ID: 932158265

View in Genome Browser
Species Human (GRCh38)
Location 2:69437704-69437726
Sequence GCTAGGTTTTTAGCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932158259_932158265 -1 Left 932158259 2:69437682-69437704 CCGTACTTTGTTTTCCCTGTTGG 0: 1
1: 1
2: 2
3: 28
4: 312
Right 932158265 2:69437704-69437726 GCTAGGTTTTTAGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932158265 Original CRISPR GCTAGGTTTTTAGCTGGTGC TGG Intergenic
901650847 1:10742408-10742430 GCTTGGTGTGTAGCTGGTCCAGG + Intronic
902668464 1:17955418-17955440 TCAAGCTTTCTAGCTGGTGCTGG + Intergenic
906635560 1:47407905-47407927 GCTAGATTTCTGGCTGGTGGGGG + Intergenic
909761321 1:79291018-79291040 GCTCGATTTTTATCTGCTGCAGG - Intergenic
912425401 1:109584227-109584249 ACTAGATTTTTTCCTGGTGCAGG + Intronic
913270465 1:117088045-117088067 GCTAGATTTTGAGCTCTTGCAGG + Intronic
917655884 1:177124961-177124983 GCTAGGCACTTAGCTGATGCTGG - Intronic
922027089 1:221760252-221760274 GCTGGGTTGTTAGCAGGAGCAGG - Intergenic
922395250 1:225193195-225193217 GCAAGGTATTTTGGTGGTGCTGG - Intronic
1064093728 10:12407291-12407313 TCTGGGTTTTAAGCTGGGGCTGG - Intronic
1066440775 10:35436398-35436420 GTTAGGTTTTCTGCTGCTGCTGG + Intronic
1067095901 10:43299680-43299702 GCCAGGGTTTTACCTTGTGCTGG - Intergenic
1077146294 11:1047663-1047685 GCGAGGTTTCTCGGTGGTGCTGG + Intergenic
1077782837 11:5350508-5350530 TCTAAGATTTCAGCTGGTGCAGG - Intronic
1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG + Intergenic
1088569656 11:111210717-111210739 GCTAAGTTTTCATCTGGTGCAGG - Intergenic
1088608552 11:111555076-111555098 TCTACGTTTATAGATGGTGCTGG + Intronic
1090914859 11:131154419-131154441 GCGGGGTTTTTAGCTGAAGCAGG - Intergenic
1091192084 11:133704460-133704482 GCTATGATTTTACCTGATGCAGG - Intergenic
1091450374 12:569072-569094 GCCGGGGTTTCAGCTGGTGCTGG + Intronic
1092368904 12:7900146-7900168 GTTACGTTTTTAGTTGGGGCGGG + Intergenic
1096541109 12:52307719-52307741 GCATTGTTTTTAGGTGGTGCAGG + Intronic
1096623072 12:52876590-52876612 GCTGGGTTGGCAGCTGGTGCTGG - Intergenic
1103013496 12:117476167-117476189 GCTAGGATTGTAGCAGATGCAGG - Intronic
1104545426 12:129708365-129708387 GCTTTGTATTTAGCTGGTGAAGG - Intronic
1109756636 13:66769866-66769888 GCTAGGTTTTTATTAGGGGCTGG + Intronic
1111061508 13:83025220-83025242 TCTAGGTGTTTTCCTGGTGCTGG - Intergenic
1113744512 13:112734236-112734258 GCTTGGCTTTTAATTGGTGCTGG + Intronic
1116360958 14:43997381-43997403 ACTAGATTTTTTGCTTGTGCTGG - Intergenic
1122245517 14:100400452-100400474 GCTGGGCTATTAGCTGGTGCTGG - Intronic
1128594136 15:68929342-68929364 GCTAGGTTTTGAGCTGGGAACGG - Intronic
1129922656 15:79333148-79333170 GCTAGGACTTTACCTGGTACAGG + Intronic
