 1:115374063-115374085 AAGAATTAGAATGAGGAGGTGGG - Intergenic
914795330 1:150915440-150915462 AATTGTTAGTTTGAGGTGGGTGG - Intergenic
914863949 1:151409721-151409743 AAGAAGAGGGCTGAGGTGGGAGG - Intronic
915173904 1:153998826-153998848 AGGCAGGAGGTTGAGGTGGGAGG - Intronic
915328179 1:155092073-155092095 AAGGACTAGGATGAGGGGGGCGG + Intergenic
915417441 1:155752829-155752851 AAGAGTTGGGTGGAGGTGGGGGG + Intronic
915894165 1:159798353-159798375 AAAAATTCGGTTGAGCTGGGAGG + Intergenic
916349585 1:163833848-163833870 AACAACTAGGGTGAGGTGTGTGG - Intergenic
916365303 1:164020222-164020244 AAGAATGAGGGGGAGGCGGGTGG + Intergenic
916692965 1:167208810-167208832 GAGAAGTAGGGTGTGGTGGGAGG - Intergenic
917471069 1:175326413-175326435 GAGAGTTAAGTTGTGGTGGGAGG - Intronic
918398492 1:184140183-184140205 ACTCAGTAGGTTGAGGTGGGAGG - Intergenic
919248281 1:195017058-195017080 AATAATTGGGTTGAGCAGGGTGG - Intergenic
919644223 1:200077424-200077446 CACAATTAGGTTGGGCTGGGTGG + Intronic
920385961 1:205570054-205570076 CAGGAGTAGGATGAGGTGGGTGG - Intronic
920947371 1:210542249-210542271 AATAAATAGGTAGGGGTGGGAGG + Intronic
921113289 1:212060582-212060604 AAAAATTAGCTTGACGTGGTAGG + Intronic
921495518 1:215836186-215836208 AAGAATTATAGTTAGGTGGGTGG - Intronic
921553753 1:216571197-216571219 GATTATTAGGCTGAGGTGGGTGG + Intronic
922301628 1:224306586-224306608 ATGATTCAGGCTGAGGTGGGTGG + Intronic
923759872 1:236832304-236832326 ATGAAGTAGGATGAGATGGGAGG + Intronic
1063522542 10:6753882-6753904 AATAATGAGGATGATGTGGGCGG - Intergenic
1063991623 10:11571067-11571089 AAGAATTATTTTGGGGAGGGAGG - Intronic
1064001893 10:11670627-11670649 GAGAACTAGGATGAAGTGGGAGG - Intergenic
1064410499 10:15099848-15099870 CAGCATGAGGCTGAGGTGGGAGG + Intronic
1064450522 10:15438329-15438351 CAGACTTGGGCTGAGGTGGGAGG + Intergenic
1064457788 10:15504701-15504723 AAAAATTATGAGGAGGTGGGAGG - Intergenic
1064842765 10:19613533-19613555 AAGGATTAGGGTGGGGTTGGGGG - Intronic
1065232044 10:23608282-23608304 AAAAATTAGGTGGATGTGGTGGG + Intergenic
1066240731 10:33532265-33532287 AAGTAATAGGTAGTGGTGGGTGG - Intergenic
1067282189 10:44880970-44880992 AGGAGTCAGGGTGAGGTGGGCGG + Intergenic
1067750990 10:48970831-48970853 AAGGAAGTGGTTGAGGTGGGAGG + Intronic
1068138537 10:52975218-52975240 AAAAATTAGCTGGATGTGGGTGG - Intergenic
1069640540 10:69952676-69952698 GAGAATTTGGCTAAGGTGGGTGG - Intronic
1069850071 10:71398504-71398526 AAGAATTAGGTTGTGGGGTGTGG + Intronic
1070529379 10:77323382-77323404 AAGAGTGAGTTTGAAGTGGGGGG + Intronic
1072443943 10:95481414-95481436 AAGCATGAGATTGGGGTGGGTGG - Intronic
1072639685 10:97202484-97202506 AACCACTAGGCTGAGGTGGGAGG - Intronic
1072893325 10:99344338-99344360 AAAAAATAGGTGGGGGTGGGGGG + Intronic
1073492389 10:103861830-103861852 AAGACTTAGGATGGGGTGGGTGG + Intergenic
1073558233 10:104474097-104474119 AAGAATTGGGGTGAGCTGAGAGG - Intergenic
1074620882 10:115119837-115119859 AAAAATTAGGTTGAGGCAGAAGG - Intronic
1074642681 10:115405560-115405582 AAACATTATGTTGAGGTGAGAGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076083649 10:127606131-127606153 AAGAATTGTGTTGGGGTGGAGGG + Intergenic
1076461359 10:130649590-130649612 AAAGCTTGGGTTGAGGTGGGGGG - Intergenic
1076478569 10:130769165-130769187 AAGAATTTAGTTGAAGTGGATGG - Intergenic
1076656118 10:132024787-132024809 AAGAAATAGGAGGGGGTGGGTGG - Intergenic
1077822747 11:5765844-5765866 AAGGATTAAGATGAGGTGGGAGG - Intronic
1077875160 11:6298685-6298707 ATGAAGTAGGGTGAGGTTGGTGG - Intergenic
1078591184 11:12641513-12641535 ATGAATAGGGTTGGGGTGGGTGG - Intergenic
1079203202 11:18392900-18392922 ACCAATGTGGTTGAGGTGGGAGG - Intergenic
1080123589 11:28705132-28705154 AAGGGTGAGGTTCAGGTGGGAGG + Intergenic
1080321614 11:31016540-31016562 ATGACTTGGGTTGCGGTGGGTGG + Intronic
1081291460 11:41330678-41330700 AAGGCTGAGGCTGAGGTGGGAGG - Intronic
1081403331 11:42667790-42667812 AAGAGTGAGGTTCAGGTGGGCGG - Intergenic
1081489175 11:43554131-43554153 AAGTGTTGGGTTGAGGAGGGAGG + Intergenic
1081791617 11:45791684-45791706 AAGAATTTGGCTGAGTTGGAAGG + Intergenic
1083210588 11:61182683-61182705 ACGAGGAAGGTTGAGGTGGGAGG + Intergenic
1083371655 11:62187246-62187268 ACTAAAGAGGTTGAGGTGGGAGG - Intergenic
1083891196 11:65596545-65596567 AAGGATCAGGTGGGGGTGGGAGG + Intronic
1083974490 11:66106645-66106667 AAGAGGTAGGCTGAGGTGGGAGG + Intronic
