ID: 932154549

View in Genome Browser
Species Human (GRCh38)
Location 2:69404132-69404154
Sequence AAGAATAATTAATTGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 422}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932154549 Original CRISPR AAGAATAATTAATTGGAGGC CGG (reversed) Intronic
900999442 1:6141318-6141340 AATAATAATTAGTTGGGGCCAGG + Intronic
901373403 1:8819193-8819215 AAGAATAATTGAATGTGGGCCGG - Intergenic
901382219 1:8882044-8882066 AAGAAAAAAGAAATGGAGGCCGG + Intergenic
901789586 1:11647313-11647335 ATGAATAAACAATTGCAGGCAGG + Intergenic
902648568 1:17821519-17821541 AAAAATAATTAAATGGAGAAAGG - Intronic
903249490 1:22042394-22042416 AACAATAATTAAAACGAGGCTGG - Intergenic
903391498 1:22966819-22966841 AAGCATGACTAAGTGGAGGCAGG - Intergenic
905214669 1:36398352-36398374 AAGTAAAATTTATAGGAGGCAGG + Intergenic
905555780 1:38882981-38883003 AAAAATATCTAATTAGAGGCTGG + Intergenic
905583859 1:39102415-39102437 AGGACCTATTAATTGGAGGCGGG + Intronic
905629705 1:39511721-39511743 AAGAACAATTAACCGGCGGCCGG - Intronic
905668054 1:39774469-39774491 AAGAACAATTAACCGGCGGCCGG + Intronic
906856047 1:49305983-49306005 AAGAATAATTAATTCCGGCCAGG - Intronic
907131515 1:52101603-52101625 AAGAATAACTAAAAGAAGGCTGG + Intergenic
907491189 1:54809934-54809956 AGGAATGATTAATTGGAGAGGGG - Intronic
908603586 1:65768209-65768231 AAAAATAATTAATGGGTGGTAGG - Intergenic
908980907 1:69957258-69957280 AAAAATACTTCATTAGAGGCAGG - Intronic
910977245 1:92919722-92919744 AAGAATAAAGAAATGGAGGGAGG + Intronic
912362377 1:109105586-109105608 AAGAGTAGTCAAGTGGAGGCCGG + Intergenic
914432360 1:147630372-147630394 AACACTAATTAATTGGACACTGG - Intronic
915481450 1:156188695-156188717 AAAAACAATTTATTGGAGGGGGG + Intergenic
916953897 1:169811158-169811180 AAAACTAAATAATTGGGGGCAGG - Intronic
917927457 1:179801052-179801074 AAGAAGAATTCAGTGGAGGGAGG - Intronic
919213824 1:194524150-194524172 AAGAGCATTTAACTGGAGGCTGG - Intergenic
919907655 1:202088975-202088997 AATCATAATTCATTGCAGGCTGG + Intergenic
920321577 1:205127624-205127646 GACAAGAATTAATTGAAGGCTGG + Intergenic
920403387 1:205691424-205691446 AAGAATATATAAATGGAGGCCGG - Intergenic
921839803 1:219816159-219816181 AAGAATAATTCATAGGTGGATGG + Intronic
923284032 1:232473772-232473794 AAAAATAAACGATTGGAGGCGGG + Intronic
1063229548 10:4050923-4050945 AAGAATAATTAATCTGCTGCTGG + Intergenic
1063408119 10:5815482-5815504 AAAAAAAATTAGCTGGAGGCCGG + Intronic
1064141553 10:12795045-12795067 AAGAATGATAAGTTTGAGGCTGG + Intronic
1065394122 10:25216015-25216037 AAGAAAATGTTATTGGAGGCAGG - Intronic
1066624461 10:37392166-37392188 AATAATAATTATTTGGAGTGGGG - Intergenic
1067727875 10:48785766-48785788 AAGAAGAATTAATTTGGGGGAGG - Intronic
1068031720 10:51712833-51712855 AGGATTAAATAATTCGAGGCAGG - Intronic
1068188221 10:53615013-53615035 CAGAATAATTTATTTTAGGCTGG - Intergenic
1069392661 10:67952600-67952622 AAGACTCATAAATTGGAGGCCGG + Intronic
1069464695 10:68627968-68627990 AATAATAAATATTTGGGGGCCGG - Intronic
1069869366 10:71523861-71523883 AAGAATCTTTAAGGGGAGGCTGG - Intronic
1070003491 10:72399664-72399686 AATAAGAATAAATTTGAGGCCGG + Intronic
1070076203 10:73138859-73138881 TAGAATTATTACTTGTAGGCTGG - Intronic
1070596573 10:77836916-77836938 AAAAAGAATTATTTGGGGGCAGG + Intronic
1070645674 10:78200602-78200624 AAGAATAAATAATTCCAGGCTGG - Intergenic
1071246126 10:83766034-83766056 AAAAGTAATTAATTGAAGGAGGG - Intergenic
1071366132 10:84902283-84902305 AATAATAATAAAGTGGAGGTAGG + Intergenic
1071588588 10:86849158-86849180 AAGAATGATTAAGTGTAGGCAGG - Intronic
1071929100 10:90445950-90445972 AAAAATAATTAATGGGTGCCAGG - Intergenic
1072292966 10:93982531-93982553 AAGAATAAATAAATTAAGGCTGG + Intergenic
1073421127 10:103424578-103424600 AAGAGTGATTAATTGGGGGTGGG + Intronic
1073791856 10:106948661-106948683 AAAAAAAATTAACTGTAGGCCGG + Intronic
1073956170 10:108873981-108874003 AAAAATAACTAATTGGAGCTAGG + Intergenic
1074010670 10:109475947-109475969 CAGAATAATTAATTCGAAGCAGG - Intergenic
1074172880 10:110961128-110961150 AACAATAATTAAGCTGAGGCTGG - Intronic
