ID: 932168282

View in Genome Browser
Species Human (GRCh38)
Location 2:69528650-69528672
Sequence GAGGGTAAAAAGAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1685
Summary {0: 1, 1: 0, 2: 17, 3: 183, 4: 1484}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932168273_932168282 19 Left 932168273 2:69528608-69528630 CCACTGAGAGAAACTGAAAAGAG 0: 1
1: 0
2: 3
3: 39
4: 408
Right 932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG 0: 1
1: 0
2: 17
3: 183
4: 1484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932168282 Original CRISPR GAGGGTAAAAAGAAGGAAGG AGG Intronic
900471992 1:2859586-2859608 GAGGTAGGAAAGAAGGAAGGAGG + Intergenic
900681757 1:3920375-3920397 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900862958 1:5246077-5246099 GAGGGAGAAAAGAAGGAAGGAGG - Intergenic
900926750 1:5710761-5710783 GAGGGAAGAGGGAAGGAAGGAGG + Intergenic
901145316 1:7060984-7061006 GAGGGAATAAAAAAAGAAGGAGG - Intronic
901208063 1:7508650-7508672 GAGGGAAGAGAGAAGGGAGGAGG + Intronic
901384598 1:8899372-8899394 GAGGGAAAAAAGAAGAAAAGAGG - Intergenic
901419769 1:9143057-9143079 GAGGAAAAAAGGAAGGAAGGAGG - Intergenic
901677235 1:10892739-10892761 GAAGGAAGAAAGAAAGAAGGGGG - Intergenic
901938618 1:12645125-12645147 GAGGGAAGGAGGAAGGAAGGAGG - Intronic
902137953 1:14326906-14326928 GAGGCTATAAAGCAGGATGGGGG - Intergenic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902512743 1:16975114-16975136 GAGGATGAAAAGTAGCAAGGAGG + Intronic
902609107 1:17586859-17586881 GAGGGTAAAAGCAGGGAATGAGG + Intronic
902613683 1:17612058-17612080 AAGGGTAAAAGGGAGGGAGGGGG - Intronic
902699829 1:18164292-18164314 GAGGGAAGAAAGAAGGAAAGGGG - Intronic
902743232 1:18455036-18455058 GAGGGTACACAGGAGGGAGGTGG - Intergenic
902858874 1:19230218-19230240 GAGGGTAGAAGGTAGGAATGTGG - Intronic
903149676 1:21397966-21397988 GAGGGAGGAAAGGAGGAAGGGGG - Intergenic
903352487 1:22726185-22726207 AAGGAGAAAAAGGAGGAAGGAGG - Intronic
903491277 1:23730466-23730488 GAAGGTAAAAATCATGAAGGTGG - Intergenic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903859442 1:26356073-26356095 GAGGGACCAAAGATGGAAGGCGG + Intergenic
903865207 1:26392774-26392796 GAGGGTAAAAAGAAGTGGGTGGG + Intergenic
903977372 1:27159677-27159699 CAGTGTAAAAAGAAGAAAAGAGG + Intronic
904087063 1:27916710-27916732 GGAGAAAAAAAGAAGGAAGGGGG - Intergenic
904087156 1:27917022-27917044 GAGGGAAGGAGGAAGGAAGGAGG - Intergenic
904087164 1:27917045-27917067 GGGGGGAGAAGGAAGGAAGGAGG - Intergenic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904343231 1:29851586-29851608 GAGGGAAAGAAGTAGGCAGGTGG + Intergenic
904448360 1:30594284-30594306 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
904480736 1:30791724-30791746 GAGGGAAGAAGGAAGGAGGGAGG + Intergenic
904761359 1:32806749-32806771 GAGGGAAAGAAGAAGAAAGTTGG - Intronic
904847107 1:33428792-33428814 GAGGGTGAACAGAAAGGAGGAGG + Intronic
904992434 1:34603956-34603978 GAGGAGAGAAGGAAGGAAGGAGG - Intergenic
905291902 1:36927632-36927654 GAGGGAAAAAAGAGGGAAAAGGG + Intronic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
906370671 1:45250647-45250669 GAAGGAAGAAAGAAGGAGGGAGG + Intronic
906445218 1:45890521-45890543 GAAGGAAAAAATAAGGAAGGAGG - Intronic
906532633 1:46532454-46532476 TGGGGTAGAAACAAGGAAGGTGG + Intergenic
906786070 1:48617069-48617091 GAGGGAGAAAAGGAGGGAGGGGG + Intronic
906794962 1:48689457-48689479 GAGGAAAGAAGGAAGGAAGGAGG - Intronic
907669874 1:56464966-56464988 GAAGGTACAAAGGAGGAAGGAGG + Intergenic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
908598361 1:65711825-65711847 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
908792997 1:67801936-67801958 GAAGGAAAAAAGAAGGAAGGGGG + Intronic
909005063 1:70265934-70265956 GAGGGAAGAAGGAAGGAAGGAGG + Intronic
909016829 1:70389031-70389053 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
909126056 1:71671372-71671394 CAGGGTAAAATGAAGGAAACTGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910909004 1:92214366-92214388 GACAGTTAAAAGAAGCAAGGAGG + Intergenic
910964294 1:92792676-92792698 GAGGGACAGAAGAAGGAAGATGG - Intergenic
910977366 1:92920918-92920940 GAGAGTAAGAGGAAGGAAAGAGG + Intronic
911304260 1:96213987-96214009 GAGTGTGTAAAGAAGGAAGGTGG + Intergenic
911526536 1:98994192-98994214 GAGGGAGAAAGGAAAGAAGGGGG + Intronic
911741634 1:101392559-101392581 GAGGGCAAGAGGAAGGAGGGAGG - Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912316147 1:108668995-108669017 GAGGGAAGAAGGAAGAAAGGAGG + Intergenic
912443728 1:109717517-109717539 GAGAGTAGAAAGAAGGAAAAAGG - Exonic
912698813 1:111861146-111861168 AAGGGCAGAAAGGAGGAAGGGGG + Intronic
912720989 1:112019803-112019825 GGGAGTTAAAAGGAGGAAGGAGG + Intergenic
912966519 1:114241870-114241892 GACCGTAGAAAGAAAGAAGGGGG - Intergenic
913455713 1:119028563-119028585 GAGGGGAAAAGGAGGCAAGGAGG + Intergenic
914087365 1:144465223-144465245 AAGGGCAAAGAGAAGGTAGGAGG + Intergenic
914311246 1:146468980-146469002 AAGGGCAAAGAGAAGGTAGGAGG - Intergenic
914739216 1:150449576-150449598 GGAGGGAGAAAGAAGGAAGGAGG - Intronic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914959259 1:152191624-152191646 GTGGGTAAGAATGAGGAAGGTGG + Intergenic
915304478 1:154969825-154969847 GGGAGTGAAAAGAAGGAAGGGGG + Intronic
915594203 1:156887253-156887275 GAGGGAAGAAAGAAGGGAGAGGG - Intergenic
915700004 1:157783072-157783094 GAGAGAAGAAAGAAGAAAGGAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916123994 1:161553059-161553081 GAGGGGAGAGAGATGGAAGGTGG + Intergenic
916133878 1:161634421-161634443 GAGGGGAGAGAGATGGAAGGTGG + Intronic
916259731 1:162829527-162829549 GAGGTAAGAAAGAAGGAAGAAGG - Intronic
916260805 1:162840218-162840240 GAAGGAAGAAGGAAGGAAGGGGG + Intronic
916497783 1:165360638-165360660 GAGGGAAGAAAAAAGGGAGGAGG + Intergenic
916736720 1:167614129-167614151 GAGGGAAGAAGGAAGGAAGAAGG - Intergenic
917105588 1:171488021-171488043 GGGGGTAAGAAGAAGAGAGGGGG - Intronic
917236713 1:172900565-172900587 GGTGGTAAAGAGAAGGAAGTTGG - Intergenic
917418830 1:174840505-174840527 TAGGGTATAAAGAAGAAAGCGGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
918195016 1:182213191-182213213 GAGGGAAGAAGGAAGGAAGGTGG - Intergenic
918195577 1:182218606-182218628 GAAGGCAAAAAGAAGCAAGGTGG + Intergenic
918300838 1:183202387-183202409 CAAGGATAAAAGAAGGAAGGGGG + Intronic
918302537 1:183217009-183217031 GAGGGAGCTAAGAAGGAAGGAGG + Intronic
918431779 1:184468401-184468423 GGGGGAAAAAAGGAGGAAGGTGG + Intronic
918470519 1:184868136-184868158 GAGGTAAAAAAGAAGGAAGTTGG - Intronic
918482918 1:184998727-184998749 GAAGGAAGAAAGAAGGAAGAAGG + Intergenic
918794845 1:188880547-188880569 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919363724 1:196629823-196629845 GAGGGGAGAAAGAAGAAAGGAGG + Intergenic
919486108 1:198149302-198149324 GGGGAAAGAAAGAAGGAAGGAGG + Intergenic
919547384 1:198940689-198940711 GAGGAGAAAAGGAATGAAGGGGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919986560 1:202679810-202679832 GAAGCTAGAAAGAAGGGAGGAGG - Intronic
919990068 1:202703384-202703406 GGGAGTAAAAAGAAGGGCGGGGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920167255 1:204044677-204044699 GAGGGAGAAAGGAAGGAAGGAGG + Intergenic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920766063 1:208835077-208835099 GATAATAAAAAGAAGAAAGGAGG + Intergenic
920811067 1:209286083-209286105 AAGGATAGAAGGAAGGAAGGAGG + Intergenic
920815043 1:209323456-209323478 GAGGGTAAGGAGAAGAAAGGTGG - Intergenic
921124004 1:212160925-212160947 TAGGGTAAAAAGTTGGTAGGGGG - Intergenic
921126407 1:212181933-212181955 AATGGTGAAAAGAAAGAAGGGGG - Intergenic
921540410 1:216407082-216407104 GAGCAAGAAAAGAAGGAAGGAGG - Intronic
921557154 1:216612534-216612556 GAGGGAAACAAGAAAGGAGGGGG - Intronic
