ID: 932165067

View in Genome Browser
Species Human (GRCh38)
Location 2:69498402-69498424
Sequence AGGATGCTCTGGGGTCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932165062_932165067 -9 Left 932165062 2:69498388-69498410 CCTCTGGCATGAGGAGGATGCTC 0: 1
1: 0
2: 0
3: 16
4: 165
Right 932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG 0: 1
1: 0
2: 0
3: 33
4: 272
932165059_932165067 0 Left 932165059 2:69498379-69498401 CCAGTTCTGCCTCTGGCATGAGG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG 0: 1
1: 0
2: 0
3: 33
4: 272
932165057_932165067 25 Left 932165057 2:69498354-69498376 CCTGTCTCTGAATCTTGGTCTCT 0: 1
1: 0
2: 5
3: 39
4: 438
Right 932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG 0: 1
1: 0
2: 0
3: 33
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932165067 Original CRISPR AGGATGCTCTGGGGTCTACT GGG Intronic
900431780 1:2606134-2606156 AGGGAGCTCCGGGGTCTCCTGGG - Intronic
900966963 1:5965606-5965628 AGGCTGCTCTGGAGTCCTCTAGG - Intronic
902411301 1:16212911-16212933 AGCATGCTCAGGGGACTTCTTGG + Intergenic
902456926 1:16540252-16540274 AGACTTCTCTGGGGTCTCCTTGG - Intergenic
902474557 1:16674821-16674843 AGACTTCTCTGGGGTCTCCTTGG - Intergenic
902484304 1:16732923-16732945 AGACTTCTCTGGGGTCTCCTTGG + Intergenic
902495243 1:16867661-16867683 AGACTTCTCTGGGGTCTCCTTGG + Intronic
902544885 1:17183991-17184013 AGGATGCTCTGGGCGCTCCCTGG + Intergenic
903134304 1:21299263-21299285 AGGAAGCTCTGGGGACTCCTTGG + Intronic
906913692 1:49983869-49983891 AGGTTTTTCTGGGGTCTCCTGGG - Intronic
907959667 1:59266950-59266972 AGGTTTCTCTGGGGTTTACTTGG + Intergenic
908496548 1:64700329-64700351 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
909234903 1:73140382-73140404 AGGAGTCTCTGGGGTTTTCTAGG + Intergenic
910780364 1:90925911-90925933 AGGTTTCTCTGGGGTCACCTTGG - Intronic
912715060 1:111977605-111977627 AGGCTGCTCTTGGGTATCCTAGG - Intronic
917179036 1:172273847-172273869 AGTATTATCTGGGGACTACTGGG - Intronic
918128598 1:181605650-181605672 AGGTTGCTCTGAGGGCTGCTGGG - Intronic
920105731 1:203552063-203552085 AGGTTTCTCTGGGGTCACCTGGG + Intergenic
920918703 1:210279936-210279958 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
921497365 1:215857936-215857958 AGGTTGCTCTGGTGTCCCCTTGG + Intronic
921583725 1:216924945-216924967 AGGAAGCTTTGGGGTATGCTGGG - Intronic
922231408 1:223689937-223689959 AGGTTCCTCTGGGGTCCACTTGG + Intergenic
923208241 1:231778860-231778882 TGGAGTCTCTGGGGTCTCCTTGG - Intronic
923317582 1:232796239-232796261 AGGTTGCTCTGGGGTCCCCTTGG - Intergenic
1062958609 10:1556757-1556779 AGGAAGATCTGGGGTCTTCCTGG - Intronic
1065461871 10:25975510-25975532 AGGTTTCTCTAGGGTCTACTTGG + Intronic
1065810968 10:29443413-29443435 AGATTTCTCTGGGGTCTTCTTGG + Intergenic
1068770532 10:60815576-60815598 AGGTCTCTCTGGGGTCTACGGGG - Intergenic