1074841975 10:117362554-117362576 AAGAATAATTACTAAGAGTCTGG + Intronic
1075966772 10:126618781-126618803 CAGAATGATTAATTTGAGGATGG - Intronic
1076041507 10:127253576-127253598 AAGAATAATACAATGGAGCCAGG + Intronic
1077672572 11:4168969-4168991 AAAAATTTTTAATTGAAGGCTGG + Intergenic
1077781868 11:5339024-5339046 AAGAATATTTAATTTGAGTCAGG - Intronic
1078421042 11:11213228-11213250 AAGAGTCATTAATTTAAGGCTGG + Intergenic
1078591256 11:12641978-12642000 GAGAATAATTAAGAGGAGGCTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079942036 11:26692989-26693011 ATGAATAATTAATGAGTGGCAGG - Intronic
1080153560 11:29080146-29080168 AAAAATAATTAATGGGTAGCAGG + Intergenic
1080304825 11:30825056-30825078 AAAGATTATTTATTGGAGGCTGG - Intergenic
1080849407 11:36055246-36055268 AAGAAAAATTAATTACAAGCAGG - Intronic
1083993252 11:66259118-66259140 TAGAAGAATTAATTGGTGGGAGG - Intronic
1084125842 11:67098522-67098544 AAGAAGAATTGATTGGGGGCTGG + Intergenic
1084363083 11:68681733-68681755 AAGAAAAATAAATTTCAGGCCGG - Intergenic
1084466696 11:69327549-69327571 AAAAATAATTTCTTGGGGGCCGG - Intronic
1085507919 11:77070589-77070611 AAGAATAGCTAATGGGAGCCGGG - Intronic
1086578698 11:88371022-88371044 AAGAAAAAGAACTTGGAGGCAGG - Intergenic
1086800831 11:91172822-91172844 AAGAATAATTAAGTGAAGAGAGG - Intergenic
1090410215 11:126503053-126503075 AAAAATAATCAAGGGGAGGCAGG - Intronic
1090759881 11:129826989-129827011 ATGAAAAATAAATTGGAGGCCGG - Intronic
1093206392 12:16256561-16256583 AAAAATAATAAATTAGGGGCCGG + Intronic
1093572919 12:20689350-20689372 AAGAACACTTAATTGAAGGATGG - Intergenic
1093811762 12:23500460-23500482 AAGAATGATATAATGGAGGCCGG - Intergenic
1093970115 12:25368879-25368901 AAGAAAAATTAAATGGATGGAGG + Intergenic
1094348203 12:29495084-29495106 AAGCATAAATAATTTGTGGCTGG + Intronic
1094653778 12:32401555-32401577 TAGAATAAAGAATTTGAGGCCGG - Intronic
1095155405 12:38847259-38847281 AAGAATCATGAAATAGAGGCTGG + Intronic
1095155972 12:38854561-38854583 AAGAATAATTTATCGTAGGTGGG + Intronic
1096621245 12:52867005-52867027 AATAATAATAAAATCGAGGCCGG - Intergenic
1096727050 12:53572773-53572795 AAAAAAAATTAAATAGAGGCAGG - Intronic
1096989250 12:55785938-55785960 AAGAGTAAATAATTGGATACAGG - Intronic
1097424653 12:59428288-59428310 AGAAATAAGCAATTGGAGGCTGG - Intergenic
1098912437 12:76222988-76223010 AATAAAAATATATTGGAGGCTGG + Intergenic
1099351549 12:81576195-81576217 AAGAATGGATATTTGGAGGCAGG + Intronic
1099449776 12:82794929-82794951 AAAAATAAATAAAAGGAGGCCGG + Intronic
1099816168 12:87651140-87651162 AAGAATAATAAATTGTTGGTTGG - Intergenic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100327522 12:93553345-93553367 AATAATATTGCATTGGAGGCTGG - Intergenic
1100665448 12:96746977-96746999 AAGAATAATCAATTAGAAGGGGG - Intronic
1100685157 12:96979624-96979646 AACAAGAATTAAATTGAGGCAGG - Intergenic
1100937055 12:99681031-99681053 AAAAATCATCAAGTGGAGGCCGG - Intronic
1101176167 12:102154114-102154136 AAGAATAATACATTGGAGGCTGG + Intronic
1101376203 12:104173354-104173376 AAGAATACATAATTGGGGCCGGG + Intergenic
1102344510 12:112150857-112150879 AATAATAATAAGTTTGAGGCTGG - Intronic
1102751490 12:115298514-115298536 ATGAATAATAAGTTGGAGGATGG - Intergenic
1103802017 12:123544336-123544358 AAGAGAAATGAATTGTAGGCCGG - Intergenic
1104809086 12:131609827-131609849 AAAAATCAGTACTTGGAGGCAGG + Intergenic
1104936750 12:132368613-132368635 AAAAATAATTAATTGCTGCCGGG - Intergenic
1105320515 13:19315955-19315977 AAGAAGCATTAGTTGGATGCAGG - Intergenic
1105464350 13:20623769-20623791 AAACATAAATAAATGGAGGCTGG - Intronic
1106489318 13:30203265-30203287 AAGAAAAGTTAATGGGAGGAGGG + Exonic
1107326917 13:39254103-39254125 AAGCATGAATACTTGGAGGCAGG + Intergenic
1108284499 13:48893200-48893222 AAAAAAAATTAATTGGTGGCCGG - Intergenic
1108625149 13:52221154-52221176 AAAAACTATTAATTGGAGGCTGG - Intergenic
1108660903 13:52585263-52585285 AAAAACTATTAATTGGAGGCTGG + Intergenic
1109267560 13:60218579-60218601 AAGAATAAAGAAGTGGAGGTGGG - Intergenic
1109399693 13:61809218-61809240 AAGAATAAGTAATTGCAGAACGG + Intergenic
1110229271 13:73151764-73151786 AAGAGTAGTTACTTCGAGGCTGG - Intergenic