921591326 1:217007718-217007740 GAGGAAGAAAAGATGGAAGGAGG - Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921734522 1:218612118-218612140 GAAGGGAGAAAGAGGGAAGGAGG - Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922129354 1:222761620-222761642 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
922191535 1:223323170-223323192 GAGAGTGACAAAAAGGAAGGAGG + Intronic
922300914 1:224299731-224299753 GAGGATAAAGAGAAAAAAGGTGG - Intronic
922447008 1:225706224-225706246 GAGGGTGAAAACAATGATGGAGG + Intergenic
922505994 1:226126008-226126030 GAGAGTAACAGGAGGGAAGGAGG - Intergenic
922852206 1:228742542-228742564 TAGGAGAAAATGAAGGAAGGAGG + Intronic
923052115 1:230396255-230396277 GGGGGTAAAAAGGAGGAGTGTGG - Intronic
923455828 1:234164406-234164428 GAGAGGAAAAAGAAAGAGGGAGG - Intronic
923460766 1:234207402-234207424 GAGGGAGAAAGGAAGGAGGGAGG - Intronic
923784080 1:237051175-237051197 GAAGGGAAAAGGAGGGAAGGGGG - Intronic
923986174 1:239385590-239385612 GAAAGAAAAAGGAAGGAAGGAGG - Intergenic
924005132 1:239600713-239600735 GAGGGAGGGAAGAAGGAAGGAGG - Intronic
924038515 1:239960019-239960041 AAGGAAAAAATGAAGGAAGGAGG - Intergenic
924059269 1:240154853-240154875 GAGGGAAGAAAGAAAGAGGGAGG - Intronic
924202557 1:241675028-241675050 GAAGGAAAGAAGAAGGAGGGAGG - Intronic
924202602 1:241675171-241675193 GAGGAAGGAAAGAAGGAAGGAGG - Intronic
924217098 1:241833943-241833965 GAGGAGGGAAAGAAGGAAGGAGG - Intergenic
924293975 1:242566898-242566920 GAGGGTTAAAAGAGGGAGAGGGG - Intergenic
924429452 1:243984461-243984483 GAGGAAAAAAAGAAAGGAGGGGG + Intergenic
924700018 1:246441907-246441929 GATAGTAAAGAGAAAGAAGGTGG - Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924910833 1:248511510-248511532 GAAGGAAAAAAGAAGGAAATGGG + Intergenic
924913268 1:248536530-248536552 GAAGGAAAAAAGAAGGAAATGGG - Intergenic
1063186317 10:3654986-3655008 GAGAGGAAAAAGAAGCAAAGAGG - Intergenic
1063511147 10:6646737-6646759 GAGGGAAAGAAGGAGGGAGGGGG - Intergenic
1063621027 10:7649247-7649269 GGGGGAAGAAAGAAGAAAGGAGG - Intronic
1063774628 10:9247595-9247617 GAGGGAAAAAAGAATAAATGAGG + Intergenic
1063777891 10:9284811-9284833 CAGGGTAGAAAGAAAGGAGGTGG - Intergenic
1063796112 10:9515716-9515738 GAGGAAAGAAAGAAGGGAGGAGG + Intergenic
1063907066 10:10792043-10792065 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1063986135 10:11504891-11504913 GAGTGGTAAAAGAAGGATGGTGG + Intronic
1063999742 10:11653662-11653684 GGGGAAAAAAAGAAGGAAGGCGG - Intergenic
1064830243 10:19456238-19456260 GAGGGTAAAATAAAAGAAGCTGG + Intronic
1065231723 10:23605574-23605596 GAGGAAAGAAAGAAGGGAGGAGG - Intergenic
1065770517 10:29074055-29074077 GAGGGAAGAATGAAGGAAGAAGG + Intergenic
1065811906 10:29450400-29450422 GAGGGTGCACAGAAGGAAAGTGG - Intergenic
1065866486 10:29919402-29919424 GAGGGTAAGAGGAGGGAAGGGGG - Intergenic
1066458823 10:35595518-35595540 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1066553417 10:36584579-36584601 AAGGATGAAAAGTAGGAAGGAGG - Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1067232009 10:44418516-44418538 GGAGGCAAAAAGAAGAAAGGAGG + Intergenic
1067364012 10:45608142-45608164 GAAGGGAAAGGGAAGGAAGGGGG + Intergenic
1067481510 10:46602530-46602552 GAGGGAGAAAAGAAGGAAAGGGG - Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1067613242 10:47739199-47739221 GAGGGAGAAAAGAAGGAAAGGGG + Intergenic
1067683457 10:48454233-48454255 GTGGGCAAAGAGAAGGGAGGTGG + Intronic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1068022340 10:51601001-51601023 GAGGGGGAAAAGAAGAAGGGAGG + Intronic
1068357217 10:55924053-55924075 GAGAGAAAAGAAAAGGAAGGAGG + Intergenic
1068435730 10:56989006-56989028 GAGGTGGAAGAGAAGGAAGGAGG + Intergenic
1068711597 10:60141064-60141086 GAGGGGAAAAAGAGAGAGGGAGG + Intronic
1069443846 10:68454865-68454887 GGGGGAAAAAAGGAGGGAGGAGG + Intronic
1070504792 10:77103772-77103794 GAGGGGAAAAAGATGGAGAGGGG - Intronic
1070596871 10:77838590-77838612 GAGGGCATAGAGAAGGAAAGGGG + Intronic
1071094025 10:81952411-81952433 GAGGGGAGAGAGAAAGAAGGCGG + Intronic
1071161648 10:82753528-82753550 GAGGAAAGAAAGAAGGAGGGAGG - Intronic
1071163195 10:82776521-82776543 GAGGGTAAAGAGATGGAAAAAGG - Intronic
1071275353 10:84049114-84049136 GAGGGTAGAAGGAGAGAAGGAGG + Intergenic
1071393579 10:85199597-85199619 GAAGGGAGGAAGAAGGAAGGAGG + Intergenic
1071570653 10:86694947-86694969 GAGGAGAAAGAGAAGGTAGGTGG - Intronic
1071628653 10:87199304-87199326 GAGGGAGAAAAGAAGGAAAGGGG + Intergenic
1072043420 10:91631272-91631294 GAGGAAGAAAGGAAGGAAGGAGG - Intronic
1072161490 10:92771220-92771242 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1072260237 10:93663145-93663167 GAGGCAAAAAAGCAAGAAGGAGG + Exonic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073840547 10:107494396-107494418 AAGGGAAAAGAGAATGAAGGTGG - Intergenic
1074421943 10:113316880-113316902 GAGGGTACAAGGAGGGGAGGAGG + Intergenic
1074724081 10:116289688-116289710 AGGGAGAAAAAGAAGGAAGGAGG - Intergenic
1074813776 10:117129853-117129875 GCAGGAAAAAAAAAGGAAGGAGG + Intronic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075256956 10:120932943-120932965 GAGGCTAAGAAGAGGCAAGGAGG + Intergenic
1075282763 10:121154585-121154607 GTGGAAAAAAAGAAGGGAGGCGG + Intergenic
1075303026 10:121342270-121342292 GAGGGGAAGAGGCAGGAAGGGGG + Intergenic
1075468988 10:122673671-122673693 GAGGATACAAAGAAAGAAGGTGG - Intergenic
1075934632 10:126328951-126328973 GAGGGTAGGAAGGAGGAAGCTGG + Intronic
1076077507 10:127547154-127547176 GAAGGTAAAGAGAAGGAATCAGG - Intergenic
1076252363 10:128994644-128994666 GAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1076318862 10:129564169-129564191 GAGTGGAAGAAGAAGGGAGGGGG - Intronic
1076558679 10:131346898-131346920 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1076558692 10:131346945-131346967 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1076778112 10:132709316-132709338 GAGGGGGAAAAGAAGGAGGTGGG + Intronic
1076810204 10:132882497-132882519 GAAGGCAAGAAGAAGGATGGTGG + Intronic
1077563784 11:3283287-3283309 AAGGGAAAAAAGGAGGGAGGGGG - Intergenic
1077569674 11:3329104-3329126 AAGGGAAAAAAGGAGGGAGGGGG - Intergenic
1077618425 11:3696513-3696535 GAGGGAAAAAAAAAGGCCGGAGG + Intronic
1077772341 11:5233747-5233769 GAAGGAAAAATGAAGGGAGGGGG + Intronic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1077978235 11:7272443-7272465 GAGGATAAAATGAAGTAAGAGGG - Intronic
1078074740 11:8148069-8148091 GAGGTAAGAAAGAAGGTAGGTGG + Intronic
1078612930 11:12837669-12837691 GAAGGGAGAAAGAAGGAAGAAGG - Intronic
1078740624 11:14062994-14063016 GAGGAAAAAAAGAGGGAAGGAGG - Intronic
1078779553 11:14424057-14424079 GGGGTTAAAAAGAAGAAAGAAGG + Intergenic
1078803197 11:14668081-14668103 GAGTTTAAAAGGAAGAAAGGGGG + Intronic
1079189377 11:18265083-18265105 GAGGGAAAGAGGAAGAAAGGAGG + Intergenic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079750011 11:24185359-24185381 GAGGGATGAAGGAAGGAAGGAGG + Intergenic
1080050224 11:27851919-27851941 GAGGGAAGAAAGAGGGAGGGAGG - Intergenic
1080556388 11:33421223-33421245 GAGGCTAATTAGAAGAAAGGGGG + Intergenic
1080956292 11:37099777-37099799 GAAGGAAGAAGGAAGGAAGGGGG - Intergenic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081507923 11:43737573-43737595 GAGGAAGAAAAGAAGGAAAGTGG - Intronic
1081678983 11:44988667-44988689 GAAGAAAAAAAGAAGGAAGGAGG + Intergenic
1081693616 11:45094652-45094674 GAGGAAAGAAGGAAGGAAGGAGG + Intergenic
1081766309 11:45612943-45612965 GAGGGTGAAAGGAAAGAATGTGG + Intergenic
1081809002 11:45904942-45904964 GAGGGAGAAAAGAAGCAAGAGGG - Intronic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1082071335 11:47942155-47942177 GAGGGGAACAAGAAGAAAGTGGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083421534 11:62556094-62556116 TAGGGTAGAATGAGGGAAGGGGG - Intronic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084470413 11:69356174-69356196 GAGGATGAAGAGAAGGAAGGAGG + Intronic
1084470472 11:69356390-69356412 GAGGGAAGAAAGATGGATGGAGG + Intronic
1084470497 11:69356476-69356498 GAGGGAGGAAAGAAGGAGGGAGG + Intronic