1085623648 11:78055859-78055881 AAAAATTAGGCTGAGGTAAGTGG - Intronic
1086827552 11:91518314-91518336 AAGAAATAGATTAAGGTGGTTGG - Intergenic
1087713126 11:101577549-101577571 AAGAAAAAGGTTGTGGCGGGAGG + Intronic
1087740410 11:101880895-101880917 AATAATAAGTCTGAGGTGGGGGG - Intergenic
1087758018 11:102074809-102074831 AATCAGGAGGTTGAGGTGGGAGG - Intronic
1087873990 11:103333505-103333527 CATAAGGAGGTTGAGGTGGGAGG - Intronic
1088325373 11:108595394-108595416 AAGAAATAGGGGGTGGTGGGAGG + Intergenic
1088998915 11:115032369-115032391 AGGAATTATTTTGAGGTGTGTGG + Intergenic
1090265278 11:125349583-125349605 GAAAATGAGGTGGAGGTGGGTGG - Intronic
1090312076 11:125749890-125749912 AGGAATTAGGAAGAGGTTGGAGG - Intergenic
1092530327 12:9338795-9338817 AATCAGTAGGCTGAGGTGGGAGG - Intergenic
1092859500 12:12708240-12708262 AGGAAATAGGCCGAGGTGGGAGG - Intergenic
1093033607 12:14312215-14312237 AAAAATTATGTTGTGGTGGTAGG - Intergenic
1093311709 12:17595963-17595985 AAAAATTAGGTTGGGGATGGTGG - Intergenic
1094544990 12:31396311-31396333 AGGCATTATGCTGAGGTGGGTGG - Intronic
1094650323 12:32369723-32369745 AAAAATTTGGTAGAGGTCGGGGG - Intronic
1094700849 12:32869339-32869361 AAATATGAGGCTGAGGTGGGCGG + Intronic
1095275725 12:40280665-40280687 TATAATAAGGCTGAGGTGGGAGG + Intronic
1095582667 12:43818377-43818399 GAAAACTAGGTTAAGGTGGGTGG - Intergenic
1095700821 12:45189190-45189212 AAAGATCAGGCTGAGGTGGGAGG - Intergenic
1095724965 12:45441591-45441613 GAGAATGAGGTTGGGGTGGGAGG + Intergenic
1096284638 12:50287830-50287852 AGTACTTAGGTTGAGATGGGTGG + Intergenic
1096797126 12:54084959-54084981 AGGAATTAAGGCGAGGTGGGAGG + Intergenic
1096836895 12:54356906-54356928 AAGAATTGGGTGGAGGGGGGTGG + Intergenic
1096878374 12:54647880-54647902 AGGAAGGAGGTTGACGTGGGTGG + Intronic
1097020315 12:56016151-56016173 AAGAATTGGGTGGGGGTGGGGGG + Intronic
1097237806 12:57551591-57551613 AAAAACTAGCTTGAGGAGGGAGG + Intronic
1097789801 12:63803076-63803098 ACTCATGAGGTTGAGGTGGGAGG + Intronic
1098277559 12:68828463-68828485 GAGGCTGAGGTTGAGGTGGGAGG + Intronic
1098375642 12:69810675-69810697 AAAAGTTAGATTGGGGTGGGGGG + Intronic
1100096683 12:91047510-91047532 GAGAATTAGTTTTTGGTGGGTGG + Intergenic
1100136000 12:91554193-91554215 AAGAATTAGGCTGAGTGTGGTGG + Intergenic
1100441488 12:94621428-94621450 AAGAATGGGGTGGAGGTGGGAGG - Intronic
1100724689 12:97396168-97396190 AAGAATTAGCTGGGTGTGGGAGG + Intergenic
1101415632 12:104505860-104505882 AAAAAATAAGATGAGGTGGGAGG + Intronic
1101454356 12:104814274-104814296 ACTACTCAGGTTGAGGTGGGAGG + Intronic
1102075474 12:110056500-110056522 ACTCATTAGGTGGAGGTGGGAGG + Intronic
1102979257 12:117228518-117228540 AAAAATCAGGTTGGGGTGTGTGG + Intronic
1103523737 12:121553289-121553311 GAGAAGTGGGTGGAGGTGGGAGG - Intronic
1103910684 12:124350387-124350409 AAGAACTGGGCAGAGGTGGGAGG + Intronic
1104785788 12:131447251-131447273 AAGACTGAAGTTGGGGTGGGAGG + Intergenic
1104831353 12:131754094-131754116 AAGAATTAGCTTGTGATTGGGGG + Intronic
1105376326 13:19848523-19848545 AACAAAGAGGCTGAGGTGGGAGG - Intronic
1105792278 13:23813702-23813724 AAGATCTTGGCTGAGGTGGGAGG - Intronic
1106882682 13:34149067-34149089 AAGGAGTAGGTACAGGTGGGTGG - Intergenic
1107303247 13:38989609-38989631 AAGTGGGAGGTTGAGGTGGGAGG - Intronic
1107450507 13:40504511-40504533 AAGAATGCTGTTGAGATGGGTGG - Intergenic
1107552367 13:41488758-41488780 ACTCATTAGGCTGAGGTGGGAGG - Intergenic
1107894191 13:44942982-44943004 AAAAAATAGGTGGAGGAGGGAGG + Intronic
1107958304 13:45538727-45538749 AAGCATTAAGTGGAGGTTGGTGG + Intronic
1108395212 13:49985014-49985036 AAAAATTAGGGTGTGGTGGTGGG + Intergenic
1108556369 13:51597068-51597090 AAAAATTAAAGTGAGGTGGGAGG - Intronic
1109280919 13:60354411-60354433 AGGAATGAGGATGAGATGGGGGG + Intergenic
1109670822 13:65604393-65604415 AAAAATTAGCTTGATGTGGTGGG - Intergenic
1110293386 13:73834142-73834164 AATAAAGAGGTTGTGGTGGGGGG - Intronic
1110383907 13:74886060-74886082 AAGAATGTGGTGGTGGTGGGTGG + Intergenic
1112301441 13:98234207-98234229 AAGAATGAAGGTGAGGTGAGAGG - Intronic
1112486406 13:99824264-99824286 AAGGATTAGCTGGGGGTGGGTGG - Intronic
1113187681 13:107707987-107708009 AACAATTGGGGTGGGGTGGGGGG - Intronic
1114056680 14:18974847-18974869 AAAACTGAGGTTGAGGTTGGAGG - Intronic
1114366137 14:22028926-22028948 AAAAATTAGGTTTAGGTGTGTGG + Intergenic
1114832150 14:26157543-26157565 ACTCATGAGGTTGAGGTGGGAGG - Intergenic