1110530132 13:76587839-76587861 ATTCATAATTAATTGGAGGAAGG + Intergenic
1110605924 13:77432514-77432536 AAATATAATTAGTTGGTGGCTGG + Intergenic
1111166542 13:84464535-84464557 AAGAATAACTAAAAGGAGGTTGG + Intergenic
1111684940 13:91490141-91490163 AAGAATGAATAATTGGAGAGGGG + Intronic
1112403524 13:99097286-99097308 AAAAAGAATTAAATTGAGGCTGG + Intergenic
1116255000 14:42542218-42542240 GAGAATAATGGATTGAAGGCTGG - Intergenic
1116381857 14:44278773-44278795 CAAAATAAGTAAATGGAGGCTGG - Intergenic
1116586042 14:46706079-46706101 AAGAATAATGAATTTGACACAGG + Intergenic
1116773668 14:49155673-49155695 AAAAATAATTATTTGGGGTCAGG + Intergenic
1117692721 14:58324798-58324820 AATACTAATTAATTTAAGGCAGG - Intronic
1120743351 14:88131836-88131858 AAGAAGTTTTAATTGGATGCAGG - Intergenic
1121209614 14:92198305-92198327 AACAAAAACTAATTTGAGGCCGG + Intergenic
1121772506 14:96560960-96560982 AAGAAAAAGTAATTGAGGGCTGG + Intronic
1121943015 14:98091360-98091382 AATTATAATTATTTGGAGACAGG + Intergenic
1122581195 14:102772794-102772816 AAAAATAATTAATCAGAGGCCGG - Intergenic
1122911948 14:104834427-104834449 CAAAAGAATTAAATGGAGGCTGG - Intergenic
1123675451 15:22706756-22706778 AAGAATATTTATTTGGAGCTGGG - Intergenic
1124327443 15:28779702-28779724 AAGAATATTTATTTGGAGCTGGG - Intergenic
1124529451 15:30491700-30491722 AAGAATATTTATTTGGAGCTGGG - Intergenic
1124769204 15:32515984-32516006 AAGAATATTTATTTGGAGCTGGG + Intergenic
1125187242 15:36945127-36945149 AAGCCTAATTAGTAGGAGGCAGG - Intronic
1126289992 15:47064048-47064070 AAAAATTCTTAATTGTAGGCAGG + Intergenic
1126774627 15:52089460-52089482 AATAATAATAAATTGGGGGTGGG + Intergenic
1128708720 15:69856421-69856443 AAAAAAAATTAATTTTAGGCTGG + Intergenic
1134160454 16:11884073-11884095 AAGAATAATGTATTTGAGGAGGG + Intronic
1134528428 16:14962973-14962995 AAGAATTGTTAATAGGAGACTGG + Intergenic
1134699033 16:16249282-16249304 AAAAATATTTTATTCGAGGCTGG + Intronic
1134873158 16:17670016-17670038 AAAAATAATTAACAGCAGGCCGG - Intergenic
1134904197 16:17965483-17965505 AAAAATAATTAAATGAAAGCAGG - Intergenic
1135292036 16:21248195-21248217 AAAAAAAATTTAATGGAGGCAGG + Intronic
1135698738 16:24612948-24612970 AAGAATATATAACTGAAGGCCGG + Intergenic
1138036002 16:53606908-53606930 AATAAAAATTTATTGCAGGCTGG - Intronic
1138860429 16:60749671-60749693 AAGTGTAATTAATGTGAGGCTGG + Intergenic
1139543414 16:67635920-67635942 AAGAAAAATCAATTTAAGGCTGG - Intronic
1139938037 16:70585394-70585416 AAAAATAATTTTTTTGAGGCTGG + Intronic
1140709953 16:77668169-77668191 AAAAATAAAAAATTAGAGGCGGG - Intergenic
1140823239 16:78682405-78682427 AAAAATAATTCATTGAAGACTGG - Intronic
1142831739 17:2554163-2554185 AAAAATGGTTAAATGGAGGCTGG - Intergenic
1142840549 17:2625627-2625649 AAGAACCATTTATTAGAGGCTGG + Intronic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1143109791 17:4546566-4546588 TAGAATTATGAATTGGGGGCTGG - Intronic
1144000990 17:11054828-11054850 GAGCAAAATTAATTTGAGGCCGG - Intergenic
1145977211 17:28991199-28991221 ATAAATAAATAAATGGAGGCTGG - Intronic
1146747268 17:35343317-35343339 AAGAAAATATTATTGGAGGCTGG - Intergenic
1147894763 17:43743355-43743377 AGAAATAATAAATTGGTGGCCGG + Intergenic
1148143776 17:45346745-45346767 AAAAATTATTATTTGGAGGCTGG - Intergenic
1148251439 17:46084401-46084423 AACAAAAATGAATTGGAGGCTGG + Intronic
1148767379 17:50047121-50047143 AAGAATGATTTAGTGGGGGCAGG - Intergenic
1148812715 17:50304264-50304286 AAACATAATTTTTTGGAGGCTGG - Intergenic
1149515215 17:57275962-57275984 AAGGATAATGAATTTGAGGGAGG - Intronic
1150677243 17:67255046-67255068 AAGAAAAATTAATTCCAGGTGGG + Intergenic
1150691747 17:67373067-67373089 AACAAAAATTAATTGTAGGCTGG + Intergenic
1154261153 18:12834028-12834050 AAAAACAATTACTAGGAGGCTGG + Intronic
1154408370 18:14118351-14118373 AAGAATAATTCATTGTGGCCAGG - Intronic
1155644047 18:28055499-28055521 AAGAAGAGTTATTTGGAGACTGG + Intronic
1155647390 18:28095519-28095541 AAAAATAATTAATTACAGGCTGG + Intronic
1155970454 18:32078084-32078106 AAAAAATATTTATTGGAGGCTGG - Intergenic
1156479668 18:37428091-37428113 ATGAGTAATTAATTGGTGGGTGG + Intronic