1084877389 11:72143132-72143154 TGGGGTATAAAGAAGGAAAGAGG + Intergenic
1084882547 11:72181935-72181957 TGGGGTATAAAGAAGGAAAGAGG + Intergenic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085122281 11:73974845-73974867 GAATGTAGAAAGAGGGAAGGTGG + Exonic
1085252906 11:75155277-75155299 GAGAGTCAAAGGCAGGAAGGGGG - Intronic
1085314502 11:75536169-75536191 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1085497552 11:76984964-76984986 AATGGCAAAAAGAGGGAAGGGGG - Intronic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085595646 11:77806778-77806800 GAGTGAAAAAACAAGGGAGGAGG + Intronic
1085619892 11:78030151-78030173 GGGGGAAAAAAGAAGCAAGCAGG - Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1085775143 11:79358715-79358737 GAGGGAAGGAAGAGGGAAGGAGG - Intronic
1085869998 11:80338338-80338360 TAGGGAAGAAAGAAGAAAGGTGG - Intergenic
1086027737 11:82314919-82314941 GAGGGAAAAAAGAAGAAAATAGG - Intergenic
1086129117 11:83382836-83382858 GAGGGCAAGAAGAAGCAGGGTGG + Intergenic
1086165452 11:83772510-83772532 AAGGGAAGAAGGAAGGAAGGAGG + Intronic
1086170586 11:83831924-83831946 AAGGGAAATTAGAAGGAAGGGGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086572135 11:88297399-88297421 GAGGGGCAAAACAAGAAAGGAGG - Intronic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1086846024 11:91750700-91750722 AAGGGGAAAGGGAAGGAAGGGGG - Intergenic
1086867831 11:92001685-92001707 GTGGAGAAAATGAAGGAAGGAGG + Intergenic
1087242921 11:95800321-95800343 AAGGGAAACATGAAGGAAGGAGG - Intronic
1087547219 11:99600041-99600063 AAGGGTACAAACAAGGGAGGAGG + Intronic
1087563082 11:99816175-99816197 GAAGGAAAAAAGTAGGAAAGTGG - Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1087806522 11:102561378-102561400 GAGAAGGAAAAGAAGGAAGGAGG - Intergenic
1088197678 11:107293867-107293889 GAGGGCAAGAGGAAGGAGGGCGG + Intergenic
1088235527 11:107718997-107719019 GAGAGAAAATAGAAGGAAGTGGG + Intronic
1088250425 11:107857208-107857230 GAAGGAACAAAGAAGGAGGGAGG + Intronic
1088329232 11:108633178-108633200 CATGGTAACAAGAAAGAAGGTGG - Intergenic
1088381260 11:109195032-109195054 GAAGGGAGAAAGAAAGAAGGAGG - Intergenic
1088616532 11:111635394-111635416 AAGGGAGAAAGGAAGGAAGGAGG + Intronic
1088618795 11:111661345-111661367 GAGGGAAAAGAAAAGGAAGCAGG + Intronic
1088684801 11:112275580-112275602 GAGGGGAAAAGGAAGGAAAGGGG + Intergenic
1088892626 11:114057440-114057462 GAAGGTAACAAAAAGGAAGAAGG - Intergenic
1088916799 11:114233622-114233644 GTGGATAAAAAAAGGGAAGGAGG - Intronic
1089042231 11:115462890-115462912 AAGGGGAGAAAGAAGGAAAGGGG + Intronic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089455754 11:118624958-118624980 GTGGTTAAAGCGAAGGAAGGTGG - Exonic
1089470521 11:118716706-118716728 AAGGGGAAAAAGCAGGCAGGAGG - Intergenic
1089641607 11:119851363-119851385 GAGGGAAGGAAGAATGAAGGTGG - Intergenic
1090062620 11:123477252-123477274 GAGGGGGAAGGGAAGGAAGGGGG - Intergenic
1090130518 11:124136777-124136799 GAGGAAAGAAGGAAGGAAGGAGG - Intronic
1090271938 11:125392792-125392814 GAGGGAGGAAAGAAGGAACGGGG + Intronic
1090725172 11:129518394-129518416 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
1091116478 11:133018368-133018390 GAGGGGAAAAAGAAGTAAAAAGG - Intronic
1091335136 11:134760973-134760995 AAGGATGGAAAGAAGGAAGGAGG - Intergenic
1091488146 12:909247-909269 AGGGGTAAAAAAAAGGGAGGAGG - Exonic
1091545077 12:1496178-1496200 GAGGGTAGAAAGAAGGAAAAAGG - Intergenic
1091618874 12:2070919-2070941 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618904 12:2071026-2071048 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091618926 12:2071098-2071120 AAGGGGAAAGGGAAGGAAGGAGG - Intronic
1091671763 12:2457137-2457159 GGGGGTATCTAGAAGGAAGGAGG + Intronic
1091743670 12:2977335-2977357 GAGAGGAAAAAGAAGGGAAGGGG - Intronic
1091755868 12:3051157-3051179 GTGGCTGAAAGGAAGGAAGGAGG - Intergenic
1091853531 12:3720365-3720387 GAGAGAGAAACGAAGGAAGGGGG + Intronic
1091858834 12:3760506-3760528 GAAGGAAGAAGGAAGGAAGGAGG + Intronic
1091916202 12:4273088-4273110 GTGGGTATTAGGAAGGAAGGGGG - Intergenic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1091976116 12:4827106-4827128 GAAGGAAAGAAGGAGGAAGGAGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093019981 12:14194316-14194338 GAGTGAAGGAAGAAGGAAGGAGG - Intergenic
1093029836 12:14278096-14278118 GCTGGTAAAAAGAAGAAAGTCGG + Intergenic
1093038806 12:14356506-14356528 GAGAGAAAAAAAAAGAAAGGAGG - Intergenic
1093141624 12:15516545-15516567 GAGGGAGGGAAGAAGGAAGGGGG + Intronic
1093508389 12:19896706-19896728 GAAGGAAAGAAGAAGGAAGAAGG - Intergenic
1094026103 12:25960658-25960680 GAGGAAAAAAATGAGGAAGGGGG - Intronic
1094234382 12:28146846-28146868 GAGGAGAAGAAGAAAGAAGGAGG - Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094404834 12:30106433-30106455 GAGGCTACAGAGAAGGAAGCTGG - Intergenic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1095152701 12:38814054-38814076 GAGGATAGAAAGAATGGAGGGGG + Intronic
1095450783 12:42328442-42328464 GAGGGTAAAACACTGGAAGGAGG + Intronic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095930852 12:47624000-47624022 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1095999399 12:48116198-48116220 GAAGGAGAAAAGAAGGAAGGAGG - Intronic
1096235174 12:49921597-49921619 GAAAGGAAAAGGAAGGAAGGCGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096638084 12:52973920-52973942 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1096638103 12:52973972-52973994 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1096743297 12:53710014-53710036 GAAGGTAAAAGGAGGGATGGGGG + Intronic
1096767012 12:53899423-53899445 GAAGGAAGAAGGAAGGAAGGAGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097176757 12:57147727-57147749 TAGAATAGAAAGAAGGAAGGAGG + Intronic
1097207204 12:57332722-57332744 TAGGGTAAGAATAAGGAATGTGG - Intronic
1097223370 12:57462882-57462904 GAGGGGCACGAGAAGGAAGGGGG + Intronic
1098035478 12:66297518-66297540 GAGGGAGAAGAGAAGGAAGGAGG + Intergenic
1098082209 12:66799545-66799567 GAGGGGAAAAGGAAGGAGAGAGG - Intronic
1098139303 12:67435453-67435475 AATGATGAAAAGAAGGAAGGAGG - Intergenic
1098212126 12:68177542-68177564 GAGGGTAAGAAGAGAGAGGGAGG + Intergenic
1098501350 12:71195941-71195963 GAAGGTCAAAAACAGGAAGGAGG + Intronic
1098833390 12:75390975-75390997 GAGGGAAAAACAAAGGAGGGAGG - Intergenic
1098989656 12:77050750-77050772 GAGGGCAGATAGAAGGGAGGGGG + Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099134904 12:78885309-78885331 GAGGGAGGGAAGAAGGAAGGAGG + Intronic
1099227541 12:79987711-79987733 AAGGAAAGAAAGAAGGAAGGAGG + Intergenic
1099712248 12:86242684-86242706 GAGGGAAAAATGGAGGAAGGGGG + Intronic
1099890440 12:88583164-88583186 GAGGGAAAAAAAATGGAAAGAGG - Intergenic
1100198773 12:92276642-92276664 GAGGGAAAAAAAAAAGAAGCAGG - Intergenic
1100571290 12:95845403-95845425 AAGGGTTAAATGGAGGAAGGAGG - Intergenic
1100677664 12:96885873-96885895 GAGGAAGGAAAGAAGGAAGGAGG - Intergenic
1100877299 12:98975421-98975443 AAGGCAAGAAAGAAGGAAGGGGG - Intronic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101199033 12:102415611-102415633 GAGAGAAGAAGGAAGGAAGGAGG - Intronic
1101348225 12:103905453-103905475 GAGGAAGGAAAGAAGGAAGGAGG + Intergenic
1101348612 12:103907318-103907340 GAGGGGAAAAGGAGGGGAGGGGG + Intergenic
1101427615 12:104600836-104600858 GAGGGAAAAAAGAGAGATGGGGG - Intronic
1101502514 12:105317164-105317186 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1101567694 12:105923665-105923687 GAAGGTTAAAAAAAGGAATGTGG - Intergenic
1101843211 12:108342297-108342319 GGGGGTCAGAAGGAGGAAGGGGG + Intergenic
1102094656 12:110227754-110227776 GAGAGAGAAAAAAAGGAAGGAGG + Intergenic
1102527021 12:113519697-113519719 TGGGGTGAAAAGAGGGAAGGGGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102726438 12:115069654-115069676 GATGATAATAAGAAGGAATGGGG - Intergenic