1114834040 14:26181916-26181938 AAAAATTAGTTGGAGGTGAGGGG + Intergenic
1115226410 14:31107240-31107262 AAAAATTAGGTTGATCTTGGAGG - Exonic
1117659663 14:57990482-57990504 AAGAAATATGGTGAGGTGGAAGG + Intergenic
1118780333 14:69003652-69003674 ATGACTTAGGTTTAGGAGGGTGG - Intergenic
1119456082 14:74756649-74756671 TAAGATTAGGTGGAGGTGGGTGG - Intergenic
1119521220 14:75286877-75286899 AAAAATTAGCTGGGGGTGGGTGG + Intergenic
1119925509 14:78489768-78489790 AAGAATTTGGGCGGGGTGGGAGG + Intronic
1121179499 14:91918079-91918101 TAGAATAAGGTAAAGGTGGGAGG + Intronic
1122667155 14:103338523-103338545 TGGCATTTGGTTGAGGTGGGTGG + Intronic
1124117513 15:26859860-26859882 AAAAATGAGGCTGAGGTGGGTGG + Intronic
1125052774 15:35320713-35320735 AAGAAATAGGATAAGGTGGATGG - Intronic
1125250849 15:37701376-37701398 GAGAATTAGCTTGTGGTGTGAGG - Intergenic
1125264793 15:37866706-37866728 AAGACTAAGGTTGAAGTTGGAGG - Intergenic
1125443569 15:39729463-39729485 ACGAAGGAGGCTGAGGTGGGAGG + Intronic
1125612933 15:40984573-40984595 ACTACTTAGGCTGAGGTGGGAGG + Intronic
1125954422 15:43779598-43779620 ATGAAGGAGGCTGAGGTGGGTGG - Intronic
1127933528 15:63614001-63614023 AAAAATTAGGCTGAGGTATGGGG + Intronic
1128415776 15:67444553-67444575 AAGTATTGGGTCAAGGTGGGAGG + Intronic
1128478523 15:68017734-68017756 AAAAAGGAGGCTGAGGTGGGAGG + Intergenic
1129049553 15:72768863-72768885 AGGAACTCGGCTGAGGTGGGAGG + Intronic
1130710848 15:86279591-86279613 GAGAATAAGGGAGAGGTGGGAGG - Intronic
1130974422 15:88762360-88762382 GAGAATGAGGATGAGGTGAGGGG - Intergenic
1131429701 15:92376974-92376996 AAAAAAGAGGTGGAGGTGGGGGG + Intergenic
1131489109 15:92846974-92846996 AAGAACTATGTAGAGATGGGAGG + Intergenic
1131508352 15:93035319-93035341 AAGACTTTATTTGAGGTGGGGGG + Intronic
1131651164 15:94401014-94401036 AAAACCTGGGTTGAGGTGGGTGG + Intronic
1135676242 16:24417428-24417450 AGCAATGAGGTTGAGGTTGGGGG - Intergenic
1136043783 16:27600191-27600213 AAGAAGTGGGGTGAGGAGGGAGG + Intronic
1136244993 16:28969860-28969882 AGGAAGGAGGCTGAGGTGGGAGG + Intergenic
1136387028 16:29934670-29934692 AAGAAAAAGGCTGAGGTGGGAGG - Intergenic
1136568690 16:31084438-31084460 AAGGCTTAGTTTCAGGTGGGAGG + Intronic
1137011373 16:35324079-35324101 ACTAATGAGGCTGAGGTGGGAGG + Intergenic
1139480921 16:67230236-67230258 AAGAAGAAGGGTGAGCTGGGAGG + Intronic
1139672419 16:68500775-68500797 GAGGTTGAGGTTGAGGTGGGAGG + Intergenic
1139768847 16:69255887-69255909 AAAAAATTGGTTGGGGTGGGGGG + Intronic
1140349555 16:74248997-74249019 AACAATTAGGCTGAGGACGGTGG + Intergenic
1140375120 16:74439282-74439304 AAAAAAGAGGCTGAGGTGGGAGG - Intergenic
1141074453 16:80990825-80990847 GAGGCTGAGGTTGAGGTGGGAGG - Intronic
1141698204 16:85630558-85630580 AAGTAGGAGGGTGAGGTGGGAGG - Intronic
1142726108 17:1815547-1815569 AAAATTGAGGCTGAGGTGGGAGG + Intronic
1142822245 17:2479416-2479438 AACACTTAGGCTGAGGCGGGAGG - Intronic
1143772640 17:9178454-9178476 GAGAATTAGGAAGAGGAGGGAGG - Intronic
1144248610 17:13393602-13393624 AAAAATTAGGTCGTGGTGGTGGG + Intergenic
1144775990 17:17784849-17784871 GAGAATTTGGCAGAGGTGGGAGG + Intronic
1146008905 17:29179269-29179291 CAGAATGAGCTAGAGGTGGGGGG - Intronic
1147012586 17:37463079-37463101 AATAAGGAGGCTGAGGTGGGAGG - Intronic
1147238366 17:39074259-39074281 ACTTAGTAGGTTGAGGTGGGAGG + Intronic
1147288330 17:39421090-39421112 AAAAATTAGGCTGATGTGGCCGG - Intronic
1148040107 17:44699936-44699958 AAAAAATGGGCTGAGGTGGGAGG - Intergenic
1148192281 17:45687981-45688003 AGGGGTTAGCTTGAGGTGGGAGG + Intergenic
1148253850 17:46110786-46110808 AGAAATAAGGTTGGGGTGGGAGG + Intronic
1148330207 17:46809640-46809662 AAGATGTAGGTGGAGGTGAGGGG - Intronic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1149401643 17:56302404-56302426 AATCATGAGGCTGAGGTGGGAGG + Intronic
1149552607 17:57551423-57551445 GAGAGGTAGGTTCAGGTGGGTGG + Intronic
1149745197 17:59089989-59090011 AGGAAGGAGGTTGAGGTAGGAGG + Intronic
1150922957 17:69502688-69502710 AAGAATGATGTTGATGTGGGGGG + Intronic
1151021003 17:70617488-70617510 AAGGATTAAGGTGAGGTGGATGG - Intergenic
1151206743 17:72513497-72513519 AAAAATGAGGCTGAGGTGGGAGG - Intergenic
1151413636 17:73947516-73947538 AAGAGGTAGGTAGGGGTGGGAGG + Intergenic
1151924038 17:77180525-77180547 GAAAATAAGGCTGAGGTGGGAGG - Intronic
1151998370 17:77627944-77627966 AAGCATTAAGTAGAGGAGGGAGG - Intergenic