1156951322 18:42902582-42902604 AATAATAATTTATTGGAAGATGG + Intronic
1157337624 18:46753183-46753205 ATGAATAAATAATTGAAGGTAGG - Intronic
1157751551 18:50183238-50183260 TAGAATAATTACTGGGAGGTGGG - Intronic
1157886984 18:51378119-51378141 AAGAAGAACTAATTAAAGGCAGG - Intergenic
1158009486 18:52712253-52712275 AAAATTAAGTAAGTGGAGGCTGG - Intronic
1158325340 18:56307833-56307855 CAAAATAATTAATTTGAGTCTGG + Intergenic
1158970886 18:62665360-62665382 AAGAATAATTTCTTGAGGGCAGG - Intergenic
1159858260 18:73615182-73615204 AAGATTAATTCCATGGAGGCTGG - Intergenic
1160272395 18:77399013-77399035 ATGAAATATTAATTGGAGGAGGG - Intergenic
1161194488 19:2978451-2978473 AAAAAAAATTAAGTGTAGGCTGG + Intronic
1161243789 19:3237751-3237773 AAGAATATCTAACTTGAGGCCGG + Intronic
1162678627 19:12320842-12320864 AAGAATAAATAAATTTAGGCTGG + Intronic
1162684588 19:12371094-12371116 AAGCATCATGAATTGGAAGCTGG + Intergenic
1163122942 19:15228813-15228835 AAAAATTATTTTTTGGAGGCCGG - Intronic
1163464244 19:17457099-17457121 AAAAAAAAAAAATTGGAGGCTGG + Intronic
1163504492 19:17697391-17697413 TGGCATAATTAATTGGAGGGAGG - Intergenic
1163564801 19:18044647-18044669 AATAAAAAATAAGTGGAGGCTGG + Intergenic
1164613485 19:29649604-29649626 AAGAATAATTCAGTGGAGTTTGG + Intergenic
1164850318 19:31477859-31477881 AAAAATAATTAATTTTTGGCTGG - Intergenic
1164882408 19:31744447-31744469 ACCAAAAATTAATTGGAGGAAGG - Intergenic
1165873243 19:38988114-38988136 AACAATAATAAATAAGAGGCCGG - Intergenic
1167570346 19:50283414-50283436 CAGACTAATTATTTTGAGGCTGG - Intronic
1168281476 19:55308318-55308340 AAGAAAAATAAGTTGGAGCCAGG - Intronic
1168527796 19:57102750-57102772 AAGATTAATTATTTTTAGGCTGG + Intergenic
925269758 2:2595594-2595616 AAGAATAATTAATACCAGTCAGG + Intergenic
925676546 2:6368023-6368045 ATGAAAAATGAATGGGAGGCCGG + Intergenic
926190650 2:10724943-10724965 AAGAAAAATAATTAGGAGGCTGG - Intronic
926283420 2:11468532-11468554 AAGAATACTTTATAGAAGGCCGG + Intergenic
927024630 2:19053417-19053439 AAGAATAATTCATTGGACTTTGG - Intergenic
927050797 2:19326395-19326417 AATAATAATTAATTAAAGGCAGG + Intergenic
927931471 2:27048234-27048256 AAAAATAAATAAATGTAGGCCGG - Intronic
928573598 2:32632105-32632127 AAAAAAAATTAAATGGAGGCTGG - Intronic
928732777 2:34251900-34251922 AAAAATAATAAATTAGAGACAGG - Intergenic
929101561 2:38319809-38319831 AAAAATAATCAATTTTAGGCTGG + Intronic
929554281 2:42915606-42915628 AAAAATAACTCTTTGGAGGCCGG - Intergenic
929700621 2:44159877-44159899 AAGAATAATTCTTTTCAGGCTGG - Intergenic
930016765 2:46976023-46976045 AAAAAGAATAAAATGGAGGCTGG - Intronic
932154549 2:69404132-69404154 AAGAATAATTAATTGGAGGCCGG - Intronic
932464645 2:71909729-71909751 AAAAATTTTTAATTGGAGGCTGG - Intergenic
932651151 2:73558723-73558745 AAGAAAAACTAATTGCAGGTGGG - Intronic
935873083 2:107472680-107472702 AAGATTAATTAATAGGACACAGG - Intergenic
936046323 2:109190796-109190818 AAAAATGATTAATTTGAGCCTGG - Intronic
936749442 2:115623138-115623160 AAGAATAAATGAATGGAGCCGGG - Intronic
937420794 2:121753647-121753669 AAAAATTATTTATTTGAGGCAGG + Intronic
937821872 2:126319260-126319282 AAGAATAATTGATGGGAAGATGG + Intergenic
939727753 2:145744474-145744496 AAGAATGATTAATTATGGGCCGG - Intergenic
939865552 2:147468731-147468753 AAAAATAATTAAATGAAGGGCGG - Intergenic
941080384 2:161054272-161054294 AAGAGTAATTCATAGTAGGCTGG + Intergenic
941117996 2:161493751-161493773 AAGAATAATAAATTGGAGAAGGG + Intronic
941827573 2:169917062-169917084 AAGAAAAATTAATTCAGGGCAGG - Intronic
942311053 2:174657358-174657380 AAAATTTATTAATTGGAGGTAGG - Intronic
942513274 2:176725312-176725334 AGGAATCATTGATTGTAGGCTGG + Intergenic
943059153 2:183020164-183020186 AAAAATAAATATTTTGAGGCTGG + Intronic
944343911 2:198637322-198637344 AAGAAAAATAAAGTGGAGGTAGG - Intergenic
944568460 2:201016575-201016597 AATAATAAATAAATTGAGGCCGG - Intronic
944623330 2:201542053-201542075 AAAAATACTTAATTGCTGGCTGG - Intronic
945407274 2:209464434-209464456 AAGAATAAATTATTGCAGTCAGG + Intronic
946110559 2:217411733-217411755 ATTAAAAATTAAATGGAGGCTGG + Intronic
946589512 2:221228848-221228870 ATGAAAAGTTAAATGGAGGCAGG - Intergenic