1131845348 15:96485133-96485155 CCTAGGTTTTTATCTGGCCCTGG - Intergenic
1133041606 16:3063908-3063930 GCATGACTTTTAGCTGGTGCAGG + Intergenic
1134514190 16:14873535-14873557 GCCAGGTTTTTAGCTGGGGGTGG + Intronic
1134701832 16:16272034-16272056 GCCAGGTTTTTAGCTGGGGGTGG + Intronic
1134969998 16:18522616-18522638 GCCAGGTTTTTAGCTGGGGGTGG - Intronic
1135407799 16:22210585-22210607 GTTGGGTTTGAAGCTGGTGCGGG - Intronic
1137766668 16:50982699-50982721 GATTGCTTTTTAGCTGCTGCAGG - Intergenic
1139688958 16:68627093-68627115 GATTGGTGTTTGGCTGGTGCTGG - Intergenic
1144672405 17:17140362-17140384 GATGGGTTTTCACCTGGTGCTGG + Intronic
1145079000 17:19879069-19879091 GGTAGGATGTTAGCTGGTGATGG - Intergenic
1152179137 17:78806975-78806997 GCCAGTTTTTTGGCTGGTGGAGG + Exonic
1152746645 17:82043430-82043452 GCCAGGTTTGCACCTGGTGCTGG + Intergenic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1153611357 18:6888855-6888877 GCTAGGATTGCAGCTGGTGTGGG + Intronic
1155249238 18:23939408-23939430 GTCAGGTTCTGAGCTGGTGCTGG - Intronic
1162420688 19:10564659-10564681 CCTAGGTTATTACCTGGTGGTGG - Intronic
1163256187 19:16157386-16157408 GGTGGCTTTTTAGCTGCTGCCGG - Exonic
1163896889 19:20067173-20067195 GCTGGGTTTTTACCTGCTCCAGG - Intergenic
1165157866 19:33798593-33798615 GCTGGGTTTGATGCTGGTGCTGG + Exonic
1167096032 19:47375561-47375583 GCTGGCGTTTCAGCTGGTGCAGG - Exonic
926489732 2:13509577-13509599 GCTGGGATTTTAGCAGGTGTTGG - Intergenic
932158265 2:69437704-69437726 GCTAGGTTTTTAGCTGGTGCTGG + Intergenic
932357739 2:71080226-71080248 GCAAGCTTTTTACCAGGTGCTGG - Intergenic
932370147 2:71180163-71180185 GCAAGCTTTTTACCAGGTGCTGG - Intergenic
940070913 2:149686890-149686912 GCTAGGATCTTGGCTGATGCAGG + Intergenic
942369820 2:175271799-175271821 GCTAGGTTTTTAACTGAGGTTGG - Intergenic
944838756 2:203605504-203605526 GCTAGGTTTATAGCAGTTACAGG + Intergenic
1172452362 20:35035485-35035507 GCTCAGTTTTTAGCAGGTACAGG + Intronic
1178804264 21:35825363-35825385 GGTTGGTTTTTAGGTGGTCCTGG + Intronic
1179557358 21:42188274-42188296 GCTAGGCTTTTAGTTTGTGGAGG + Intergenic
1182709409 22:32311215-32311237 GCTGGCTTTCTAGCTGGGGCGGG - Intergenic
1183089797 22:35514077-35514099 GCTAGGATTTTAGCCTGGGCAGG + Intergenic
1184381944 22:44150277-44150299 GACAGGTTTTAAGCTTGTGCCGG + Intronic
1184396992 22:44248176-44248198 GCTAGCTTTCTAGCTGGGGCAGG - Exonic
952606980 3:35159760-35159782 GGTAGGTTTTCAGTTGGTGGTGG - Intergenic
957328763 3:78731969-78731991 GCTATGTATATAGCTGGTGTTGG - Intronic
958464514 3:94442070-94442092 TCTAGGCTTTTAGCAGGTCCTGG - Intergenic
959146446 3:102551545-102551567 GCTATGTTTGGAGCTGGAGCTGG + Intergenic