1152223165 17:79080410-79080432 AGGAAAGAGGTGGAGGTGGGCGG - Intronic
1152413191 17:80141038-80141060 ATAAATTAGGTCGAGGTGGGTGG - Intronic
1154061491 18:11064936-11064958 AGGAATGAGGCTGTGGTGGGTGG + Intronic
1154139335 18:11809487-11809509 TAGAAAGAGGCTGAGGTGGGTGG + Intronic
1154211101 18:12378990-12379012 CAGAAATAGGCTGAGGTGAGAGG + Intergenic
1154254072 18:12767711-12767733 AAAAATTAGCTGGAGGTGGTGGG + Intergenic
1155232676 18:23789852-23789874 AAAAATAAGGCAGAGGTGGGAGG + Intronic
1155530334 18:26760217-26760239 ATGAATTAGGCAGGGGTGGGGGG - Intergenic
1155985147 18:32222414-32222436 AAGAATTAAGTTGAGAGGGCAGG - Intronic
1156524645 18:37755506-37755528 AAGAATTAGGTTCCAGAGGGAGG - Intergenic
1157911847 18:51623796-51623818 AGCAATAAGGTGGAGGTGGGAGG + Intergenic
1157966098 18:52210221-52210243 AAGAATAAGGGTCAGGTTGGAGG + Intergenic
1158214509 18:55085994-55086016 AAGAATTGGATTGAACTGGGTGG + Intergenic
1159915399 18:74183188-74183210 GAGAAGTAGGGGGAGGTGGGAGG - Intergenic
1160964468 19:1740457-1740479 GAAAACAAGGTTGAGGTGGGAGG - Intergenic
1161278694 19:3433659-3433681 AAGGAGTAGGGTGAGGGGGGTGG - Intronic
1161509588 19:4663110-4663132 TAGAATGAGGATGAGGTGGGTGG - Intronic
1161509621 19:4663243-4663265 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509660 19:4663422-4663444 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509681 19:4663508-4663530 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509693 19:4663553-4663575 TAGAATGAGGGTGGGGTGGGTGG - Intronic
1161509707 19:4663598-4663620 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509738 19:4663727-4663749 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509751 19:4663772-4663794 TAGAATGAGGATGGGGTGGGTGG - Intronic
1161509762 19:4663819-4663841 CAGAATGAGGATGGGGTGGGTGG - Intronic
1162689032 19:12413769-12413791 AAGAGTTAGGTTGAGGAGACAGG + Intronic
1162866856 19:13554567-13554589 AAGCATTGGGTCAAGGTGGGAGG - Intronic
1163186316 19:15641672-15641694 AAGAATGAGGCTCAGGTGAGAGG + Intronic
1163200964 19:15768857-15768879 ACTAAGGAGGTTGAGGTGGGAGG - Intergenic
1163288794 19:16365211-16365233 AAGAAACAGGCTGAGGGGGGTGG - Intronic
1163666864 19:18607357-18607379 AAGAGGCAGGATGAGGTGGGAGG - Intronic
1164976784 19:32579687-32579709 AAGATTTAGGTTGGTGTGAGGGG - Intergenic
1165562632 19:36693313-36693335 AATAATTAGCTGGATGTGGGTGG + Intronic
1165821183 19:38677099-38677121 AAGAATGAGGAGGAGGTAGGTGG - Intronic
1166178847 19:41093094-41093116 ACTAAGGAGGTTGAGGTGGGAGG + Intronic
1166661821 19:44652299-44652321 GAGACTGAGGCTGAGGTGGGAGG - Intronic
1167422056 19:49409666-49409688 TAGAAATAGGTTTAGGTGTGCGG - Intronic
1167464601 19:49643839-49643861 AGGAATTAGGTGGAGCTGGGAGG + Intronic
1167488687 19:49779182-49779204 AAAAATTAGCTAGGGGTGGGTGG + Intronic
1167936357 19:52911963-52911985 AAAAATTAGGGTGTGGTGGCGGG - Intergenic
925218821 2:2121460-2121482 AAGAAAGAGGTTGAGGGCGGTGG - Intronic
926343232 2:11922195-11922217 ACTCATAAGGTTGAGGTGGGAGG - Intergenic
927240112 2:20913858-20913880 AAGAATGGGGTTCAGGTTGGGGG - Intergenic
927973790 2:27322755-27322777 AGGAATGAGGTTGGGGTGGCTGG - Intronic
929334876 2:40730105-40730127 AAGAATGATGATGATGTGGGTGG - Intergenic
929840250 2:45452775-45452797 AAAAAATTGGTTGTGGTGGGGGG + Intronic
930693821 2:54391046-54391068 AAGAATGAGGTTGAGGGCAGTGG + Intergenic
930881993 2:56280704-56280726 AACAATGAGGTGGAGGTGGGAGG + Intronic
931034179 2:58218545-58218567 AAGAAGTACATTGAAGTGGGTGG + Intronic
931338311 2:61372600-61372622 ACTAAGGAGGTTGAGGTGGGAGG + Intronic
931444966 2:62319196-62319218 AATGATGAAGTTGAGGTGGGAGG + Intergenic
931495863 2:62806477-62806499 ACGAAGGAGGCTGAGGTGGGAGG - Intronic
931727296 2:65123582-65123604 AGCAATTTGGCTGAGGTGGGTGG + Intronic
932152774 2:69387687-69387709 AAGAATTAGGTTGAGGTGGGAGG + Intergenic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933033250 2:77359289-77359311 AATAATTAGTTTGGGTTGGGGGG - Intronic
935134707 2:100289858-100289880 TACACTTTGGTTGAGGTGGGAGG + Intronic
936134295 2:109876085-109876107 AAAAAAGAGGTTGAGGTGGGAGG + Intergenic
936210402 2:110495400-110495422 AAAAAAGAGGTTGAGGTGGGAGG - Intergenic
936434987 2:112496814-112496836 AAAAAAGAGGTTGAGTTGGGAGG - Intronic
936912657 2:117608815-117608837 AAGTGTTGGGCTGAGGTGGGCGG - Intergenic
937390937 2:121485718-121485740 AAGAATTAGGGCATGGTGGGGGG + Intronic