947410656 2:229835414-229835436 ACGAATATATAATTGAAGGCTGG - Intronic
1168901181 20:1366257-1366279 AACACTCAGTAATTGGAGGCAGG - Intronic
1169118014 20:3079087-3079109 AAGAACAAGTAATAGGAGGCTGG - Intergenic
1169438802 20:5616833-5616855 AAGAATAATCACTTATAGGCCGG + Intergenic
1169969515 20:11254359-11254381 AAGAAAAATTATTTGTTGGCTGG - Intergenic
1170838434 20:19904629-19904651 AAGTATAATGAATGGCAGGCCGG + Intronic
1171996904 20:31738570-31738592 ACCGATAATTAATTAGAGGCCGG - Intergenic
1171999412 20:31761183-31761205 AAAAAAAATTAATTGAAGGAGGG - Intronic
1173078996 20:39848271-39848293 AAAAATATTTAATAGGAGGTAGG + Intergenic
1173281772 20:41634847-41634869 AAAAAAAATAAATAGGAGGCTGG + Intergenic
1173483163 20:43419340-43419362 AAGAATAATTAAAAAGTGGCTGG + Intergenic
1173779460 20:45742509-45742531 AAGAATAATTTATTGACAGCTGG - Intergenic
1174003377 20:47390943-47390965 AAGTATAAATAACAGGAGGCTGG - Intergenic
1174300274 20:49576951-49576973 AAAAAGAATTGAATGGAGGCTGG + Intergenic
1174633142 20:51975727-51975749 AAAAATTATGAATTTGAGGCTGG - Intergenic
1174757359 20:53173310-53173332 AATAATAATAAAGCGGAGGCTGG + Intronic
1175287971 20:57850584-57850606 AAGAATAATTGAAATGAGGCCGG - Intergenic
1178957968 21:37040545-37040567 AAGTATTATTTATTGCAGGCTGG + Intergenic
1179327020 21:40357293-40357315 CTGAATAATTAAGTGGAGACAGG + Intronic
1182013063 22:27016608-27016630 AAGACTGATGAGTTGGAGGCTGG - Intergenic
1182202758 22:28590423-28590445 AAGATTTAGAAATTGGAGGCTGG - Intronic
1182625724 22:31644533-31644555 AAAAATTATGAATTTGAGGCTGG - Intronic
1182631693 22:31690934-31690956 AAAAAAAATTAGCTGGAGGCCGG - Intronic
1182818155 22:33187620-33187642 AAGAATCACTAAGAGGAGGCCGG + Intronic
1183020077 22:35019851-35019873 AAGAATAAAGACATGGAGGCTGG - Intergenic
1183573808 22:38674201-38674223 AAAAAGAATTAAATGGAGCCTGG + Intergenic
1183645190 22:39121998-39122020 AAGAAGAATCAATTTTAGGCTGG + Intronic
1184316932 22:43701261-43701283 AAGAACAATGAATTAGAGGAGGG - Intronic
950058574 3:10049801-10049823 AAGAATAATTAAATTTAGCCTGG + Intronic
950908209 3:16558360-16558382 AAGAAAAATAAAATGGAGCCAGG + Intergenic
952966454 3:38623903-38623925 AATAATTATAAACTGGAGGCTGG - Intronic
953745443 3:45570495-45570517 AAAAGTAACAAATTGGAGGCCGG + Intronic
953989332 3:47472136-47472158 AATAATAATTAAATGGGGCCGGG + Intronic
954909127 3:54088135-54088157 AAGAATAGTTAGTTTGAGGCTGG - Intergenic
955144175 3:56299724-56299746 AAGAATATTTAAATGACGGCCGG - Intronic
955190821 3:56759840-56759862 AAAAATGGTTAATTGTAGGCTGG - Intronic
955640532 3:61078272-61078294 AATAAAAATTAATTAGAAGCTGG - Intronic
956274393 3:67482233-67482255 AAGAATTGTTGATTGCAGGCTGG + Intronic
957235792 3:77588650-77588672 AAGAAAAATTATTTGAAGGCAGG - Intronic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
958614984 3:96481857-96481879 AAGATTAATTAAATGGAAGGAGG + Intergenic
959307299 3:104684447-104684469 AAGGATATTGATTTGGAGGCTGG - Intergenic
959320160 3:104863370-104863392 AAAAAAAATCAAATGGAGGCTGG + Intergenic
960803646 3:121562552-121562574 AAAAATAATTAAATAGAGACAGG + Intergenic
960867628 3:122218112-122218134 CAGAATAATGGATTGGAGGGGGG + Intronic
961967709 3:130923569-130923591 AAGAATAACTACTTCTAGGCCGG + Intronic
962586902 3:136850977-136850999 AATAATAATTATTTTGAGACAGG - Intronic
964288296 3:155145839-155145861 AAGTATCATTAAGTGGGGGCTGG + Intronic
964629674 3:158796573-158796595 AAGAGAAATCAATTGAAGGCAGG + Intronic
964814144 3:160698601-160698623 TAGAAGAACTAAATGGAGGCAGG - Intergenic
965352562 3:167631939-167631961 AAGAATAATTAACTCCTGGCTGG - Intronic
965564722 3:170102692-170102714 ATGGATAAGTAATTGGAAGCTGG + Exonic
965726683 3:171724533-171724555 TAGAATATTTAAATGGATGCTGG + Intronic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
970166300 4:13241752-13241774 AAGAATAAATAAATGGAGCCAGG - Intergenic
972961563 4:44459548-44459570 TAAAATAAAGAATTGGAGGCAGG + Intergenic
973114608 4:46439758-46439780 AAAAATAATTAATTTTTGGCTGG - Intronic
973243367 4:47983098-47983120 AAGAATATTCATTTTGAGGCTGG - Intronic
973276867 4:48319455-48319477 AAGAATTATTAAGTGTTGGCCGG + Intergenic