1068988011 10:63124647-63124669 AGGTTTCTGTGGGGTCTCCTTGG + Intergenic
1069203375 10:65652353-65652375 AGGTTTCTCTGGTGTCTCCTTGG - Intergenic
1069416630 10:68206420-68206442 AGGATGCTCTGGGATGAACAGGG - Intronic
1071221780 10:83475560-83475582 AGAAAGCTCTGGGGTCTTCAAGG + Intergenic
1071471478 10:85987088-85987110 AGGCTGCCCTGGGGTCTGCTAGG - Intronic
1071962126 10:90817203-90817225 AGGTTTCTCTGGGGTTTCCTTGG - Intronic
1072481509 10:95813658-95813680 AGGTTTCTCTGGGGTCCCCTTGG + Intronic
1075545437 10:123351414-123351436 AGGAGGCTGTGGGGTCCTCTCGG + Intergenic
1076728054 10:132422382-132422404 AGAAGGCTCTGGGGCCTGCTGGG + Intergenic
1079622438 11:22570470-22570492 ATGATGCTCAGGGATCTACTTGG - Intergenic
1080055748 11:27904625-27904647 AAGCTGCTCTGGGGGATACTGGG + Intergenic
1082934528 11:58642615-58642637 AGGTTTCTCTGAGGTCTCCTTGG + Intronic
1083069394 11:59961271-59961293 AGGTTTCTCTGGGGTCCTCTTGG - Intergenic
1083359118 11:62093150-62093172 AGGTTTCTCTGGGGTCCTCTTGG + Intergenic
1083360332 11:62102870-62102892 AGGTTTCTCTGGGGTCCTCTTGG - Intergenic
1084365441 11:68694524-68694546 AGGCTTCTTTGGGGTCTCCTTGG - Intergenic
1085251361 11:75145955-75145977 AGGTTTCTCTGGGGTCCCCTTGG - Intronic
1085401993 11:76241005-76241027 AGGATGCTCAGGGGTCTAAACGG + Intergenic
1087472085 11:98588218-98588240 AAGATTCTCTAGGGTCTCCTTGG + Intergenic
1091209306 11:133842972-133842994 AGGAAGCTGTGGGGTCCCCTGGG + Intronic
1091748850 12:3010306-3010328 TGGATGCTCTGGGGTTTTCCAGG + Intronic
1092219639 12:6703999-6704021 AGGATGCTCTGGGGCTTAAGGGG - Intergenic
1092384354 12:8024513-8024535 ACGATTCTCTAGGGTCTTCTAGG - Intergenic
1094038005 12:26091115-26091137 AGTATGCACTCGGATCTACTTGG + Intergenic
1094285149 12:28784187-28784209 AGGATTCTCTGGGGTCCCCTTGG - Intergenic
1094351423 12:29530184-29530206 AGGTTTCCCTGGGGTCTCCTTGG - Intronic
1094504497 12:31050065-31050087 AGAATCCTCTTGGGTCTTCTAGG + Intergenic
1094528055 12:31246079-31246101 AGTATGCTCTGGGCCCTCCTAGG + Intergenic
1094597672 12:31880034-31880056 AGCTTGCTCTGGGGTCCCCTCGG + Intergenic
1095231196 12:39742121-39742143 AGGTTTCTCTGGGGTTCACTTGG + Intronic
1099261216 12:80385267-80385289 AGGTTTCTCTGGGGTCCTCTTGG + Intergenic
1101916791 12:108902192-108902214 AAGATGCTATGGGGTCTCCCAGG - Intergenic
1101920958 12:108932615-108932637 AGGTTTCTCTGGGGTCCCCTTGG - Intronic
1101998190 12:109540065-109540087 AGGATTCTCTGGGGTCAAGGAGG - Intergenic
1102167283 12:110816689-110816711 GGGATGCTCTGGGATATTCTGGG + Intergenic
1102441494 12:112967290-112967312 AGGGTGGTCTGGGATCCACTGGG - Intronic
1103265351 12:119625179-119625201 AGAAAGCTCTGTGGTATACTGGG + Intronic
1103443534 12:120979982-120980004 AGGATGGCCTGGGGGCTACAGGG + Intronic
1104046225 12:125164906-125164928 AGCATTTTCTGGGGTCTCCTGGG + Intergenic
1104908433 12:132228022-132228044 AGCCTGCTCTGTGGTCTGCTGGG + Intronic