1102764784 12:115423181-115423203 GAGGGAGAAAGGAAAGAAGGAGG + Intergenic
1102947674 12:117004242-117004264 GAGGATAAAAAGTAGGAAATCGG - Intronic
1102991956 12:117322157-117322179 GGAAGGAAAAAGAAGGAAGGAGG - Intronic
1103030201 12:117606600-117606622 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1103111011 12:118278285-118278307 GAGGGTGGAAAGAAGGAGGAGGG - Intronic
1103245775 12:119455939-119455961 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1103246677 12:119464021-119464043 GAGGGAAGAAAAAAGGAAGAAGG - Intronic
1103246726 12:119464336-119464358 GAGGGAAGAAAAAAGGAAGAAGG - Intronic
1103624010 12:122205100-122205122 GAGGGGAGAAAGAAGGGAGACGG - Intronic
1103896614 12:124277667-124277689 GAGGAGAAAGAGGAGGAAGGGGG - Intronic
1104139286 12:125972164-125972186 GAAGGAAAAAGGAAGGAAGGAGG - Intergenic
1104139291 12:125972186-125972208 GAAGGAAAAAGGAAGGAAGGAGG - Intergenic
1104159172 12:126162022-126162044 GAAGGTAAAAACAAGGAACAGGG - Intergenic
1104492740 12:129208930-129208952 GAGGCTGAGACGAAGGAAGGAGG + Intronic
1105618133 13:22040139-22040161 GAGGAAAGAAAGAAGGAAAGAGG + Intergenic
1105705117 13:22963606-22963628 GAGGGAAGAAGGAATGAAGGAGG + Intergenic
1106481212 13:30138316-30138338 GAGGGTAAAAAGAGGGAAAAGGG + Intergenic
1106594330 13:31123733-31123755 GAGGAAGAAAAGAAGGGAGGAGG - Intergenic
1106743957 13:32679844-32679866 GGAGGGAAAAAGAAGGGAGGAGG - Intronic
1106882876 13:34150864-34150886 GAGGCAAAAATGAAGGAGGGGGG - Intergenic
1107037481 13:35916614-35916636 GAGGGAGAGAAAAAGGAAGGAGG - Intronic
1107737324 13:43413437-43413459 GAGGGAAAAAAGTTGGGAGGAGG + Intronic
1107763663 13:43710145-43710167 GAGAGGAAAAAGAGGGCAGGAGG + Intronic
1107807630 13:44169153-44169175 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1107829191 13:44359415-44359437 GAGGGTGAAAAGTAGGAGGGAGG - Intergenic
1107982220 13:45744614-45744636 CAGGGAGGAAAGAAGGAAGGAGG + Intergenic
1108225859 13:48287988-48288010 GAGGGGAAAAGGGAGAAAGGGGG + Intergenic
1108379140 13:49840123-49840145 GAGGGAGAGAACAAGGAAGGAGG + Intergenic
1108421943 13:50259753-50259775 GAGGGTAAAAAGAAGGTCTCTGG - Intronic
1108433225 13:50375670-50375692 GAGGGAGAAAAGAGGGATGGAGG - Intronic
1108436575 13:50406776-50406798 GAGGGGGGAAAGAAGGAGGGAGG - Intronic
1109140231 13:58705616-58705638 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1109147692 13:58801808-58801830 GAAGGGAAAAGGAAGGAAGAAGG + Intergenic
1109451254 13:62517923-62517945 GAGGTTAAAAGGTAGGAAGTTGG - Intergenic
1109710809 13:66157019-66157041 GAAGTTAAAAAGAAGAAAAGGGG - Intergenic
1110582494 13:77147552-77147574 AAGGGTAGAGAGAAGGAAGGGGG - Intronic
1110713073 13:78671278-78671300 GAGGGAGAGAAGAAGAAAGGAGG + Intergenic
1110754481 13:79155841-79155863 GAGGGGAGGAAGAAGGAATGAGG + Intergenic
1110846512 13:80195843-80195865 GAGGGCAGAAGGAAGGAAAGAGG + Intergenic
1110870218 13:80443536-80443558 GAGGAGAAAAAGAAGAAAGGAGG - Intergenic
1111232216 13:85358460-85358482 GAGGGTAAAAGGTAGGAGGAGGG + Intergenic
1111446090 13:88347748-88347770 GAGGGAAAAAGGGAGGGAGGAGG + Intergenic
1111452646 13:88438831-88438853 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1111860497 13:93698821-93698843 GAGAGAAAAAAGGAAGAAGGAGG - Intronic
1112004172 13:95240156-95240178 GAGGGTCACAAGAGGGGAGGAGG + Intronic
1112441440 13:99427157-99427179 GAGGGTGAAAGGGAGGAGGGAGG + Intergenic
1112827825 13:103412641-103412663 GAGGTTTAAAAAAAGGAAAGGGG - Intergenic
1112991186 13:105515602-105515624 GAGGGAGAAAGGAAGGAAGTGGG - Intergenic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1113664099 13:112128823-112128845 GCGGGGAAAAGGAAGAAAGGAGG - Intergenic
1113735148 13:112673208-112673230 GAAGAAAGAAAGAAGGAAGGAGG - Intronic
1113851179 13:113419071-113419093 GAGGGAAGAAGGAAGGAAGGAGG - Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114192285 14:20449020-20449042 GAAGAAAAAAATAAGGAAGGAGG + Intronic
1114241292 14:20870824-20870846 GAGGGTAGAAGAAAGAAAGGAGG + Intergenic
1114370415 14:22081118-22081140 GAAGGTAAAAAGAATGAGAGGGG - Intergenic
1114428627 14:22641346-22641368 GAGGGAAGAAAGAAAGAAAGGGG + Intergenic
1114484045 14:23052667-23052689 GAGGGAAGAAAGAAGAGAGGGGG - Intronic
1115124106 14:29972178-29972200 GAGGGCAAACAGAAGCAAAGTGG + Intronic
1116010622 14:39347410-39347432 GAGGAGGAAAAGAAGGAAGGAGG + Intronic
1116226411 14:42159135-42159157 CATTGTAAAAAGAATGAAGGGGG + Intergenic
1116403783 14:44542864-44542886 GAGGTGAGAGAGAAGGAAGGGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117007277 14:51434085-51434107 TAAGTTAAAAATAAGGAAGGGGG + Intergenic
1117096173 14:52300672-52300694 GGGTGTATAAAGATGGAAGGAGG - Intergenic
1117186780 14:53247648-53247670 GAGACTAGAAAGAAGGAAGAGGG + Intergenic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1118113091 14:62744958-62744980 GAAGGGAGAAAGAAGGAAGTTGG + Intronic
1118219310 14:63840462-63840484 GGAGGGAAAAGGAAGGAAGGAGG - Intergenic
1118225199 14:63892366-63892388 GAGGGAAAAAAAAAGGTTGGGGG - Intronic
1118427026 14:65676603-65676625 GAGGGAAGGAAGAAGGAAGGAGG - Intronic
1118608703 14:67522812-67522834 GAGGGTAAAAAGAATAGAGATGG - Intronic
1119224926 14:72937763-72937785 AAGGGTAACAGGAAGGAAGTGGG + Intronic
1119401008 14:74362338-74362360 GAGGGAGAAAAGAATGCAGGGGG - Intergenic
1119964029 14:78893098-78893120 GATGGCAAAGAAAAGGAAGGTGG - Intronic
1120068458 14:80074390-80074412 AAGGGGAAAAAGTAGAAAGGGGG + Intergenic
1120228519 14:81817969-81817991 GAAGGAAGAAGGAAGGAAGGAGG - Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1120576335 14:86185994-86186016 AAGGAAAGAAAGAAGGAAGGAGG - Intergenic
1120584224 14:86291145-86291167 GAAGGAAGGAAGAAGGAAGGGGG - Intergenic
1121345644 14:93133803-93133825 GAGTGTAAAAAAAAGAAAAGTGG - Intergenic
1121350123 14:93166843-93166865 GAAGGAAGAAGGAAGGAAGGAGG - Intergenic
1121566407 14:94913260-94913282 GTGGGAAAGAAGAAGGAATGAGG + Intergenic
1121624595 14:95374916-95374938 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624604 14:95374946-95374968 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121624626 14:95375019-95375041 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624635 14:95375049-95375071 GAGAGAGGAAAGAAGGAAGGGGG - Intergenic
1121624656 14:95375122-95375144 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624688 14:95375237-95375259 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624704 14:95375292-95375314 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121760376 14:96439883-96439905 GGGGGTGCAAAGAAAGAAGGCGG + Intronic
1121800268 14:96768902-96768924 GAAGGAAGAAAGAAGGAAGGAGG - Intergenic
1121800307 14:96769062-96769084 GAGGAAGGAAAGAAGGAAGGAGG - Intergenic
1121882590 14:97514332-97514354 AAGGAAAAAAGGAAGGAAGGAGG - Intergenic
1121970229 14:98349199-98349221 GAGGGTGAGAAGAAGGGAGAGGG + Intergenic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1122804747 14:104250643-104250665 GGGGGTGAAAAGGGGGAAGGAGG + Intergenic
1123197182 14:106627816-106627838 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123198526 14:106639692-106639714 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123771998 15:23538065-23538087 GGGGGAAAAAAGAAGAAAAGGGG + Intergenic
1124035639 15:26051572-26051594 GAGGGAAAAAGAAAGGGAGGGGG - Intergenic
1124037440 15:26068774-26068796 GAAAATAAAAAGAAGGAAGGAGG - Intergenic
1124069490 15:26378365-26378387 AAGGGAGAAAGGAAGGAAGGAGG - Intergenic
1124069559 15:26378700-26378722 AAGGGAGAAAGGAAGGAAGGAGG - Intergenic
1124113964 15:26822102-26822124 AAGGCTAAGAAGAAGGAACGAGG + Intronic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1124490586 15:30152532-30152554 GAGGGGGCAAAGAGGGAAGGAGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124752947 15:32385797-32385819 GAGGGGGCAAAGAGGGAAGGAGG - Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1124974690 15:34521497-34521519 GAGGGGGCAAAGAGGGAAGGAGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125605824 15:40939321-40939343 GAGGGCATAAAGAGGGAAGGGGG - Intergenic
