ID: 932165067

View in Genome Browser
Species Human (GRCh38)
Location 2:69498402-69498424
Sequence AGGATGCTCTGGGGTCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932165062_932165067 -9 Left 932165062 2:69498388-69498410 CCTCTGGCATGAGGAGGATGCTC 0: 1
1: 0
2: 0
3: 16
4: 165
Right 932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG 0: 1
1: 0
2: 0
3: 33
4: 272
932165059_932165067 0 Left 932165059 2:69498379-69498401 CCAGTTCTGCCTCTGGCATGAGG 0: 1
1: 0
2: 0
3: 18
4: 218
Right 932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG 0: 1
1: 0
2: 0
3: 33
4: 272
932165057_932165067 25 Left 932165057 2:69498354-69498376 CCTGTCTCTGAATCTTGGTCTCT 0: 1
1: 0
2: 5
3: 39
4: 438
Right 932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG 0: 1
1: 0
2: 0
3: 33
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932165067 Original CRISPR AGGATGCTCTGGGGTCTACT GGG Intronic