937875342 2:126820975-126820997 AAGAATCGGGTGGAGATGGGTGG + Intergenic
938049309 2:128152750-128152772 AAAAAGGAGGTTGAGGGGGGAGG - Intronic
939155435 2:138519553-138519575 AAGAATAAAGTTTAGGTGGGAGG + Intronic
940181677 2:150941333-150941355 CAGTCTTAGGTTGAGGAGGGAGG - Intergenic
940282344 2:152000941-152000963 AAGAATCTGCTGGAGGTGGGAGG - Intronic
940783126 2:157954201-157954223 GAGACTGAGGTTGAGGTTGGAGG + Intronic
941668804 2:168268535-168268557 AAAACTGAGGCTGAGGTGGGCGG - Intergenic
941811336 2:169758669-169758691 AAAAATTAGCTGGAGGTGGTGGG - Intronic
942637329 2:178021797-178021819 AAGCATTAGGGAGAGGTGGAAGG + Intronic
943253621 2:185565062-185565084 AATAAGGAGGCTGAGGTGGGTGG + Intergenic
943551901 2:189351520-189351542 AAGAACTAGGTTGATATGTGTGG + Intergenic
943601944 2:189931620-189931642 AAGAGTTTGCTTGAGGAGGGAGG - Intronic
943607037 2:189987986-189988008 AACAATTAGGTGGATGGGGGTGG + Intronic
944541856 2:200761611-200761633 AAGAATAAGGATGAAGAGGGTGG + Intergenic
944562641 2:200956336-200956358 ATGAGTGAGGCTGAGGTGGGAGG - Intronic
944718725 2:202402130-202402152 GGGAATGAGGTGGAGGTGGGAGG + Intronic
944883768 2:204042245-204042267 AAGACTTGGGTTGGGGAGGGCGG + Intergenic
945878380 2:215302038-215302060 ATTAGCTAGGTTGAGGTGGGAGG + Intergenic
946186670 2:217984734-217984756 AAAAAAGAGGCTGAGGTGGGAGG - Intronic
946388947 2:219404186-219404208 AAAAATTAGCTGGACGTGGGTGG + Intergenic
946625620 2:221609619-221609641 AAGGACTAGGTTGAAGAGGGAGG + Intergenic
947136734 2:226983444-226983466 AAGAAATGGATTGAGGTGGCTGG - Intronic
947250942 2:228103181-228103203 ATGAATTAGGTTTCTGTGGGGGG - Intronic
947738089 2:232468900-232468922 CAGCATGAGGTTGAGGTGGGCGG - Intergenic
947940618 2:234051751-234051773 CAAATTTAGGTTAAGGTGGGAGG + Intronic
948188255 2:236038371-236038393 CTGAATTAGGTCGAGGTGGCAGG - Intronic
1169282913 20:4282085-4282107 GAGAAATAGGTTGAGGGGCGGGG - Intergenic
1170616676 20:17958591-17958613 AATACTTAGGTTGAGATGTGAGG - Intronic
1170926637 20:20730687-20730709 ATGAAGGAGGCTGAGGTGGGAGG + Intergenic
1171167762 20:22987055-22987077 AAAAAATAGGCTGTGGTGGGAGG + Intergenic
1171508804 20:25662474-25662496 GAGAAGTAGGGTGGGGTGGGAGG + Intergenic
1171848980 20:30294816-30294838 AGGAATTAAGGTGAGGTGGGAGG + Intergenic
1171934590 20:31261854-31261876 AAGAATAAGGTTGTTTTGGGAGG - Intergenic
1172265837 20:33612976-33612998 ACTCAGTAGGTTGAGGTGGGAGG + Intronic
1172537490 20:35685268-35685290 AGGAAGGAGGCTGAGGTGGGAGG + Intronic
1172852865 20:37979154-37979176 AGGATTTAGGCTGAGGTGGGAGG + Intergenic
1173508067 20:43604906-43604928 AAGTATGAGGCTAAGGTGGGAGG - Intronic
1173751706 20:45481552-45481574 CTGACTTGGGTTGAGGTGGGTGG + Intergenic
1174024688 20:47563914-47563936 AAGAAAAAGGCTGAGGTGGGAGG + Intronic
1177177416 21:17714995-17715017 AACAATTTGGTTGACCTGGGAGG + Intergenic
1177798574 21:25804938-25804960 ACTACTGAGGTTGAGGTGGGAGG + Intergenic
1177923235 21:27181170-27181192 AAAAATTAGTTAGAGGAGGGTGG - Intergenic
1179201519 21:39227045-39227067 AAAAAGGAGGCTGAGGTGGGAGG + Intronic
1181163839 22:20973260-20973282 AGGAAGTTGGCTGAGGTGGGGGG + Intronic
1181786328 22:25229879-25229901 GAGGATTAGGTTGAGGCAGGAGG + Intronic
1181818499 22:25457702-25457724 GAGGATTAGGTTGAGGCAGGAGG + Intergenic
1181844467 22:25695769-25695791 GAGACTGAGGTTGAGGTGGAAGG - Intronic
1182472977 22:30560022-30560044 AAAAGTTATGCTGAGGTGGGAGG + Intronic
1182793013 22:32968682-32968704 AAGAATTAGGTGAGGGTGAGTGG - Intronic
1184002113 22:41682593-41682615 AAGAATTAGGTGAAGGATGGAGG + Intronic
1184329154 22:43815174-43815196 GAGAATGAGGTTGAGGTTGTAGG - Intergenic
1184644876 22:45890209-45890231 AAGAACTAAGTTGAGGCCGGAGG - Intergenic
1184830297 22:46981820-46981842 AAGAATTAGGAAGATCTGGGAGG + Intronic
1185013042 22:48326749-48326771 AAGAATTAGGTAGAAATGAGTGG + Intergenic
949978230 3:9480201-9480223 TAGAATCAGGTTGTGGTTGGTGG - Intergenic
952207777 3:31197796-31197818 GAGAATTGGGTTGTGGAGGGAGG - Intergenic
953803217 3:46045131-46045153 AAGAATTAGGCTGGGTGGGGTGG + Intergenic
953962762 3:47280059-47280081 GAGGTTGAGGTTGAGGTGGGAGG - Intronic
955075654 3:55610596-55610618 AAGGCTGAGGCTGAGGTGGGAGG + Intronic
955495463 3:59527495-59527517 AAGAAATAGGTTTCTGTGGGAGG + Intergenic
955627321 3:60932339-60932361 AAGAGATAGGAAGAGGTGGGTGG - Intronic
956528421 3:70190087-70190109 AAGAAATGGGTTGGGGAGGGGGG - Intergenic