1125617813 15:41031450-41031472 GAAGGAAAAGAGAGGGAAGGAGG + Intronic
1125707285 15:41750076-41750098 GAGGCCAAAGAGAAGGAATGTGG + Exonic
1125717743 15:41828637-41828659 AATAGAAAAAAGAAGGAAGGAGG - Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1126333522 15:47560614-47560636 GAGGGGAAAAAAAAGTAAAGGGG + Intronic
1126739880 15:51766835-51766857 TAGGGGAAAAAGAAGGAAAGAGG + Intronic
1127117031 15:55738915-55738937 GAGGGAGAAAGGAAGGAAGTAGG + Intronic
1127223211 15:56902106-56902128 GAAGGAATAAAGAAGGAGGGAGG + Intronic
1127392957 15:58521665-58521687 GAGGGGAAGAAAGAGGAAGGGGG + Intronic
1127479552 15:59365961-59365983 GAAGGGAAGAAGAGGGAAGGAGG - Intronic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1127737476 15:61857656-61857678 GGTGGTAAACAGAAGGGAGGTGG + Intronic
1127788658 15:62378803-62378825 AAGGACAGAAAGAAGGAAGGAGG + Intergenic
1128227334 15:66011241-66011263 GAGGGGACTGAGAAGGAAGGTGG + Intronic
1128396281 15:67229581-67229603 GAAAGAAAAAAGGAGGAAGGAGG + Intronic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1128485709 15:68085374-68085396 GTGGGGAAAAAGGAGAAAGGGGG + Intronic
1128585197 15:68843163-68843185 AAGGATAGAAAGAAGGGAGGGGG + Intronic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1129074726 15:72983791-72983813 GAGGGTAAAATAAAGGAAAGCGG - Intergenic
1129119526 15:73387532-73387554 GAGGGAAAAAAGAGGGAGTGAGG + Intergenic
1129228096 15:74181419-74181441 GAGGGGGAAGAGAAGAAAGGTGG + Exonic
1129933060 15:79428291-79428313 AAGGGAGAGAAGAAGGAAGGAGG - Intergenic
1130127412 15:81105350-81105372 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1130127418 15:81105374-81105396 AAGGGAAGAAGGAAGGAAGGAGG - Intronic
1130321245 15:82843976-82843998 GAGGGTAACATGAAGGGAGAAGG + Intronic
1130673169 15:85930720-85930742 GGGGGTAGAGAGAAGGGAGGAGG - Intergenic
1130759956 15:86808694-86808716 AAGGGAAGAAGGAAGGAAGGAGG - Intronic
1131459984 15:92611109-92611131 GAGGGGAGAAGGAAGGAAGGAGG + Intergenic
1131583960 15:93673502-93673524 GAAGGAAAAGGGAAGGAAGGAGG - Intergenic
1131656561 15:94466545-94466567 CAGGATAAGAATAAGGAAGGAGG - Intronic
1131657971 15:94481667-94481689 GATGGTACAAAAAAGGAAGTTGG - Exonic
1131756317 15:95566695-95566717 GTGAGTAGAAGGAAGGAAGGTGG - Intergenic
1131968070 15:97866662-97866684 GGGGAAAAAAGGAAGGAAGGAGG + Intergenic
1132241786 15:100263374-100263396 GAGGGAATAAAGAAGGAATGTGG - Intronic
1133386965 16:5377517-5377539 GAGGGGAGGAAGAAGGACGGAGG + Intergenic
1133569621 16:7027916-7027938 AAGGGAAAAGAGAAGGAAGGAGG + Intronic
1133647180 16:7775267-7775289 GAGGAAAGAAGGAAGGAAGGAGG + Intergenic
1133688291 16:8188044-8188066 GAAGGAAGAAAGAAGGATGGGGG + Intergenic
1133853058 16:9524252-9524274 GAGGGAGGAATGAAGGAAGGTGG - Intergenic
1133853078 16:9524301-9524323 GAGGGAGGAATGAAGGAAGGTGG - Intergenic
1134122788 16:11596667-11596689 GAGGGAAAAAGGAGGGGAGGGGG + Intronic
1134833132 16:17339824-17339846 GAAGGAAGGAAGAAGGAAGGAGG - Intronic
1134833138 16:17339847-17339869 AAGGGAGAAAAGACGGAAGGAGG - Intronic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1135164766 16:20129529-20129551 GAGGAAGGAAAGAAGGAAGGAGG - Intergenic
1135195588 16:20391768-20391790 GAGGTTAAAAAGAAGGCAGTGGG + Intronic
1135583778 16:23651282-23651304 GGTGTTAAAAAGAAAGAAGGTGG - Intronic
1135939577 16:26809682-26809704 GAGGAATGAAAGAAGGAAGGAGG + Intergenic
1136065154 16:27753746-27753768 AAGGAGGAAAAGAAGGAAGGAGG - Intronic
1136470753 16:30478391-30478413 GAAGGGAAAAAGAAAGAAAGAGG + Intronic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137552177 16:49445266-49445288 GAGGGAAAAAAGAGGGAGAGAGG - Intergenic
1137720053 16:50622490-50622512 GAAGGCAAACAGAGGGAAGGAGG - Intronic
1137771387 16:51018319-51018341 GAGGGTAAAATGAAGGAGCTTGG + Intergenic
1137863685 16:51871794-51871816 GAAGGAGAAGAGAAGGAAGGAGG + Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138486706 16:57349860-57349882 GAAGGAAGAAAGAGGGAAGGAGG - Intergenic
1138589591 16:57992481-57992503 GCTGGGAAGAAGAAGGAAGGAGG - Intergenic
1138645208 16:58419657-58419679 GAAAGAAAAAAAAAGGAAGGGGG + Intergenic
1139253544 16:65519624-65519646 GAAGGAAAGAAAAAGGAAGGAGG - Intergenic
1139411832 16:66768420-66768442 GATTATAAAAAGAAGGAAGTAGG + Intronic
1139706505 16:68744570-68744592 GCAGGTAAGAGGAAGGAAGGAGG - Intronic
1139743304 16:69054133-69054155 GAGTGGAAAGAGAAGGATGGAGG + Intronic
1140231014 16:73117192-73117214 GAGGGAAGAAGGAAGGAAAGAGG - Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140684740 16:77422562-77422584 GAGGGAGAAAGAAAGGAAGGAGG + Intronic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140775581 16:78246350-78246372 AAGGGGAAAAAAAAGGTAGGAGG - Intronic
1140895009 16:79317189-79317211 GAGGGACAGATGAAGGAAGGAGG - Intergenic
1140903612 16:79392330-79392352 GAGAGGAGAGAGAAGGAAGGAGG + Intergenic
1140944638 16:79756511-79756533 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1140967668 16:79983004-79983026 GAGTGAAAATAGAAGGGAGGGGG - Intergenic
1140987329 16:80170701-80170723 GAGGGTAGAGGGAAGTAAGGGGG + Intergenic
1141162206 16:81636974-81636996 GCAGTTAAAAAGAAGGAAGGAGG - Intronic
1141331526 16:83115868-83115890 GAGGGCAGAAAGAGGGAATGAGG + Intronic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141411661 16:83838350-83838372 AAGGGAAAAAGGAAGGAAGGAGG + Intergenic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141421621 16:83921397-83921419 GAGGGTGGATGGAAGGAAGGAGG + Exonic
1141714003 16:85716578-85716600 GAGGGAGAAAAGGAGGGAGGAGG + Intronic
1141856217 16:86683082-86683104 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1141856223 16:86683106-86683128 GAGAAGGAAAAGAAGGAAGGAGG + Intergenic
1141882924 16:86871853-86871875 GAGGGAAGAAAGGGGGAAGGGGG - Intergenic
1142028097 16:87825066-87825088 GGTGGGAAACAGAAGGAAGGAGG - Intergenic
1142536956 17:624906-624928 GAAGGGAAAAAGAAAGAAAGAGG - Intronic
1142958245 17:3535454-3535476 GGGGGAAGAAAGAGGGAAGGAGG - Intronic
1143091264 17:4450253-4450275 GAGAGAAAAGAGGAGGAAGGAGG - Intronic
1143173279 17:4942499-4942521 GAGGGTAAAAAAAAGGCACCAGG + Intronic
1143184858 17:5003973-5003995 GGGGGATAAAAGGAGGAAGGAGG - Intronic
1143701115 17:8660902-8660924 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1143945231 17:10585881-10585903 GAGGGCATAAAGATGGAAGCAGG - Intergenic
1144237190 17:13272921-13272943 GAAGATAGAAGGAAGGAAGGAGG + Intergenic
1144279619 17:13712409-13712431 GAGGGAAAAGAAGAGGAAGGTGG + Intergenic
1144524954 17:15981449-15981471 GACTGTAATAAGAAGGAAGTGGG + Intronic
1145772496 17:27503763-27503785 GAGGGTAGGAGGAAGGAATGTGG - Intronic
1146587994 17:34099466-34099488 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
1146700057 17:34949490-34949512 GAGGGAGGGAAGAAGGAAGGAGG + Intronic
1146700059 17:34949494-34949516 GAGGGAAGAAGGAAGGAGGGAGG + Intronic
1146998185 17:37338997-37339019 GAGGGAAAAAGAAAGAAAGGGGG + Intronic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1147770340 17:42863721-42863743 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1148026498 17:44592734-44592756 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1148171606 17:45525774-45525796 GAAAATAGAAAGAAGGAAGGGGG - Intergenic
1148277765 17:46320635-46320657 GAAAATAGAAAGAAGGAAGGGGG + Intronic
1148299972 17:46538490-46538512 GAAAATAGAAAGAAGGAAGGGGG + Intronic
1148364415 17:47042775-47042797 GAAAATAGAAAGAAGGAAGGGGG + Intronic
1148466342 17:47867292-47867314 GAGGGTGAAGAGAAGCAATGAGG + Intergenic
1148475669 17:47927096-47927118 GAGGGACAAAAGAAGAAAGCAGG + Intronic
1148545756 17:48517705-48517727 AAGGATAAAAAGAGGGAAGTGGG + Intergenic
1148579490 17:48733952-48733974 GAGAGGAAAAAAAAGGAAGGAGG - Intergenic
1149107080 17:52982588-52982610 GAGGGGGAGAAGGAGGAAGGGGG - Intergenic
1149538975 17:57454390-57454412 GAGGAAAGAAGGAAGGAAGGAGG - Intronic