973318402 4:48784748-48784770 AAGAATAATTAAGTCAAGGAAGG - Intergenic
973607713 4:52603979-52604001 AAGAATAGGTGATTAGAGGCTGG - Intronic
974583431 4:63836948-63836970 AAGAATCATCAGGTGGAGGCAGG + Intergenic
975472680 4:74788389-74788411 AAGGATAATTTATTACAGGCTGG - Intronic
975704632 4:77099582-77099604 AAAAATAATTTTTTAGAGGCTGG + Intergenic
975835948 4:78422356-78422378 ATGAATATTTAATTGCAGTCTGG + Intronic
976306676 4:83566566-83566588 AACAAGAATAAATAGGAGGCCGG - Intronic
976938009 4:90663643-90663665 AAGAATAATAAAGTATAGGCTGG - Intronic
977759088 4:100709332-100709354 ATGAATAATAAATTTGAGGATGG + Intronic
977796419 4:101170756-101170778 AAGAATGATTAATTATAGGCTGG - Intronic
978801581 4:112760481-112760503 AAGAATATGGAATTTGAGGCTGG - Intergenic
979763375 4:124435218-124435240 AAGATAAAATAATTGGAGGCTGG - Intergenic
981030932 4:140125270-140125292 AAAAGTAATTTATTGGAGCCAGG + Intronic
981846171 4:149172504-149172526 AAAAATGGTTAATAGGAGGCTGG - Intergenic
982329637 4:154166704-154166726 AGGAAGAATTGATTGGAAGCAGG + Intergenic
982710389 4:158752669-158752691 AAGAATTACAAATTTGAGGCTGG + Intergenic
985337940 4:188915975-188915997 CAGGATATTTAATTGGAGGCAGG - Intergenic
985983242 5:3489383-3489405 CTGTATAATTAAGTGGAGGCCGG + Intergenic
986975836 5:13392780-13392802 AACTATAATTACTTGGAGGGTGG + Intergenic
987033738 5:13999166-13999188 AAAAGTAATTAATGGCAGGCCGG - Intergenic
987553122 5:19409772-19409794 AAGAATAATTAATGGGTAGTAGG - Intergenic
987935190 5:24454737-24454759 AAAAATAATTAATTGGGAACAGG + Intergenic
987995822 5:25277417-25277439 AATAATGATTAATTAGAGGAGGG + Intergenic
988406613 5:30832125-30832147 AGGATTAATTAATTCTAGGCAGG + Intergenic
990173950 5:53086311-53086333 AATAATACTTAATTTGGGGCAGG - Intronic
990589451 5:57247738-57247760 AAGAATAATTTTTTGGGGGGTGG + Intronic
990857809 5:60290505-60290527 TAGAATAATACATAGGAGGCAGG + Intronic
991458366 5:66829138-66829160 AAGAATAGTTAAATTGTGGCTGG + Intronic
991983428 5:72257786-72257808 AAGATTAAAGAATTGGAGGCTGG + Intronic
993198334 5:84780161-84780183 AAGAATAATTAATTAAATTCAGG + Intergenic
993507998 5:88735024-88735046 AAGAATAACAATTTGGTGGCTGG - Intronic
994441363 5:99808847-99808869 AATTATAGTTAATGGGAGGCTGG - Intergenic
994822194 5:104668050-104668072 AACAGTAATTAAGAGGAGGCTGG - Intergenic
994991715 5:107004959-107004981 AAGCATATTTAATTGGGGGAGGG - Intergenic
996522204 5:124439544-124439566 AAGAATAGTTAACTAGAAGCTGG + Intergenic
996555615 5:124776249-124776271 ATGAAGAATTAATTGGAGGGTGG + Intergenic
997144611 5:131419329-131419351 AAGAATTATTATTTGGTGGGCGG - Intergenic
997445592 5:133937483-133937505 AAGAATTCTTAATTGGGGGAGGG + Intergenic
998678914 5:144442659-144442681 AAGAATGATTAAGAAGAGGCTGG - Intronic
999954752 5:156688204-156688226 TAGAATAATTATTGGGAGGAGGG - Intronic
1000106323 5:158062500-158062522 AAGAATAAGTATTTGGAATCTGG - Intergenic
1000403271 5:160855849-160855871 AAGAACAATTCAATGGAGGAAGG - Intergenic
1000716386 5:164650138-164650160 AAGAAAATTCAATGGGAGGCCGG + Intergenic
1000740343 5:164961207-164961229 AAGAATAATTCATGGGGTGCTGG - Intergenic
1000813889 5:165895959-165895981 AAGAATACTACATTGGAGTCAGG + Intergenic
1001398527 5:171433279-171433301 GAAAATCATTAATGGGAGGCCGG + Intronic
1002510550 5:179713619-179713641 AAGAAAAAGTAAATGGAGCCAGG + Intronic
1002711270 5:181196407-181196429 AACAATAATACAGTGGAGGCCGG + Intronic
1003105929 6:3215934-3215956 ATGAAATATTAAGTGGAGGCTGG - Intergenic
1003828712 6:9981036-9981058 AAGAATAATTATTGGTGGGCAGG - Intronic
1004255913 6:14064284-14064306 AATAATAAATAATGGGGGGCTGG + Intergenic
1004580672 6:16948193-16948215 GAGAATAATTTATTAGAGGATGG + Intergenic
1004713903 6:18198523-18198545 AAAAAAATTTAACTGGAGGCCGG - Intronic
1004769478 6:18765635-18765657 AAGAAATATTTATAGGAGGCAGG + Intergenic
1007118463 6:39361260-39361282 AAGAAGAATGGGTTGGAGGCTGG + Intronic
1007175436 6:39893218-39893240 AAGAATTAGTCAGTGGAGGCTGG + Intronic
1007549547 6:42718460-42718482 ATTAATAATTATTTTGAGGCAGG - Intronic
1008809687 6:55481082-55481104 AACAATAATTTATTGCAGGCTGG + Intronic
1009451384 6:63804820-63804842 GTGGATAATTAATTGCAGGCAGG + Intronic