1105290663 13:19051034-19051056 TGGATGGTCTGGGGCCCACTGGG + Intergenic
1107380817 13:39855101-39855123 AGGTTTCCCTGGGGTCTTCTTGG - Intergenic
1107683739 13:42876316-42876338 AGGTTTCTCTGGGGTCCTCTTGG + Intergenic
1108920103 13:55662316-55662338 AGGTTTCTTTGGGGTCTCCTTGG + Intergenic
1111318551 13:86593303-86593325 AGGCTTCTCTGGGGTCCCCTTGG + Intergenic
1111559644 13:89928729-89928751 AGGTTTCTCTGGGGTCCTCTAGG - Intergenic
1112312155 13:98328323-98328345 AGGTTACTCTGGGGTCCCCTTGG + Intronic
1112608358 13:100930187-100930209 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
1113158461 13:107352309-107352331 AGGTTTCTCTGGGGTCCCCTTGG + Intronic
1113842149 13:113366284-113366306 AGGATGCTCGGGTGCCTGCTGGG - Intergenic
1113922805 13:113923570-113923592 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
1116322402 14:43485847-43485869 AGGTTTCTCTGGGGTCTTTTTGG + Intergenic
1119727800 14:76932713-76932735 AGGAGGCTCTGGGGGCTGCCGGG - Intergenic
1121544302 14:94752139-94752161 CTGATGCTCTGGGATCTCCTGGG + Intergenic
1123974097 15:25536206-25536228 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
1124009880 15:25829965-25829987 AGGATGCTCAGGTGTGTGCTAGG + Intronic
1124732567 15:32211689-32211711 AGGTTTCTCTGGGCTCTCCTTGG - Intergenic
1125452924 15:39827564-39827586 AGGTTACTCTGGGGTCCCCTTGG + Intronic
1125829222 15:42701643-42701665 AGGTTTCTCTGGGGTCTCCCTGG - Intronic
1126064779 15:44818268-44818290 AGGCTGCCCAGGGGTCTGCTAGG + Intergenic
1126095058 15:45082325-45082347 AGGCTGCCCAGGGGTCTGCTAGG - Intergenic
1128659079 15:69484730-69484752 AGGAGGCTCTGGGGTCCCATGGG - Intergenic
1129268169 15:74405664-74405686 TGCATTCTCTGGGGGCTACTGGG - Intergenic
1129347833 15:74935419-74935441 AGGCTGGTCTGGGGACTCCTGGG - Intronic
1131464959 15:92647476-92647498 AGGTTTCTCTGGGGTCCTCTTGG - Intronic
1132617849 16:851284-851306 AGGCTGCTCTGGGGACTCCAGGG + Intergenic
1135193812 16:20377984-20378006 AGAATGCTCTGGAGTTAACTAGG + Intronic
1135296092 16:21280453-21280475 AGGTTTTTCTGGGGTCTGCTTGG - Intronic
1136048378 16:27633170-27633192 AGGTTTCTCTGGGGTCCCCTTGG + Intronic
1139839374 16:69866085-69866107 AGGTTTCTCTGGCGTCTTCTTGG + Intronic
1141443170 16:84042388-84042410 AGGTTGCCTTGGGGTCTAGTGGG - Intronic
1141914747 16:87087585-87087607 AGGTTGCTATGGGGTCCTCTTGG - Intronic
1142183178 16:88681539-88681561 AGGAAGCTCTGGGGGCCTCTGGG - Exonic
1142249672 16:88985604-88985626 AGGTTGCCCCGGGGTCTGCTTGG + Intergenic
1143919211 17:10317588-10317610 AGGGTGCTCTGAGCTGTACTAGG - Intronic
1143995396 17:11002374-11002396 AGTTTGCTGTGGGGTCTCCTTGG - Intergenic
1144347914 17:14366777-14366799 AGGAGGCTCTGGGATCTCCAAGG - Intergenic
1144374637 17:14627147-14627169 AGGATTCTCTGGTCTCTTCTGGG - Intergenic
1145007859 17:19347677-19347699 GGAATGCTCTGGGGTCTCCAGGG - Intronic
1146581698 17:34044297-34044319 AGGATGCTCTGGGGCCCATCTGG - Intronic