957989903 3:87614541-87614563 TGGAATTTGGTGGAGGTGGGTGG + Intergenic
958108842 3:89113722-89113744 TAAAATGGGGTTGAGGTGGGGGG + Intronic
959028509 3:101270554-101270576 AATAATCAGGTTGAGGCGGGTGG + Intronic
961197563 3:125015501-125015523 AAGAAACAGCCTGAGGTGGGGGG + Intronic
961244404 3:125438872-125438894 ATGAAATAAGTTGAGGGGGGTGG + Intergenic
963576917 3:147071914-147071936 ACAAAGGAGGTTGAGGTGGGAGG + Intergenic
963624117 3:147649220-147649242 AAAAATAAGGTTAAGGTGGTAGG - Intergenic
963833103 3:150029825-150029847 AAGGAGTAGTTGGAGGTGGGAGG + Intronic
964328719 3:155576199-155576221 AAATATGAGGTTGGGGTGGGTGG + Intronic
964742724 3:159984462-159984484 ACCAAGTAGGCTGAGGTGGGAGG - Intergenic
965597622 3:170423776-170423798 AAGAAGGAGGCCGAGGTGGGCGG + Intronic
967053434 3:185805924-185805946 AAAAATTAGCTGGGGGTGGGGGG - Intronic
967085028 3:186086860-186086882 ATGAGGTAGGGTGAGGTGGGCGG + Intronic
967393603 3:188981859-188981881 AAAAATTAGCTGGACGTGGGTGG - Intronic
968089429 3:195891169-195891191 AGCACTTAGGCTGAGGTGGGCGG + Intronic
969343899 4:6559515-6559537 AAGAATTGGGTTAAGGTGTTGGG - Intronic
970583880 4:17496742-17496764 AAAAAAGAGGCTGAGGTGGGAGG - Intronic
973331701 4:48915753-48915775 AAGAATTTGGTGGGGATGGGGGG - Intergenic
975558940 4:75691581-75691603 AATAAATAGGTGGAGGTCGGGGG - Intronic
975581025 4:75907114-75907136 AAGAATTATTTTGAGCTAGGCGG + Intergenic
976058076 4:81092755-81092777 AAGAATTGAGATGAGGTTGGTGG - Intronic
976885526 4:89979360-89979382 AAGAGTTAGGTTTAGCTTGGAGG - Intergenic
978336180 4:107672066-107672088 AAAAATGAGATGGAGGTGGGTGG + Intronic
979141972 4:117187995-117188017 AAGATTTAGGTTAAGGTTAGAGG - Intergenic
979737061 4:124100299-124100321 AAGAAATAGGATAAGGTGTGGGG + Intergenic
981414082 4:144467694-144467716 AAAAATTATGCTGAGGTGGGTGG + Intergenic
981579741 4:146239452-146239474 AAGAGATGGGTGGAGGTGGGAGG - Intergenic
981585956 4:146302604-146302626 GAGAAACAAGTTGAGGTGGGAGG + Intronic
981788087 4:148503332-148503354 AAGAATTAGGTGGGGGGGGGAGG - Intergenic
981800272 4:148647684-148647706 AAAAATTAGCTGGATGTGGGCGG + Intergenic
982294154 4:153809083-153809105 ATGCAGGAGGTTGAGGTGGGAGG - Intergenic
985096082 4:186414592-186414614 AAGAGTTTGGTTGGGATGGGGGG + Intergenic
985846327 5:2352242-2352264 AAGAACGAGGATGAGGCGGGTGG + Intergenic
986680489 5:10228786-10228808 AATTAGGAGGTTGAGGTGGGAGG - Intronic
987055704 5:14189429-14189451 TAGAATTGGATTGAGGAGGGCGG + Intronic
988365296 5:30290582-30290604 AAGGAAGAGGTTGAGGTTGGAGG - Intergenic
988643160 5:33064272-33064294 TAGAAGGAGGCTGAGGTGGGAGG - Intergenic
989547611 5:42692986-42693008 AAAAATTAGGAATAGGTGGGTGG - Intronic
990197458 5:53334621-53334643 TAGAGTTGGGTTGAGGTTGGGGG - Intergenic
990216859 5:53543099-53543121 ACTAACAAGGTTGAGGTGGGAGG + Intergenic
991775127 5:70077247-70077269 AAGACTGAGGTGGGGGTGGGAGG + Exonic
992272917 5:75084073-75084095 TAGAATTATATAGAGGTGGGTGG + Intronic
992573440 5:78084373-78084395 AAAAATTAGGGTGTGGTGGCAGG + Intronic
992667418 5:79024715-79024737 AAGAATCAGGGTAAGGTGGAGGG + Intronic
992697375 5:79303382-79303404 AATGATGAGGTGGAGGTGGGAGG + Intronic
992753830 5:79885920-79885942 AAAAAATAAGTGGAGGTGGGAGG - Intergenic
993359939 5:86962330-86962352 AAGAATCTGGTTTGGGTGGGTGG - Intergenic
994745640 5:103675029-103675051 ACAAAATAGGCTGAGGTGGGCGG + Intergenic
994765268 5:103908465-103908487 AATATTGAGGTTGAGGTGGTTGG + Intergenic
995451956 5:112311914-112311936 AAGAATTAGGTAGAGTTGTGTGG - Intronic
995594756 5:113735751-113735773 TAGACTTAATTTGAGGTGGGAGG + Intergenic
996080614 5:119254767-119254789 AAAAATTAGCTGGATGTGGGTGG + Intergenic
996556056 5:124779959-124779981 AAATATTAGGCTGAGGTGAGAGG - Intergenic
996761347 5:126989034-126989056 TAGGACTAGGCTGAGGTGGGAGG + Intronic
997094183 5:130892130-130892152 AAGAACAAGGTAGAGGTTGGAGG + Intergenic
997528399 5:134567837-134567859 AAGGAAGAGGTGGAGGTGGGAGG + Intronic
998465186 5:142337931-142337953 AAAAAAGAGGCTGAGGTGGGAGG + Intergenic
998733992 5:145113808-145113830 ATGAATAAGGATGAGATGGGAGG - Intergenic
999073020 5:148767810-148767832 AAGAATGAAGTGGATGTGGGTGG + Intergenic
999841242 5:155429852-155429874 AAGAATTAGTTTAAGCTGGGTGG + Intergenic
1000105504 5:158055248-158055270 AAGCATTAGGAGGGGGTGGGAGG + Intergenic
1000342415 5:160287892-160287914 AAGAAGGGGGCTGAGGTGGGAGG + Intronic