1149730721 17:58943561-58943583 GAGGGTAGAAAGGAAGGAGGAGG - Intronic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150281445 17:63931581-63931603 GAGGGTCAAAGGCAGAAAGGGGG - Intronic
1150402532 17:64870813-64870835 GAAAGAAAATAGAAGGAAGGGGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150541356 17:66103376-66103398 GAGGATAGAAAGAAAGAAGAGGG + Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1150885456 17:69080671-69080693 GAGGGATAAAAGTGGGAAGGAGG + Intronic
1151050933 17:70978314-70978336 GAAGGAAGAAGGAAGGAAGGAGG + Intergenic
1151179129 17:72313030-72313052 GAGTAGAAAAAGAAGGAAGTTGG - Intergenic
1151377915 17:73704045-73704067 GAAGGAAAGAAGAAGGGAGGAGG - Intergenic
1152003233 17:77660429-77660451 GAGGGAGAGAAGAAGGAAGGAGG - Intergenic
1152322357 17:79614821-79614843 GAGGAGAAAAAGAAGAAAGAGGG + Intergenic
1152913083 17:83016628-83016650 GAGGGACAGAAGAAGGAGGGAGG + Intronic
1152980617 18:272832-272854 GAGGAGAAAAGGAAGGAATGTGG + Intergenic
1153187700 18:2503050-2503072 GAGAATAAAAAGGAGGAAGAAGG + Intergenic
1153577066 18:6532881-6532903 TAGGGAAGAAAGAAGGAAAGAGG - Intronic
1153979593 18:10297666-10297688 GAGGGGGAGAAGCAGGAAGGAGG - Intergenic
1153995533 18:10438467-10438489 GACTTAAAAAAGAAGGAAGGAGG - Intergenic
1154031408 18:10756889-10756911 CAGGATAAAAAGGAGGAATGGGG + Intronic
1154394385 18:13973695-13973717 GAGGGTATGAAGAAGGAAGTTGG + Intergenic
1155047393 18:22114717-22114739 GAAGGAAAGAAGAAGGAAGGAGG - Intergenic
1155050988 18:22147457-22147479 GAGGGAGGAATGAAGGAAGGAGG - Intergenic
1155144085 18:23069126-23069148 GAGGGTAAAAAAGGAGAAGGGGG + Intergenic
1155449299 18:25946757-25946779 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1155449306 18:25946787-25946809 GAAGGAGGAAAGAAGGAAGGAGG + Intergenic
1155449312 18:25946806-25946828 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1155449316 18:25946825-25946847 GAGGAAAGAAGGAAGGAAGGAGG + Intergenic
1155479861 18:26273693-26273715 GAGGGTAAAAAATGGGAAGAAGG - Intronic
1155692568 18:28643984-28644006 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1155699463 18:28725001-28725023 GAGGAATAAAAGAAGGGAGGGGG + Intergenic
1155917779 18:31572980-31573002 GAGAGGAAAGAGAGGGAAGGAGG + Intergenic
1155931020 18:31708694-31708716 GAGGGAAACAGGAAGAAAGGTGG - Intergenic
1156794201 18:41022272-41022294 GAGGGGACAGAGAAAGAAGGTGG + Intergenic
1156920034 18:42510751-42510773 GAGGGAAAGAGGAAGGAAGGAGG - Intergenic
1157303824 18:46501882-46501904 GAGGATGAAAACAAGAAAGGGGG + Intronic
1157442490 18:47721511-47721533 GAAGGAAAAGCGAAGGAAGGAGG + Intergenic
1157583588 18:48787348-48787370 TAGGGAGAAAGGAAGGAAGGAGG + Intronic
1158103765 18:53861333-53861355 GAGGGAGGAAAGAAGGAGGGAGG + Intergenic
1158103829 18:53861499-53861521 GAGGGCAGAAGGAAGGAGGGAGG + Intergenic
1158124853 18:54089983-54090005 GAGGGCAAAAGCAAGGAAGGGGG + Intergenic
1158256999 18:55562579-55562601 GAGGGTACAAGGAAGTCAGGGGG - Intronic
1158305790 18:56103833-56103855 AAGGAAACAAAGAAGGAAGGAGG + Intergenic
1159116490 18:64119245-64119267 GAGGAAGAACAGAAGGAAGGAGG + Intergenic
1159123058 18:64192486-64192508 GAGGGGAAAATGAAAGAAGTGGG + Intergenic
1159159833 18:64629537-64629559 GGGGGAAAAAACAAGGAGGGAGG - Intergenic
1159212178 18:65338523-65338545 GAAGGAAGAAATAAGGAAGGAGG - Intergenic
1159245358 18:65798579-65798601 GAGGGAGAAAAGAAGGAAGTAGG + Intronic
1159343597 18:67169346-67169368 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1159374222 18:67571541-67571563 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1159419345 18:68196190-68196212 GAGGGTCATAGGAAGGAATGGGG + Intergenic
1159527910 18:69617629-69617651 GAGGGAGGAAGGAAGGAAGGAGG + Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1160236853 18:77092701-77092723 GAAGGAAGAAATAAGGAAGGGGG + Intronic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1161139653 19:2639860-2639882 GAGGGAGAAAGGAAGGAAGGAGG + Intronic
1161416726 19:4151417-4151439 GAGGAAAGAAGGAAGGAAGGAGG + Intergenic
1161638084 19:5401846-5401868 GAGGGAAGGAGGAAGGAAGGAGG + Intergenic
1161913909 19:7214837-7214859 GAGGGAAGAAGGAAGGAAGGAGG - Intronic
1161934672 19:7364337-7364359 GAGGAAGAAAGGAAGGAAGGAGG + Intronic
1161955908 19:7495009-7495031 GAAGGAAGAAGGAAGGAAGGAGG - Intronic
1162334098 19:10049659-10049681 GAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1162350760 19:10147784-10147806 GAGGTTAAAAAGAAGGCATGGGG + Intronic
1162625833 19:11884268-11884290 GAAGGAGAAGAGAAGGAAGGGGG - Intergenic
1162826497 19:13255677-13255699 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1162872709 19:13598502-13598524 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
1163004756 19:14390120-14390142 GAGGGAAAGAAGAGGGAGGGAGG + Intronic
1163055870 19:14717225-14717247 AAGGGAAAAAGGAAAGAAGGTGG - Intronic
1163178290 19:15581083-15581105 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178295 19:15581106-15581128 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178300 19:15581129-15581151 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178305 19:15581152-15581174 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178310 19:15581175-15581197 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178315 19:15581198-15581220 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178320 19:15581221-15581243 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178325 19:15581244-15581266 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178330 19:15581267-15581289 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178335 19:15581290-15581312 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163178340 19:15581313-15581335 GAGGGAAGAAAGAGAGAAGGAGG - Intergenic
1163596025 19:18221333-18221355 GTGGGTAAAAAGCTGGAAGATGG - Intronic
1164324418 19:24179438-24179460 GAGAGAAAAAGGAGGGAAGGAGG + Intergenic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164501441 19:28823631-28823653 GAAGGTAAGGAGAAGGAAGGAGG - Intergenic
1164700336 19:30280249-30280271 GAGGGAAAACAAAAGTAAGGGGG - Intronic
1164730964 19:30504291-30504313 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1164744230 19:30599367-30599389 GAGGGACAAAAGATGGGAGGAGG - Intronic
1164771941 19:30816247-30816269 AAGGGAAGAAAGAAGGAAGGAGG - Intergenic
1164915117 19:32046065-32046087 AAGGAAGAAAAGAAGGAAGGAGG + Intergenic
1164916771 19:32058304-32058326 GAGGGAAGAAGGAAGGAAGGAGG - Intergenic
1164937082 19:32223392-32223414 GAGGGTAGAAGGAAGGATAGAGG + Intergenic
1164975641 19:32570993-32571015 GAGGGAGGAAACAAGGAAGGAGG - Intergenic
1165156867 19:33794599-33794621 GAGGGTGGAATGAGGGAAGGTGG - Intergenic
1165370187 19:35400504-35400526 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1165527935 19:36371961-36371983 AAGGGAGATAAGAAGGAAGGAGG + Intronic
1165770912 19:38379708-38379730 GTGGAGAAAAAGCAGGAAGGAGG + Intronic
1166193881 19:41193829-41193851 GAGGGCACAAAGAAGAAAAGGGG + Intronic
1166898502 19:46039959-46039981 GAGGGGAATAAGAGGGAGGGTGG + Intronic
1167046013 19:47049097-47049119 GCGGGGAAAAAAAAGGAAGGAGG - Intergenic
1167083965 19:47296487-47296509 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1167191302 19:47991790-47991812 GAGGGGAGAAAGAGGGAAAGGGG - Intronic
1167195138 19:48023262-48023284 GAGGGAGGAAAGAAGAAAGGAGG + Intronic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167608200 19:50492902-50492924 GAGGGAAAGGAGGAGGAAGGAGG + Intergenic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
1168261857 19:55199712-55199734 GAGGGAGAAAGGAAGGAAGGAGG + Intronic
1168433798 19:56302294-56302316 GAGGGAGAAAAGAGGGAAGAAGG - Intronic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925330332 2:3053562-3053584 GAGGAAGAAAAGTAGGAAGGAGG + Intergenic
925369957 2:3337051-3337073 AAGGGTAAAAAGAAGGGAAGGGG + Intronic
925436866 2:3846099-3846121 GAGGGAGAAAGGAAGGAAGGAGG - Intronic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