1147934690 17:44004929-44004951 AGGAGGCTCTGGGGACTCGTGGG - Exonic
1149489028 17:57068649-57068671 AGTTTGCTCTGGGGTCTGCTTGG - Intergenic
1149881517 17:60296874-60296896 AGGATTTTCTGGGGTCCCCTTGG - Intronic
1151774082 17:76186615-76186637 AATATGCTCTGAGGTCTACTAGG + Intronic
1152111843 17:78360952-78360974 AGGGCGCCCTGGGGTCTCCTAGG + Intergenic
1152117095 17:78395019-78395041 AGGAGGCCCTGGGGTCTTCTCGG - Intronic
1153063699 18:1020962-1020984 AGGATGCTTTGTGAGCTACTTGG + Intergenic
1153444262 18:5154598-5154620 AGGTTACTCTGGGGTCCCCTTGG - Intronic
1156974037 18:43194586-43194608 AGGTTTCTCTGGGATCTCCTTGG + Intergenic
1157309622 18:46542567-46542589 AGGACTCTCTCGGCTCTACTGGG + Intronic
1157847729 18:51019039-51019061 AGTCTGATCTGGCGTCTACTGGG + Intronic
1158726789 18:59980870-59980892 AGATTTCTCTGGGGTCTCCTTGG + Intergenic
1158866264 18:61640289-61640311 AGGATTCTCTGGAGTCCCCTTGG + Intergenic
1158929580 18:62310475-62310497 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
1159208011 18:65279191-65279213 AGGTTTCTCTGGGGTCCACTTGG + Intergenic
1160667064 19:335854-335876 AGGATGGTCTTGGGTCGCCTGGG + Intronic
1163084170 19:14967410-14967432 AAGTTGTTCTGGGGTCCACTTGG - Intronic
1163928072 19:20364096-20364118 AGGCTGCCCTGAGGTCTCCTGGG - Intergenic
1164536724 19:29091610-29091632 TGGAAGCTCTGGGGGCTTCTGGG - Intergenic
1165692617 19:37875392-37875414 AGGTTTCTCTGGGGTCTCCTTGG - Intergenic
1165925183 19:39321767-39321789 AAGATGGTTTGGGGTCTAATGGG - Intergenic
1167267046 19:48488425-48488447 AGACTGCTCTGGGGTCTCTTGGG - Intronic
1167857393 19:52253728-52253750 AGGTTCCTCTGGGGTCCCCTTGG + Intergenic
1168187604 19:54709821-54709843 AGGATGCTCAGGGGGTCACTGGG - Intergenic
1202707874 1_KI270713v1_random:36904-36926 AGACTTCTCTGGGGTCTCCTTGG - Intergenic
925711796 2:6748281-6748303 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
926670768 2:15575032-15575054 AAGATTTTCTGGGGTCTCCTTGG - Intergenic
926815991 2:16797901-16797923 AGGTTGCTCTGGGGTTCTCTTGG + Intergenic
927950379 2:27164249-27164271 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
931270385 2:60696821-60696843 AAGATTCTCTGGGATCTAATAGG - Intergenic
931397476 2:61900654-61900676 AGGTTTCTCTGGGGTCCCCTTGG + Intronic
932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG + Intronic
932267739 2:70382847-70382869 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
933177536 2:79192211-79192233 AGGTTTCTCTGGGGTCTCCTTGG + Intronic
933582534 2:84143672-84143694 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
937112667 2:119378565-119378587 AGGTTTCTCTGGGGTCCTCTTGG + Intergenic
939615945 2:144362292-144362314 TGGATGCTTTGGGGTCTGATGGG - Intergenic
941690780 2:168498953-168498975 AGGTTACTCTGGGGTCCCCTTGG + Intronic
941987234 2:171521910-171521932 AGGTTTTTCTGGGGTCTGCTTGG + Intergenic