1000470333 5:161631997-161632019 AAGAATGAGGTTGAGTGTGGTGG - Intronic
1001065969 5:168535451-168535473 AAAAATTAGGTTGGGGATGGTGG - Intergenic
1001516235 5:172357008-172357030 AGGTGTTAGGCTGAGGTGGGAGG + Intronic
1001735890 5:174000768-174000790 AAGAAGGAGAATGAGGTGGGGGG + Intronic
1001950149 5:175810710-175810732 TAGAATTGGGCAGAGGTGGGTGG - Intronic
1003892577 6:10576597-10576619 AAGACTTAGGGGGAGGTAGGAGG + Intronic
1003954298 6:11147691-11147713 GAAAATTAGGCTGAGGTGGGTGG + Intergenic
1004470747 6:15926910-15926932 AAGATGAAGGCTGAGGTGGGAGG + Intergenic
1004872450 6:19920669-19920691 AGGAATGAGGTGGGGGTGGGGGG - Intergenic
1005140092 6:22621870-22621892 AAGACTGAGAATGAGGTGGGTGG - Intergenic
1005270276 6:24156286-24156308 AAGAGTTAGGGTGAGGCAGGTGG - Intergenic
1005326908 6:24710881-24710903 ACTCATGAGGTTGAGGTGGGAGG + Intronic
1005765994 6:29012695-29012717 AAGAGTTAGGGTGAGGTTTGAGG + Intergenic
1005948745 6:30615456-30615478 ACAAATAGGGTTGAGGTGGGAGG + Intronic
1006272944 6:32978284-32978306 ACTTCTTAGGTTGAGGTGGGCGG - Exonic
1006493440 6:34403809-34403831 AAAAAGGAGGCTGAGGTGGGAGG + Intronic
1007029413 6:38614658-38614680 ATGGATTAGGTTGAGGTCGAAGG - Intronic
1007652436 6:43431906-43431928 ATGAGTTAGGTTCAGGTGGCCGG + Intronic
1008623060 6:53290855-53290877 AAGAAGAAGGTAGAGGTGGGAGG - Intronic
1008871644 6:56279173-56279195 AAGAACAAGAGTGAGGTGGGAGG - Intronic
1009490065 6:64278995-64279017 AAGATTTTGGTTGAGTTGGGAGG - Intronic
1010258917 6:73793028-73793050 AAGAGTTAGTTTCTGGTGGGAGG + Intronic
1010694215 6:78949795-78949817 ACTAATGAGGCTGAGGTGGGAGG - Intronic
1011380538 6:86738037-86738059 AAGAAAAAGGTTGAGGTTTGAGG + Intergenic
1012399788 6:98834188-98834210 AAGACTTGGATTGGGGTGGGGGG - Intergenic
1012572777 6:100751346-100751368 TAGAATAAGGTTTAGGTGTGAGG - Intronic
1013144067 6:107369848-107369870 AAAAATTAGCTGGATGTGGGTGG + Intronic
1013167411 6:107606430-107606452 AAGTAACAGGTTGGGGTGGGTGG + Intronic
1014862858 6:126491684-126491706 AAAAATTAGCTGGAGGTGGTGGG - Intergenic
1016531281 6:145060143-145060165 TAGAATGAGGTTAAGGTTGGTGG + Intergenic
1016593074 6:145767100-145767122 AAAAATTAACTTGAGGTGGCTGG - Intergenic
1016744627 6:147565370-147565392 AGAAAGTAGATTGAGGTGGGGGG + Exonic
1017912390 6:158805097-158805119 AACAATGAGGCTGAGGTGGGTGG + Intronic
1018397836 6:163393746-163393768 AAGATTTAGGTTGTGTTGGGGGG - Intergenic
1018553310 6:165023932-165023954 AAGGGTTGGGGTGAGGTGGGAGG + Intergenic
1019166765 6:170102363-170102385 AGAAATTGGGTTGAGGTGAGAGG + Intergenic
1019332300 7:466469-466491 AAGGATGAGGGTGAGGTAGGAGG - Intergenic
1019508645 7:1406029-1406051 AAAAATTAGGTTGGGCTTGGTGG + Intergenic
1019719625 7:2560138-2560160 CAGAGTGAGGCTGAGGTGGGAGG + Intronic
1019971684 7:4546530-4546552 AAGAGTTAGAGAGAGGTGGGAGG - Intergenic
1020531092 7:9336367-9336389 TAGAATTAGTCTGAGGTGGTGGG - Intergenic
1023094358 7:36645123-36645145 AAGAATTTGGTTGGGGTGGGGGG - Intronic
1023467258 7:40469773-40469795 AAGAATTAGGTGGTGGTTGTGGG + Intronic
1024855092 7:53769742-53769764 AAGATTGAGGTTGAGGTTGCAGG - Intergenic
1026020572 7:66701749-66701771 ATAAATGAGGCTGAGGTGGGTGG - Intronic
1026162606 7:67882942-67882964 AGGCATTGGGGTGAGGTGGGGGG - Intergenic
1026833162 7:73622338-73622360 AAAAATTAGCTGGAGGTGGTGGG + Intronic
1027146872 7:75701742-75701764 AATCAGGAGGTTGAGGTGGGAGG + Intronic
1027699191 7:81448514-81448536 AAGGCTTAGGTTTAGGTTGGGGG + Intergenic
1028696268 7:93716658-93716680 AGGAAGGAGGCTGAGGTGGGAGG + Intronic
1029308746 7:99641635-99641657 AAGAATTAGGTTTGGATGGTGGG - Intergenic
1029407856 7:100387595-100387617 AATCAGGAGGTTGAGGTGGGAGG + Intronic
1030185630 7:106759027-106759049 CAGAATAAGGTGGTGGTGGGGGG - Intergenic
1030195197 7:106846451-106846473 AAGAATTTGGTGGTGGTGTGGGG - Intergenic
1030775524 7:113530083-113530105 AGCAATTTGGATGAGGTGGGTGG - Intergenic
1031808464 7:126336370-126336392 AACAATTAGATAGAGGCGGGTGG - Intergenic
1032285052 7:130533437-130533459 AAGAATGAGGGAGAGGTGGGAGG + Intronic
1032443042 7:131956865-131956887 TAGAATTAGGTTCAGTTTGGGGG + Intergenic
1033161968 7:139005846-139005868 AAGAAATAGGATGAGATAGGAGG + Intergenic
1033505584 7:141996525-141996547 AATACTTAGGTTGAGGTAGCAGG + Intronic
1033611760 7:142970081-142970103 AAGGCTGAGGCTGAGGTGGGAGG + Intergenic
1035857852 8:2995894-2995916 AAGAATGAGGTTGGGATGCGTGG + Intronic
1037480319 8:19299061-19299083 AAGAATTAGGTAGGGGAGGAAGG + Intergenic