1009595762 6:65733779-65733801 AAGAATTAGTAATTAGTGGCAGG + Intergenic
1011260018 6:85461148-85461170 ACAAATAAATAATTGGAGGGAGG + Intronic
1011994860 6:93573140-93573162 AAGAATCATTTATTGGGGGCAGG + Intergenic
1013689759 6:112627552-112627574 AAGAATAAAGAATGGGAGGCTGG - Intergenic
1014034743 6:116753330-116753352 ATGAAAAATGAATTGGAGACAGG + Intronic
1014946866 6:127509273-127509295 AAGAAGAATTGAGTAGAGGCAGG - Intronic
1015324498 6:131909058-131909080 AAAAATAAAGAATTGGAGGCTGG + Intergenic
1015454978 6:133416206-133416228 AAGAAGATGAAATTGGAGGCAGG + Intronic
1015516180 6:134084843-134084865 AAGAAGTGTGAATTGGAGGCCGG + Intergenic
1015621030 6:135131792-135131814 AATAATAATTAAATAGAGACAGG + Intergenic
1016074800 6:139782820-139782842 AAAAATGATAAATTGTAGGCTGG - Intergenic
1016158572 6:140846042-140846064 AAAAAAAAGTATTTGGAGGCTGG + Intergenic
1016458370 6:144255920-144255942 ATAAATAAGTAATTAGAGGCTGG - Intergenic
1016720601 6:147292544-147292566 AATAAAAATCAATTGGTGGCAGG - Intronic
1016928622 6:149379941-149379963 AAGAATAAGTAATTCTTGGCTGG + Intronic
1018308130 6:162479770-162479792 AAAAATAATTAGTAGGAGCCAGG + Intronic
1018958053 6:168425993-168426015 AGGAATAATTAACTGAAAGCAGG + Intergenic
1019959883 7:4450157-4450179 ATTAATAACTAAATGGAGGCTGG + Intergenic
1023125671 7:36951920-36951942 AAGAATGATTAAATGAAGGGGGG + Intronic
1023270290 7:38455365-38455387 CAGAATAAAGAATTGTAGGCTGG - Intronic
1024442782 7:49440762-49440784 AACAATGATTAATTGGAAGTTGG + Intergenic
1024859285 7:53818812-53818834 AATAATAATTTAGTGGAAGCGGG - Intergenic
1024967868 7:55040362-55040384 AGGGATAATTAATAGGAGGAAGG + Intronic
1026331324 7:69354966-69354988 AAAAAAAATTATTTGTAGGCCGG - Intergenic
1026339492 7:69423240-69423262 AAGATTTATTAATTGAGGGCAGG - Intergenic
1026865371 7:73820966-73820988 AACAAAAATAAAATGGAGGCCGG - Intronic
1026994906 7:74609217-74609239 AAAAATAAGTTATTGTAGGCTGG - Intergenic
1027038814 7:74946138-74946160 ATAAATAACTAAATGGAGGCTGG - Intergenic
1027287099 7:76657378-76657400 AAGATTAATTAATTTGAAGAAGG - Intergenic
1027682569 7:81238609-81238631 AAGAAACATTGTTTGGAGGCTGG - Intergenic
1029791359 7:102846320-102846342 AAAATTAATTAATCTGAGGCTGG + Intronic
1030021312 7:105278016-105278038 AAGAATAATTATTTGAGGCCAGG + Intronic
1030845041 7:114399402-114399424 AAGAAAAAATAAGTGAAGGCTGG - Intronic
1030958754 7:115888853-115888875 AAGAGAAATTACTTGGTGGCTGG + Intergenic
1031251233 7:119384298-119384320 AAGAATAATTAATTTGTAGAGGG + Intergenic
1031945472 7:127835157-127835179 AAGAATAATTAGTGGGGGGAAGG - Intronic
1033864063 7:145666380-145666402 AAGAATAATGTATTTTAGGCTGG - Intergenic
1034011474 7:147533608-147533630 AAAAATACTTACTTGGAGCCAGG + Intronic
1034502361 7:151459078-151459100 AAGAAAAATAAATTTGGGGCCGG - Intergenic
1035156224 7:156915535-156915557 AAGAAAAATTAATGGGGGGGAGG - Intergenic
1037159166 8:15746301-15746323 ATGAATAATTAATTTGGGGGTGG - Intronic
1037235155 8:16711267-16711289 ACGAATAATTCCTTGGAGGTGGG - Intergenic
1037273519 8:17155736-17155758 AAGAATAAATAGTTGGTGGAAGG + Intergenic
1037542121 8:19882173-19882195 AATATATATTAATTGGAGGCTGG - Intergenic
1038353218 8:26800395-26800417 AAAAATAATTCAATGGAGGAAGG + Intronic
1038527932 8:28292985-28293007 AAAAAAAATTATTTAGAGGCGGG - Intergenic
1039026937 8:33268638-33268660 AAGAATGATTAATTAGGGCCAGG - Intergenic
1039140108 8:34377631-34377653 TAGAATATTTAATAGGGGGCAGG + Intergenic
1039544339 8:38397841-38397863 AAGAATAAAGACTTGAAGGCCGG + Intronic
1039797537 8:40928007-40928029 AAGATTAATTATTTAGAGGCTGG - Intergenic
1040351865 8:46577042-46577064 AAGTATAATCATTTGGAGGCTGG + Intergenic
1040823298 8:51589553-51589575 AAGAACAAGTTATTGGAAGCTGG + Intronic
1040873871 8:52129746-52129768 GAAAATAATAACTTGGAGGCTGG + Intronic
1040950279 8:52931729-52931751 AAGAAAAATAAATTTTAGGCCGG - Intergenic
1041111018 8:54482528-54482550 AAGAATAGTAAATAGGAGCCAGG - Intergenic
1041695359 8:60730562-60730584 TAGAAATATTAAATGGAGGCCGG + Intronic
1042322457 8:67491184-67491206 CAGAAGAATCAATTGGAGTCGGG + Intronic
1042922717 8:73935614-73935636 AAGGATACTGAATTGGAAGCAGG - Intergenic