946133083 2:217622643-217622665 AGGATGCTCTGGGAGCCAGTGGG - Intronic
947166088 2:227263861-227263883 AGGATGCCATGGGGACTCCTGGG + Exonic
947751673 2:232535792-232535814 AGGATACTCTGGGGTCTGGAGGG - Exonic
948274555 2:236698156-236698178 TGGATGGGCTGGGGTCTGCTTGG - Intergenic
948874193 2:240818638-240818660 GGGAAGCTCTGGGGTCCACGTGG - Intronic
949039508 2:241841216-241841238 AGGTTTCTCTGGGGTCTCCTTGG + Intergenic
1168873567 20:1152746-1152768 AGGTGGCTCTGGGGTATATTTGG + Intronic
1169806528 20:9566030-9566052 AGTATTCCCTGGGGTCTCCTGGG + Exonic
1172845498 20:37927765-37927787 AGGCTCCGCTGGGGTCTCCTCGG - Intronic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1173370721 20:42432454-42432476 AGGTTTCTCTGGGGTCCCCTTGG - Intronic
1174163356 20:48567396-48567418 AGGTTTCTCTGGGGTCAGCTGGG - Intergenic
1175770144 20:61618338-61618360 AGGTTTCTCTGGGGTCCCCTTGG + Intronic
1176347262 21:5760798-5760820 AAAATGCTCTGGGGTTAACTGGG - Intergenic
1176354076 21:5881382-5881404 AAAATGCTCTGGGGTTAACTGGG - Intergenic
1176497565 21:7563657-7563679 AAAATGCTCTGGGGTTAACTGGG + Intergenic
1176541583 21:8158868-8158890 AAAATGCTCTGGGGTTAACTGGG - Intergenic
1176560534 21:8341913-8341935 AAAATGCTCTGGGGTTAACTGGG - Intergenic
1177192607 21:17868746-17868768 AACATGCACTAGGGTCTACTGGG + Intergenic
1177334082 21:19701024-19701046 AGTATCCTCTGGGGCCTTCTGGG + Intergenic
1178729192 21:35083495-35083517 TGGATGCAGTGGGGTCTAATAGG + Intronic
1178806124 21:35841080-35841102 AGGTTGCTTTGAGGTCTCCTGGG - Intronic
1179173240 21:38989353-38989375 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
1179448929 21:41454469-41454491 AGGTTTCTCTGGGGTCCACTTGG + Intronic
1180923681 22:19537240-19537262 AGGAGACTCTGGGATTTACTGGG + Intergenic
1181110602 22:20600660-20600682 AGGAAGCTCTGGGGACTTCTAGG - Intergenic
1182800995 22:33031788-33031810 AGGTTTCTCTGGGGTCCTCTTGG - Intronic
1183189673 22:36313838-36313860 AGGATGCTGGGTGGTCTTCTGGG + Intronic
1183227732 22:36561934-36561956 AGGATCCTCTGAGGTTTACTGGG - Intergenic
1184895898 22:47406269-47406291 AGGTTCCTCTGGGGTCCCCTTGG - Intergenic
1203246522 22_KI270733v1_random:75287-75309 AAAATGCTCTGGGGTTAACTGGG - Intergenic
951919741 3:27841288-27841310 AGGCTGCTGTGTGTTCTACTTGG + Intergenic
952573090 3:34741384-34741406 AGGATGATGTGGAGTCTAATGGG + Intergenic
952760158 3:36906364-36906386 AGGATGATCTGGGAACTTCTGGG + Intronic
953505799 3:43484760-43484782 AGGTTTCTCTGAGGTCTTCTTGG + Intronic
954290413 3:49646983-49647005 AGGATGCCCAGGGGTCATCTTGG - Intronic
955405843 3:58625177-58625199 AGATTTCTCTGGGGTCTCCTTGG - Intronic
955447286 3:59026925-59026947 AGGAAGCTTTGAGGTCTACGTGG + Intronic
956337190 3:68177225-68177247 AGCATGCCTTGGTGTCTACTTGG - Intronic
959499165 3:107085630-107085652 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