925755550 2:7128377-7128399 GAGGGGGGAAAGGAGGAAGGGGG - Intergenic
925797391 2:7561499-7561521 GAGGGATGAAAGAAGTAAGGAGG - Intergenic
925822927 2:7818225-7818247 GCGGGTAAAGGGTAGGAAGGCGG + Intergenic
925842591 2:8006582-8006604 GAGGAGGAAAAGAAGGATGGAGG - Intergenic
925862572 2:8194348-8194370 GAAGGGAAAAAGAAGGCAGGGGG - Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926244580 2:11113515-11113537 GAGGGAAGGAAGAAGGAAGAAGG - Intergenic
926244633 2:11113677-11113699 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
926244660 2:11113776-11113798 GAGGGAAGAAGGAAGGAAGAAGG - Intergenic
926244672 2:11113819-11113841 GAAGGAAGGAAGAAGGAAGGAGG - Intergenic
926690313 2:15728747-15728769 GATGGGGAAAAGAAGGCAGGGGG + Intronic
927324787 2:21791710-21791732 GAGGGAATAAGAAAGGAAGGAGG - Intergenic
927524360 2:23723425-23723447 GAGGAAAGAAAGGAGGAAGGAGG + Intergenic
927875908 2:26655135-26655157 GAGGAAGAAAGGAAGGAAGGAGG + Intergenic
928141105 2:28730104-28730126 GAGGAAAGAAGGAAGGAAGGTGG - Intergenic
928250802 2:29677198-29677220 GAGGGAAGGAGGAAGGAAGGAGG - Intronic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
928347904 2:30517710-30517732 GAGGGGAAAAAGAGAGAAAGAGG + Intronic
928664068 2:33532990-33533012 GTGGGGGAAAAGAAAGAAGGAGG - Intronic
928830364 2:35475439-35475461 GAGGGTAAAATGAGAGAAGCAGG + Intergenic
928933055 2:36645459-36645481 GAGAGTAATTAGAAGGGAGGAGG + Intronic
928950057 2:36806438-36806460 GAGGGTAGAAAAAAGGCAAGAGG - Intronic
929370396 2:41216674-41216696 GAAGGAAAAATGAAGGAAGGAGG - Intergenic
929444764 2:41993019-41993041 GAGGGAGAAAAGATGGGAGGGGG - Intergenic
929611942 2:43277188-43277210 GAGGGTTTAAAGCAGGAATGAGG - Intronic
929635975 2:43521177-43521199 GAGGGAAGAAGGAAGGAAAGAGG + Intronic
929801549 2:45108758-45108780 GAGTGTTTCAAGAAGGAAGGAGG + Intergenic
930277844 2:49334461-49334483 GAGGGTAAAATAAAGTCAGGTGG + Intergenic
930366569 2:50446578-50446600 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
930909615 2:56616233-56616255 GAGGAAGGAAAGAAGGAAGGAGG - Intergenic
931075571 2:58707728-58707750 GAAGGGAAAAGGAAAGAAGGGGG - Intergenic
931085039 2:58820578-58820600 GAGGTTAAGAAGATGGGAGGAGG - Intergenic
931098882 2:58973214-58973236 GGGGGAAAAAGAAAGGAAGGTGG + Intergenic
931203705 2:60126295-60126317 GAGGGGAGAAAAAAGGAAAGTGG + Intergenic
931330081 2:61271692-61271714 GAGGGGAAGAAGGGGGAAGGAGG + Intronic
931444301 2:62313994-62314016 GAAGGTAGCAGGAAGGAAGGAGG + Intergenic
931591586 2:63889349-63889371 GAGGGAAAAAAGACTGAAGAGGG + Intronic
932132648 2:69201697-69201719 GAGGGTAGAAAGTGTGAAGGAGG + Intronic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932778607 2:74545240-74545262 GAGGGTAAAAACAAAGATGGAGG - Intronic
933337363 2:80975541-80975563 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933912604 2:86956466-86956488 GAGGGTCAAAGGAAGGTATGGGG + Intronic
934010391 2:87813428-87813450 GAGGGTCAAAGGAAGGTATGGGG - Intronic
934647835 2:96069407-96069429 GAGGGAAAGAAGAAGTAAAGAGG - Intergenic
934715074 2:96538384-96538406 GAGGGTACAGAAAGGGAAGGAGG - Intronic
934841207 2:97625228-97625250 GAGGGAAAGAAGAAGTAAAGAGG - Intergenic
934955748 2:98616905-98616927 GAGGGTAGAGCGAAGAAAGGTGG + Intronic
935022775 2:99247596-99247618 GACTGTAAAAGGAAGGAGGGAGG - Intronic
935439719 2:103077788-103077810 GAGAGAGAAAGGAAGGAAGGAGG - Intergenic
935516662 2:104048882-104048904 GAAAGTAAAAGGAAGGAAGGAGG - Intergenic
935611374 2:105029314-105029336 GAGGGAGGAAAGAGGGAAGGGGG + Intergenic
935773957 2:106454138-106454160 GAGGGTCAAAGGAAGGTATGGGG - Intronic
935906106 2:107841775-107841797 GAGGGTCAAAGGAAGGTATGGGG + Intronic
935976804 2:108586340-108586362 GAGCCCAAAAAGAAGGAAAGTGG + Intronic
935992577 2:108734293-108734315 GAGGGTCAAAGGAAGGTATGGGG + Intronic
936040675 2:109146864-109146886 GAGGGAAAAAAGAAGAGAAGAGG - Intronic
936127892 2:109806927-109806949 GAGGGTCAAAGGAAGGTATGGGG + Intronic
936150052 2:110012312-110012334 GAGGGTAAGATGCAGAAAGGAGG - Intergenic
936194624 2:110359058-110359080 GAGGGTAAGATGCAGAAAGGAGG + Intergenic
936216805 2:110564558-110564580 GAGGGTCAAAGGAAGGTATGGGG - Intronic
936233587 2:110725005-110725027 AAGGGAGAAAGGAAGGAAGGAGG + Intergenic
936314934 2:111416238-111416260 CAGGGGGAAAAAAAGGAAGGAGG + Intergenic
936425944 2:112419139-112419161 GAGGGTCAAAGGAAGGTATGGGG - Intronic
936527977 2:113255083-113255105 GAAGGAAAAAAGAAGGAAGGAGG + Intronic
936527992 2:113255157-113255179 GAAGAAAAAAAGAAGGAAGGAGG + Intronic
936740947 2:115507895-115507917 GAAGGTAAAAAGTAGGTGGGTGG + Intronic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
936983712 2:118288324-118288346 GAGGGGATAGAGAAGGAATGAGG + Intergenic
937072300 2:119073428-119073450 GAGGGAAGGAGGAAGGAAGGAGG + Intergenic
937084869 2:119164833-119164855 GAGGGAAGAAGAAAGGAAGGAGG - Intergenic
937089365 2:119195822-119195844 GAGGGAGGAAAGAAGGAAGGAGG + Intergenic
937089374 2:119195846-119195868 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
937425917 2:121798226-121798248 GAAGGAAAAGAGAAGGAAGGGGG + Intergenic
937479209 2:122241579-122241601 AAGGGTGAGAAGAAGGAAGGAGG + Intergenic
937569687 2:123341084-123341106 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
937619616 2:123970719-123970741 AAGGGGAAAGAGAAGGAAAGAGG + Intergenic
937687394 2:124713179-124713201 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
937884654 2:126891553-126891575 GAGGATAAAGAGCAGGGAGGAGG + Intergenic
937998868 2:127716100-127716122 GAGGCTATACAGAAGGAACGTGG - Intronic
938173791 2:129105700-129105722 GAAGGAAGAAAGAAGGAAGAAGG + Intergenic
938317822 2:130342148-130342170 GAGGGTGACAAGGAAGAAGGTGG - Exonic
938572526 2:132573264-132573286 GAGGGAAAAATAGAGGAAGGAGG - Intronic
938845731 2:135206776-135206798 AAGGATAGAAGGAAGGAAGGAGG + Intronic
939112799 2:138028565-138028587 GAGTTTAATAAGAAAGAAGGAGG + Intergenic
939144032 2:138390814-138390836 GACTGTACAAAGAAGGAAAGAGG + Intergenic
939175752 2:138745823-138745845 GGGGGGAAGAAGCAGGAAGGTGG + Intronic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939320139 2:140609355-140609377 GAGGGGAAAAGGAAGAGAGGAGG - Intronic
939491617 2:142883556-142883578 GGAGGGAAAAAGAGGGAAGGAGG - Intronic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
940051027 2:149464927-149464949 GAAGATAAAAAGATGCAAGGGGG + Intronic
940531420 2:154882615-154882637 GAGTATAAAGAGAAGGAAAGGGG - Intergenic
941164449 2:162070591-162070613 GAAGGAAAAAGGAAGGAAGTAGG - Intronic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941539008 2:166758997-166759019 GAAGGCAGAAGGAAGGAAGGAGG + Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942522104 2:176815521-176815543 GAGGGAAGAAAAAAGGAAGAAGG + Intergenic
942724467 2:178991534-178991556 GAGGGTAAGAAGGAAGAAGGAGG + Intronic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943188148 2:184640249-184640271 GAGGAGAAGAAGAAGAAAGGAGG + Intronic
943575933 2:189631076-189631098 GAGGAAAAACAAAAGGAAGGAGG + Intergenic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
943791348 2:191935645-191935667 GAGGGTGGGAAGAAGAAAGGTGG - Intergenic
943901978 2:193451229-193451251 GAGGTTATAAATAAGCAAGGGGG + Intergenic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944383095 2:199134492-199134514 GAGGATAGTAAGAAGTAAGGAGG - Intergenic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944493107 2:200278302-200278324 GTGGGGAAGAAGAAGGGAGGAGG - Intergenic
944756877 2:202772430-202772452 GAGGGTCAAAAGAAAGGAGCTGG + Intergenic
944832728 2:203549113-203549135 GAGGGAAGAAGGAAGGAGGGAGG - Intergenic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945655351 2:212616537-212616559 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
945825343 2:214714844-214714866 GAGAGTGGAAAGAAGGAATGTGG - Intergenic
945911207 2:215651516-215651538 GAGGGAAGGAGGAAGGAAGGAGG + Intergenic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947006018 2:225512481-225512503 GAGGGAAGGAGGAAGGAAGGAGG - Intronic