1037983355 8:23271238-23271260 AATTAGGAGGTTGAGGTGGGAGG - Intronic
1039037629 8:33376987-33377009 AGCAATTAGGCTGAGGCGGGTGG + Intronic
1039603724 8:38864195-38864217 AATAAGGAGGCTGAGGTGGGAGG + Intergenic
1040399682 8:47036299-47036321 AAGAATGAGAGTGAGGTGGGAGG + Intergenic
1041730524 8:61057749-61057771 AAGAAATTGCTTGAAGTGGGTGG + Intronic
1041753939 8:61292271-61292293 AAGCTTAAGGGTGAGGTGGGAGG - Intronic
1041991011 8:63991647-63991669 AAGAAGGAGGGTGAGATGGGAGG + Intergenic
1042352253 8:67789173-67789195 AAAAATTAGCTGGATGTGGGTGG + Intergenic
1042545880 8:69950898-69950920 AAGAATTAGGTTGAACTCAGAGG - Intergenic
1043490654 8:80745538-80745560 AAAACTTTGGTTGAGGTAGGTGG - Intronic
1043926866 8:86046531-86046553 AAGAATAAGTCTGGGGTGGGAGG - Intronic
1044779108 8:95724842-95724864 GAGAATTTAGTGGAGGTGGGGGG + Intergenic
1046784809 8:118254594-118254616 AAGAAATAGGGTGAGGAAGGGGG - Intronic
1047051823 8:121121299-121121321 GAGAATAAAGCTGAGGTGGGAGG + Intergenic
1047981345 8:130186467-130186489 AAGCAGTAGGGTGGGGTGGGAGG - Intronic
1048039211 8:130709176-130709198 GAGAATTAGAATGAGGAGGGTGG + Intergenic
1048521291 8:135157767-135157789 AAGATTGAGATTGAGGTGAGCGG - Intergenic
1048714783 8:137256282-137256304 ATGAATTAGGTGGAGGTGGATGG + Intergenic
1048741643 8:137567296-137567318 AAGGATAGGGCTGAGGTGGGAGG - Intergenic
1049530447 8:143151878-143151900 AGGAATAAAGTTGAGGAGGGAGG + Intergenic
1049581875 8:143416095-143416117 ACAAATGAGGCTGAGGTGGGAGG - Intergenic
1051151173 9:14080716-14080738 AAGATTTAGGCTGAGGCGGATGG - Intergenic
1051193288 9:14536543-14536565 AAGACTTGGGTTGAGGGTGGGGG + Intergenic
1051918669 9:22237777-22237799 AAGCATGAGGTTAATGTGGGGGG - Intergenic
1052938640 9:34114434-34114456 AATAATGAGGGTGAGGTTGGGGG - Intronic
1052961017 9:34296665-34296687 AAGAAAAAGGTTCAGGTGGTTGG - Intronic
1053129672 9:35607835-35607857 CAGAATTTGGTTGAGGGTGGGGG - Intronic
1053786697 9:41657536-41657558 AGGAATTAAGGCGAGGTGGGAGG + Intergenic
1054450383 9:65400757-65400779 AGGAATTAAGGCGAGGTGGGAGG + Intergenic
1054478141 9:65587664-65587686 AGGAATTAAGGTGAGGTAGGAGG - Intergenic
1055179671 9:73369409-73369431 AAGATCTATGTTGAGGTGGGTGG - Intergenic
1055261766 9:74445167-74445189 AAGAATTCGGAGGAGGTTGGTGG - Intergenic
1057154424 9:92828718-92828740 AAGAATTAGGCAGGTGTGGGTGG - Intergenic
1057592993 9:96390147-96390169 AACACTTTGGCTGAGGTGGGTGG - Intronic
1059248364 9:112867027-112867049 AAGAATTCTGAGGAGGTGGGAGG - Intronic
1059279636 9:113121239-113121261 AGGAAGGAGGCTGAGGTGGGAGG + Intergenic
1059356460 9:113702982-113703004 ATGAAAGAGGCTGAGGTGGGAGG + Intergenic
1060289207 9:122284890-122284912 AGCAATGAGGCTGAGGTGGGAGG - Intronic
1060439510 9:123625998-123626020 ACGCAGGAGGTTGAGGTGGGAGG - Intronic
1060542057 9:124437806-124437828 AAAAATGAGGCTGAGGTGAGAGG + Intergenic
1060849561 9:126862488-126862510 GAGAATAAGGTTCAGGTAGGTGG - Intronic
1061072528 9:128320157-128320179 AATAAAGAGGCTGAGGTGGGCGG - Intronic
1062004192 9:134231074-134231096 AAGATTCAGGGTGAGGAGGGAGG + Intergenic
1186026706 X:5321215-5321237 AAGATGTAGGATGGGGTGGGGGG - Intergenic
1186049024 X:5569609-5569631 ACGCAGTAGGCTGAGGTGGGAGG - Intergenic
1186110039 X:6246016-6246038 AAGAATTATGATGATGTGCGTGG - Intergenic
1186979022 X:14939415-14939437 ACTAAGTAGGCTGAGGTGGGAGG - Intergenic
1187287891 X:17923653-17923675 AAGAATGAGGTTGTGGTAAGTGG - Intergenic
1189644426 X:43111513-43111535 AAGAAAGAGGTTGAGATGAGAGG + Intergenic
1189910224 X:45803778-45803800 CAGAAGTTGGTTGGGGTGGGTGG - Intergenic
1190150890 X:47946482-47946504 AAAAAAAAGGTTGAGGTGGGAGG + Intronic
1192110160 X:68355892-68355914 AAGAATTAGCTGGGTGTGGGTGG + Intronic
1192320605 X:70087446-70087468 AAAAAAGAGGCTGAGGTGGGAGG + Intergenic
1192451836 X:71249748-71249770 AAGGTCTAGGGTGAGGTGGGGGG - Intronic
1194084419 X:89508800-89508822 ACCTATTAGGCTGAGGTGGGAGG - Intergenic
1195892671 X:109712729-109712751 ACTAAAGAGGTTGAGGTGGGCGG + Intronic
1196327800 X:114428678-114428700 ACTAAGTAGGCTGAGGTGGGAGG + Intergenic
1196417187 X:115483963-115483985 ATGAAGGAGGCTGAGGTGGGAGG + Intergenic
1198523305 X:137474240-137474262 AAGAAGTAGGTTGAGGAGGTAGG + Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1200437061 Y:3164685-3164707 ACCTATTAGGCTGAGGTGGGAGG - Intergenic
1200668984 Y:6064036-6064058 AAAAATTAGGGTGTGGTGGTGGG - Intergenic