959781587 3:110240512-110240534 AGGTTTCTCTGTGGTCTCCTTGG + Intergenic
960298659 3:115974905-115974927 AGGTTTCTCTGGGGTCCCCTTGG + Intronic
962177815 3:133173592-133173614 AGCATGCAATGTGGTCTACTTGG + Intronic
963498050 3:146094097-146094119 AGGCTGCTCTGGGCACTCCTGGG + Intronic
963762342 3:149296426-149296448 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
966474581 3:180329142-180329164 AAGGTGATCTGTGGTCTACTGGG + Intergenic
966528470 3:180945762-180945784 AGGATGATCTGGGTTCTTGTTGG + Intronic
967006648 3:185390145-185390167 AGTATGCTCTGGGAACTCCTGGG - Intronic
967648898 3:191961466-191961488 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
969199370 4:5590377-5590399 AGGTTTTTCTGGGGTCTCCTTGG - Intronic
971581569 4:28348176-28348198 AGGTTCCTCTGGGGTCCCCTTGG - Intergenic
971846319 4:31923537-31923559 AGGTTTCTCTGGTGTCTCCTTGG - Intergenic
974027288 4:56744853-56744875 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
975938205 4:79607629-79607651 AATAGGCTCTGGGGACTACTGGG - Intergenic
976885433 4:89978027-89978049 AGGTTTCTTTGGGGTCTCCTTGG - Intergenic
977530462 4:98194790-98194812 AGGTTACTCTGGTGTCTTCTTGG - Intergenic
978223282 4:106303590-106303612 AGGTTACTCTGGGGTCCCCTTGG - Intronic
978350577 4:107816746-107816768 AGGAAGCCATGGGGTCTGCTGGG - Intergenic
979591024 4:122480392-122480414 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
981850769 4:149227974-149227996 AGGTTTCTCTGGGGTCCTCTCGG - Intergenic
983079823 4:163371461-163371483 AGGCTTTTCTGGGGTCTCCTTGG - Intergenic
983770422 4:171541852-171541874 AGGTTTCTCTGGAGTCTCCTTGG - Intergenic
986689631 5:10303649-10303671 AGGTTATTCTGGGGTCTCCTTGG - Intronic
986691848 5:10319764-10319786 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
986730543 5:10632088-10632110 AGGGTTCTCTGGGGTCCCCTTGG + Intronic
986767485 5:10940775-10940797 AGGATTTTCTGGGGTCCTCTTGG - Intergenic
987598541 5:20034712-20034734 ACTATGCTATGGGCTCTACTGGG + Intronic
989589190 5:43097591-43097613 AGGTTTCTCTGGGGTCCCCTTGG - Intronic
992065435 5:73103470-73103492 AGGTTTCTCTGGGGTCCTCTTGG - Intergenic
992114823 5:73529934-73529956 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
992115478 5:73534809-73534831 AGGTTTCTCTGGGGTCTCCTTGG + Intergenic
992450402 5:76871019-76871041 AGGTTTCTCTGGGGTCCCCTGGG - Intronic
992722073 5:79570558-79570580 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
994354729 5:98782560-98782582 AGGATGATCTGGTATCTACAAGG - Intronic
995369639 5:111404767-111404789 AGGTTTTTCTGGGGTCTCCTTGG + Intronic
995837830 5:116415796-116415818 GGGCTTCTCTGGGGGCTACTTGG + Intergenic
995995958 5:118299789-118299811 AGGCTGCTGTGGGCTCTGCTTGG - Intergenic
997662316 5:135599066-135599088 AGGCTTCTCTGGGGTCGTCTTGG + Intergenic
998857909 5:146412411-146412433 AACAGGCACTGGGGTCTACTTGG + Intergenic