960578029 3:119246251-119246273 GCTAGGCTCTGAGCTGGTGCTGG - Intergenic
962416091 3:135183380-135183402 GCTCTATATTTAGCTGGTGCAGG - Intronic
968958046 4:3728931-3728953 TCTTGGGTTTGAGCTGGTGCAGG + Intergenic
973662579 4:53123353-53123375 GCTAGGTTTTTAAATGTTTCCGG + Intronic
983843286 4:172482837-172482859 GCCAGGTTTTTACTTTGTGCTGG - Intronic
989002520 5:36775850-36775872 GCTTGGTCTTCAGTTGGTGCTGG - Intergenic
989339060 5:40354211-40354233 GCTGGGTTTGCAGCTGGGGCTGG - Intergenic
989419097 5:41214994-41215016 TCTAGATTCTTAGTTGGTGCTGG - Intronic
989511977 5:42298562-42298584 GCTAGGTTTTTAGTTAGTATTGG - Intergenic
989567503 5:42915811-42915833 CCTAGGTTTTCAGCAGCTGCCGG - Intergenic
990106483 5:52269721-52269743 GCTGTGTTTTTAGTTAGTGCTGG - Intergenic
991095922 5:62739621-62739643 GCTACGCTTTCAGCTGGTGTTGG + Intergenic
997597239 5:135115175-135115197 GCTAGGTTTGGTGATGGTGCTGG + Intronic
1003049769 6:2768713-2768735 GCTATGTTTCTTGCTGTTGCTGG - Exonic
1003963441 6:11230685-11230707 GTTAGCTTTTTTGCTGGTGAAGG + Intronic
1004104089 6:12647824-12647846 GCTAGTTTTTTTGTTGGTGGTGG + Intergenic
1008326880 6:50192925-50192947 ACTTGGTTTTTACCTGGTGGTGG + Intergenic
1012791372 6:103701636-103701658 GCAAGGTACGTAGCTGGTGCAGG - Intergenic
1014847079 6:126290434-126290456 GCTAGGGTGTTAGCTAGTGGTGG + Intergenic
1016475902 6:144427691-144427713 CCTAGGTTTTTAGTTGGTTAAGG + Intronic
1021918021 7:25455142-25455164 GCTAGGTTCTTAGGTGGCCCCGG - Intergenic
1022984262 7:35635339-35635361 ACTAGGTTTGGAGCTGGTGGGGG + Exonic
1027446971 7:78285412-78285434 GCTAGTCATTTTGCTGGTGCTGG + Intronic
1031157197 7:118123449-118123471 TCAAGGTTTTTAGCTTGTGATGG - Intergenic
1033420719 7:141202657-141202679 GCAAGGCTTATAGCTGCTGCAGG - Intronic
1035591416 8:817762-817784 ACTAGGCTCTGAGCTGGTGCTGG + Intergenic
1036439171 8:8765069-8765091 GTTAGGATTTCAGCTGGTGAAGG + Intergenic
1039890193 8:41680734-41680756 GCTAGCTGTATTGCTGGTGCTGG + Intronic
1040300812 8:46187087-46187109 GCTCCGTTTTTTGCTGGTGGAGG + Intergenic
1043718422 8:83512423-83512445 GCTAGGTTTCTACCTTTTGCAGG + Intergenic
1057698703 9:97347434-97347456 GCTGGGCTCTTGGCTGGTGCAGG - Exonic
1059966143 9:119616244-119616266 GCTTGGTTTCTAGATGCTGCTGG + Intergenic
1188853775 X:35166249-35166271 GGTAGGTTTTTAACTGTTTCAGG - Intergenic
1189868014 X:45351768-45351790 GCTAGTTTTTCAGCTGTTTCAGG - Intergenic
1193817479 X:86121727-86121749 ACTAGGATTTGAGCTGGTGCTGG + Intergenic
1194311661 X:92316818-92316840 GCTTGGTTTTTAGCAGATGCAGG - Intronic
1195950711 X:110269736-110269758 GAAAGGTTTTTACCTGGTGGTGG - Intronic
1195996335 X:110735438-110735460 TCTAGGTTTTGATGTGGTGCAGG - Intronic
1200619936 Y:5430949-5430971 GCTTGGTTTTTAGCAGATGCAGG - Intronic