1043697659 8:83241031-83241053 AAGAAAAATAAATGAGAGGCAGG - Intergenic
1043862417 8:85335151-85335173 AAGAATAATTAATTACAAGTAGG - Intronic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1045577376 8:103439284-103439306 AAGAATAATTTAATAGAGCCAGG - Intronic
1045983991 8:108226490-108226512 AAGAATTATTGAATGTAGGCCGG - Intronic
1048025752 8:130585104-130585126 AAGAAGGATAAAATGGAGGCAGG + Intergenic
1048392288 8:133979001-133979023 AAGAGTAATTAATTGGCTGTTGG - Intergenic
1048712129 8:137224319-137224341 AGGTATAATAAATTGCAGGCTGG + Intergenic
1050285572 9:4098331-4098353 AAGAATTACTAATGGGGGGCTGG + Intronic
1051082846 9:13313043-13313065 AAAAATAATTACATAGAGGCAGG - Intergenic
1052281936 9:26742855-26742877 AAGAATAAAGAATGGGAGGAAGG + Intergenic
1052588514 9:30460345-30460367 AAGAATAATTGCTTATAGGCTGG + Intergenic
1053058964 9:35013958-35013980 AAGAATAATTATGTGCTGGCTGG + Intergenic
1053195497 9:36115017-36115039 AAAAATAATTAATTGTGGCCGGG + Intronic
1053390468 9:37731574-37731596 AAAAATAATCATTTGGAGCCGGG + Intronic
1054997193 9:71405977-71405999 AACAATAAAAAATTGGTGGCTGG + Intronic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056614635 9:88153360-88153382 AAAAATAATTAAATGGAGGAAGG - Intergenic
1057107537 9:92434092-92434114 TAGAATGAATAATTGGAGACTGG + Intronic
1058252023 9:102710971-102710993 AAGAATAAATAATTAGAGCTGGG + Intergenic
1059133079 9:111775292-111775314 AAAAATAATTAAAAGTAGGCCGG - Intronic
1059677822 9:116556446-116556468 ACGAAAAATTAAGTGGAGTCTGG - Intronic
1059705544 9:116820106-116820128 AAGGACAATTAACTGGAGGAGGG - Intronic
1059987336 9:119833518-119833540 GAGAAGAAATAATTGGAGGATGG - Intergenic
1062545308 9:137060228-137060250 AAGAATAGTTAATAGGGGTCTGG - Intergenic
1185757361 X:2662356-2662378 AAAAATGATAAATTGGCGGCTGG + Intergenic
1186128866 X:6444976-6444998 AAGAAAATAAAATTGGAGGCAGG + Intergenic
1186246840 X:7623910-7623932 AAAAAGAATTGATTGGATGCAGG - Intergenic
1187164863 X:16795696-16795718 AGGGATCATAAATTGGAGGCAGG - Intronic
1187190866 X:17033714-17033736 GAGAATAATGAATTGGAAGAAGG - Intronic
1187277182 X:17826491-17826513 ATGAATATTTATTTGGAGGGAGG + Intronic
1188360580 X:29247860-29247882 AAGGATAATTATTTGGTGGTGGG + Intronic
1189123034 X:38415373-38415395 AAGAATAATTTATTTGCGGCCGG - Intronic
1190303620 X:49070286-49070308 AAGAAAAAAAAATTGTAGGCCGG + Intergenic
1190358582 X:49627999-49628021 AAGAATGACTGACTGGAGGCAGG - Intergenic
1190481511 X:50881824-50881846 AGGAATAGGTTATTGGAGGCTGG - Intergenic
1190842239 X:54156010-54156032 ATGCACAATTAATAGGAGGCAGG + Intronic
1192085630 X:68094358-68094380 AAAAATAATAAACTGGAGGTAGG - Intronic
1192431767 X:71117366-71117388 AAGAAGAAGTAATTCAAGGCGGG - Intergenic
1192593208 X:72379152-72379174 AAAAATAACTAAATGGTGGCCGG - Intronic
1192904355 X:75534515-75534537 AAGAATAATATATTGGACTCTGG - Intergenic
1193276636 X:79596467-79596489 AAAAATAACTAATGGGTGGCCGG - Intergenic
1193561559 X:83023328-83023350 AGAAATACTTAATTTGAGGCGGG + Intergenic
1193815411 X:86099539-86099561 AAGAATAATGAATTTGGAGCCGG - Intergenic
1194396914 X:93397426-93397448 AGGAAAAATTAAAAGGAGGCTGG + Intergenic
1194693646 X:97017875-97017897 AAGTATAATTAATTTGTGGCAGG - Intronic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1195555464 X:106217220-106217242 AAAAATTATTTATTGGAGGCTGG + Intergenic
1195708490 X:107755839-107755861 AAGAAGAAATCAATGGAGGCTGG + Intronic
1196292174 X:113955679-113955701 AAGAAAAATGATTTGTAGGCCGG + Intergenic
1196789261 X:119449431-119449453 AAGAAGAATGAATTGGAGGCTGG + Intronic
1197483800 X:127021569-127021591 AAGAATAATTTATTGTTTGCAGG - Intergenic
1197687076 X:129451997-129452019 GAGAATAAAAAAATGGAGGCTGG - Intronic
1197862416 X:130984813-130984835 AAGATTTATTATTTGGAGACAGG + Intergenic
1197878905 X:131143826-131143848 AAGAATGATGTAATGGAGGCCGG + Intergenic
1197910669 X:131479714-131479736 AAGAACCATCAAATGGAGGCAGG - Intergenic
1198694669 X:139322983-139323005 AAGAAGGATGAATTGGGGGCTGG + Intergenic
1200139156 X:153889647-153889669 AAAAATAATAAAGTGGAGGTGGG - Intronic
1202031912 Y:20584346-20584368 AAAAAAAATTAATTAGATGCCGG - Intronic