999005653 5:147974586-147974608 AGGTTTCTCTGGGGTCTCCATGG - Intergenic
999119543 5:149198476-149198498 AGGAAGTTCTGGGGTTTACAAGG + Intronic
1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG + Intergenic
1000589758 5:163144297-163144319 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
1005981766 6:30842020-30842042 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
1006420863 6:33933082-33933104 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
1006617323 6:35339378-35339400 AGGTTTTTCTGGGGTCTCCTTGG + Intergenic
1006698738 6:35954517-35954539 AGGATGTTCTGGGAGTTACTGGG + Intronic
1007101443 6:39250157-39250179 AGGTTTCTCTGGGGTCCTCTTGG + Intergenic
1008977871 6:57448989-57449011 AGGTTTCTCTGGGGTCCTCTTGG + Intronic
1009166017 6:60341936-60341958 AGGTTTCTCTGGGGTCCTCTTGG + Intergenic
1011221775 6:85062162-85062184 AGGAAGCTCTAGTGTCTTCTGGG + Intergenic
1011253232 6:85394819-85394841 AGGCTTCTCTGGGGTCTCCTTGG + Intergenic
1011509991 6:88089777-88089799 AGTTTACTCTGGGGTCTACTTGG - Intergenic
1013370965 6:109470647-109470669 AGGATGCTGAGGGGTCCACACGG - Intronic
1014241825 6:119026521-119026543 AGGTTTCTTTGGGGTCCACTTGG - Intronic
1014673856 6:124340543-124340565 AGCAGGCACTGGGGTCTACTTGG - Intronic
1015315699 6:131813796-131813818 AGGTTTCTCTGGGGTTTCCTTGG + Intronic
1015474893 6:133649350-133649372 AGGATGCACTGGGCTTTACCAGG + Intergenic
1015669439 6:135672111-135672133 GGGATGCTCTGAGGGCCACTGGG + Intergenic
1017975152 6:159350510-159350532 AGGTTACTCTGGGGTCACCTTGG + Intergenic
1018222376 6:161593821-161593843 ATGATGCTCAGGGGTCAAATAGG + Intronic
1019066198 6:169300707-169300729 AGGTTTCTCTGGGGTCTCCTTGG + Intergenic
1020533797 7:9368346-9368368 AGGATTCTTTGGGGTTTACTAGG - Intergenic
1020972674 7:14965380-14965402 AATATGCTCTGAGTTCTACTTGG - Intronic
1023802941 7:43850680-43850702 AGGTTTCTCTGGGGTCTCCTTGG + Intergenic
1023988511 7:45112657-45112679 AGGTTTCTCTGGGGTCTCCTTGG - Intergenic
1024013482 7:45290857-45290879 AGGTTTCTCTGGGGTCCTCTTGG + Intergenic
1024829753 7:53436760-53436782 GGGATACACTGGGGGCTACTAGG - Intergenic
1026150556 7:67784794-67784816 AGGATGCTCACGGGGTTACTGGG - Intergenic
1026823242 7:73564061-73564083 AGGATTCTGTGTGGTTTACTGGG - Intergenic
1027993775 7:85397328-85397350 AGGTTTCTGTGGGGTCTCCTTGG + Intergenic
1029039900 7:97562178-97562200 AGGATTCTCTTGGCTATACTGGG - Intergenic
1029547094 7:101216343-101216365 AGGATGGGCAGGGGTCCACTGGG + Intronic
1031425975 7:121606134-121606156 AGGATTATCTGGGGTTTCCTAGG - Intergenic
1031558693 7:123210309-123210331 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
1032134451 7:129262747-129262769 GGGCTTCTCTGGGGTCTCCTTGG + Intronic
1032377253 7:131432964-131432986 AGTGTGGTCTGGGGTCTCCTAGG - Intronic
1035299744 7:157889165-157889187 AGGTTTCTCTGGGGTCCTCTTGG - Intronic
1036465716 8:8995018-8995040 AGGTTTCTCTGGGGTCTTCTTGG - Intergenic
1037123606 8:15318621-15318643 AGGTTACTCTGGGGTCCCCTTGG + Intergenic
1037387639 8:18360466-18360488 AGGTTTATCTGGGGTCTTCTTGG - Intergenic
1037390973 8:18391448-18391470 AGGTTTCTCTGGGGTCGCCTAGG - Intronic
1037785149 8:21898445-21898467 AGGATGGTATAGTGTCTACTGGG - Intergenic
1040285723 8:46099513-46099535 TGGATGCCCTGGGGGCTTCTTGG - Intergenic
1040705271 8:50118620-50118642 AGGATTCTTTGGGGTCCACAGGG - Intronic
1041033326 8:53760724-53760746 AGGTTTCTCTGGGGTCCCCTTGG - Intronic
1041982324 8:63876616-63876638 AGGATGATCAAGGGTCAACTTGG - Intergenic
1042068598 8:64905632-64905654 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
1042205805 8:66328677-66328699 AAGATCCTCTGGGGTCTTCTTGG - Intergenic
1042224916 8:66507939-66507961 AAGATGCTCTGGGGAATCCTGGG + Intronic
1045099775 8:98832671-98832693 AGGTTTCTCTGGGGTCCCCTTGG + Intronic
1047399469 8:124533728-124533750 ATGTTTTTCTGGGGTCTACTTGG + Intronic
1048103529 8:131381664-131381686 AGGTTTCTCTGGGGTCCCCTTGG - Intergenic
1050331289 9:4549156-4549178 AGGATGCTCAGGGGACCTCTGGG - Intronic
1054771243 9:69086302-69086324 AGGTTTCTCTGGGGTCCCCTTGG + Intronic
1055649617 9:78394499-78394521 AGGTTTCTCTGGGGTCCTCTTGG + Intergenic
1056956299 9:91084350-91084372 AGGTTTCTCTGGGGTCCCCTTGG + Intergenic
1057918438 9:99075615-99075637 AGGGTGCTCTGGGTCCTTCTTGG - Intergenic
1060268523 9:122126085-122126107 AGGCTGCTCTGAGCTGTACTTGG + Intergenic
1061683508 9:132256768-132256790 AGGATGCTATGGCGTCTCATGGG - Intergenic
1062371769 9:136242939-136242961 AGGTTGCCCTGGGGTCTCCTTGG - Intronic
1203462857 Un_GL000220v1:58349-58371 AAAATGCTCTGGGGTTAACTGGG - Intergenic
1186689469 X:11959780-11959802 AGGTTTCTCTGGGGTCCACTTGG + Intergenic
1187101553 X:16198053-16198075 AGGTTTCTCTGGGGTCTCCTTGG - Intergenic
1187185277 X:16978544-16978566 AGGATGCTCTGAGCTCTAAAAGG + Intronic
1187791535 X:22955704-22955726 AGGTTTCTCTGGGATCTCCTTGG - Intergenic
1188762206 X:34046900-34046922 TGGATGCTGTGGTGTCTTCTGGG + Intergenic
1188843283 X:35042359-35042381 AAGAGACACTGGGGTCTACTTGG + Intergenic
1190538691 X:51455705-51455727 AGGTTGCTCTGGGGTCCCCTTGG + Intergenic
1193927855 X:87511994-87512016 AGGTTACTCTGGGGTCCCCTTGG - Intergenic
1194522646 X:94937130-94937152 AGGTTTCTCTGGGGTCCTCTTGG - Intergenic
1194822171 X:98523195-98523217 AGGTTTCTCTGTGGTCTCCTTGG - Intergenic
1195563519 X:106314103-106314125 TGGATGCTCTGGGATAAACTTGG - Intergenic
1197151250 X:123222227-123222249 TGGATGCTATGGGGGCTATTTGG - Intronic
1197747965 X:129945640-129945662 AGGCTCCTCTGGGATTTACTTGG + Intergenic
1198617490 X:138475394-138475416 AGAATTCTCTGGGGTCCCCTTGG + Intergenic
1199089426 X:143673904-143673926 AGCAGACTCTGGGGTCTATTTGG + Intergenic
1202368054 Y:24180094-24180116 AGCATGCACTGGGGTCCCCTTGG + Intergenic
1202502731 Y:25490023-25490045 AGCATGCACTGGGGTCCCCTTGG - Intergenic