947006032 2:225512545-225512567 GAGGGAAGAAGGAAGGAAGGAGG - Intronic
947030189 2:225783446-225783468 GAGTGAGAAAGGAAGGAAGGGGG - Intergenic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947336303 2:229088413-229088435 AAGGAAGAAAAGAAGGAAGGAGG + Intronic
947661239 2:231870084-231870106 GAGGGGAAAAGGAAGGAAAGAGG - Intergenic
948200345 2:236125503-236125525 GAAAGGAAAAAGAAGGAATGTGG + Exonic
948570869 2:238916429-238916451 GAGGGAAAGAAGGAGGAGGGAGG + Intergenic
948751811 2:240137447-240137469 GAGGGAAAGGAGAAGGAAAGGGG + Intergenic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
948917617 2:241044136-241044158 GAGGAAAAAAAGAAAGAAGTGGG + Intronic
949045986 2:241872873-241872895 GAAGGCAAAGAGAAGGAAGGTGG + Exonic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1168944548 20:1741710-1741732 GGAGGGAAAAAGAAGAAAGGAGG - Intergenic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1168975606 20:1963223-1963245 GACGGAGAAAAGAAGGAGGGAGG + Intergenic
1169244327 20:4014258-4014280 AAGGGGAAAAAAAAGCAAGGAGG + Intronic
1169305090 20:4482682-4482704 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1169395739 20:5227518-5227540 GTGTGTAACAAGTAGGAAGGTGG + Intergenic
1169585983 20:7086045-7086067 GAGGAGGAAAAGAAGGAAGGAGG - Intergenic
1169754898 20:9033351-9033373 GAGAGTACAAGGAAGGAAGAGGG - Intergenic
1169795329 20:9456375-9456397 GATGGTAAAAAGATGAATGGGGG + Intronic
1170000765 20:11610846-11610868 AAGGAAAGAAAGAAGGAAGGAGG - Intergenic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170366547 20:15604285-15604307 GAGGGAGAAAAGATGGAAAGAGG - Intronic
1170436925 20:16339907-16339929 GAGAAAAAAATGAAGGAAGGAGG - Intronic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1170758088 20:19222743-19222765 GAGGGAAGGAAGAAGGAGGGAGG - Intronic
1170813936 20:19697020-19697042 GAGGGAGAAGAGAAGGAAAGAGG + Intronic
1170881037 20:20296488-20296510 AAGGGAGTAAAGAAGGAAGGAGG - Intronic
1170912259 20:20584538-20584560 GAAGGTAAAAAGTGGGAAGATGG + Intronic
1171342996 20:24445179-24445201 GTGGGTAGGAAGAGGGAAGGGGG - Intergenic
1171370933 20:24661522-24661544 GGAGGAAAAAAGGAGGAAGGAGG + Intronic
1171983584 20:31644145-31644167 GAGGGTTGAAAGTAGGAAGTAGG - Intronic
1172587471 20:36094617-36094639 GAGTGTAAAAGGAAGGAAGGTGG + Intronic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172687018 20:36763453-36763475 GAGGGTAATAAGAAACACGGAGG + Intronic
1172754575 20:37274097-37274119 GAGGGAAAGGAGAAGGAAAGAGG + Intergenic
1172853526 20:37983667-37983689 GAGGGTACAGAGAGGGAAGGCGG + Intronic
1172896601 20:38304616-38304638 GAGGTTACATAGAGGGAAGGAGG - Intronic
1172931222 20:38587720-38587742 AAGGGAAAAAAGAAAGAAAGAGG - Intronic
1172974457 20:38895763-38895785 GAGGAGAGAAAGAAGGAAGTTGG - Intronic
1172974463 20:38895790-38895812 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974469 20:38895817-38895839 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974475 20:38895844-38895866 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974483 20:38895871-38895893 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974491 20:38895898-38895920 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974499 20:38895925-38895947 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974507 20:38895952-38895974 GAGGGAAGAAAGAAGAAAGGAGG - Intronic
1172974514 20:38895979-38896001 GAGGAGAGAAAGAAGGAAGGAGG - Intronic
1172974521 20:38896007-38896029 GAGGAAAGAAAGAAGGAAGGGGG - Intronic
1173005095 20:39134201-39134223 GAGGGGAAAAAAAAGAAAAGAGG - Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173438873 20:43057389-43057411 AAGGAGGAAAAGAAGGAAGGAGG + Intronic
1173708871 20:45137074-45137096 GAGGGAGGAGAGAAGGAAGGAGG - Intergenic
1174265129 20:49325767-49325789 GAGGGCAAGAAGGAGGAGGGAGG - Intergenic
1174434545 20:50496710-50496732 AAAAGGAAAAAGAAGGAAGGAGG - Intergenic
1174469351 20:50744648-50744670 GAGGGTGAAAAGCAGGAGGGAGG - Intronic
1174525661 20:51168663-51168685 GAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1174559417 20:51419422-51419444 GATGGGAAAAAAGAGGAAGGAGG - Intronic
1174589795 20:51635838-51635860 GAGGGAAAAAGGAAGGAAGGAGG + Intronic
1174723615 20:52838963-52838985 GAAGGAAGAAAGAAGGAAGAAGG - Intergenic
1174755119 20:53150676-53150698 AAAGGAAAAAGGAAGGAAGGAGG + Intronic
1174901803 20:54508467-54508489 GAGGGTGGAAATAAGGAAGTGGG + Intronic
1175059643 20:56230409-56230431 GAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1175144596 20:56886097-56886119 GAGGGTGATAAGGGGGAAGGAGG + Intergenic
1175293662 20:57894617-57894639 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175293679 20:57894685-57894707 GAGGGAAGGAAGAAAGAAGGAGG + Intergenic
1175293681 20:57894689-57894711 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175293687 20:57894708-57894730 GAGGGAAGGAGGAAGGAAGGAGG + Intergenic
1175663463 20:60837642-60837664 CAGGATAGAAAGAAGTAAGGAGG + Intergenic
1175702217 20:61147811-61147833 GAGTGGATAGAGAAGGAAGGGGG + Intergenic
1175768561 20:61608064-61608086 GAGGGGAGAATGATGGAAGGGGG - Intronic
1175833803 20:61981042-61981064 GAGGCAGAAAAGAAGGAAAGGGG + Intronic
1177087638 21:16727192-16727214 GAGGGTAAAGTGAAGTACGGTGG - Intergenic
1177097236 21:16851290-16851312 GAGGGTAAGAAGACAGAAGCTGG + Intergenic
1177144986 21:17397780-17397802 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1177567108 21:22838177-22838199 GAGGGGGAAGGGAAGGAAGGGGG + Intergenic
1177831743 21:26146901-26146923 GACTGTACATAGAAGGAAGGTGG - Intronic
1177986821 21:27986496-27986518 GAAGGAAAAAAGAAGGGAGAGGG + Intergenic
1178002141 21:28174322-28174344 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1178016107 21:28347537-28347559 GAGGGAGAAAGAAAGGAAGGAGG - Intergenic
1178061549 21:28858572-28858594 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178461821 21:32809344-32809366 GAGAGGAAAAAGAAAGAAAGAGG - Intronic
1178471001 21:32892805-32892827 AAAGGAAGAAAGAAGGAAGGAGG - Intergenic
1178477997 21:32954797-32954819 GAGAGAAAAAAAAAGGGAGGGGG - Intergenic
1178598346 21:33974757-33974779 AAGGGAAAAAAGAAGGAAAGAGG - Intergenic
1178808574 21:35860130-35860152 GAGGGAGGAAAGAAGGAGGGAGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1178926457 21:36779312-36779334 GAAGAAAGAAAGAAGGAAGGAGG - Intronic
1178940703 21:36902648-36902670 AAGAGAGAAAAGAAGGAAGGAGG + Intronic
1179251927 21:39677904-39677926 GCGTGTGAAAAGAAGCAAGGGGG + Intergenic
1179442448 21:41404572-41404594 TGGGGAAGAAAGAAGGAAGGAGG + Intronic
1179499135 21:41796047-41796069 GAGGGGAGAAAGGGGGAAGGGGG - Intergenic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1180304678 22:11065108-11065130 GAGGGTGGCAAGAAGGAAAGAGG - Intergenic
1180582699 22:16856062-16856084 GAGGGTAAGATGCAGAAAGGAGG + Intergenic
1181119723 22:20657798-20657820 GAGGGTGACAAGCAGGAGGGGGG + Intergenic
1181180568 22:21065251-21065273 GAAGGTAAATAGAAGGGAGAAGG - Intergenic
1181544903 22:23597156-23597178 GAGGAAGGAAAGAAGGAAGGAGG - Intergenic
1181663371 22:24370922-24370944 GAGGGAAAAAAGAAAGGGGGTGG + Intronic
1181917395 22:26292165-26292187 GAGGAAGGAAAGAAGGAAGGAGG + Intronic
1181928972 22:26383996-26384018 GAAGGGAAAAGGCAGGAAGGAGG + Intergenic
1181972453 22:26702087-26702109 AAGGGAAAAAAGAAAGAATGGGG - Intergenic
1182008333 22:26979785-26979807 GCGGGATAAAGGAAGGAAGGAGG - Intergenic
1182031574 22:27163217-27163239 AAGGGAAATAGGAAGGAAGGAGG + Intergenic
1182103268 22:27672001-27672023 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1183143001 22:35961849-35961871 GAGGGTACAATGTTGGAAGGAGG - Intronic
1183185339 22:36288588-36288610 GAGGCTAGAAAGAAGGAATATGG + Intronic
1183247332 22:36703664-36703686 AGGGGTAAAAAGAGGAAAGGCGG - Intergenic
1183342470 22:37289231-37289253 GAGGCAAGAAAGAAGGAAGATGG - Intronic
1183371908 22:37437484-37437506 GAAGGAAGAATGAAGGAAGGAGG + Intergenic
1183501376 22:38181600-38181622 GGGGATGAAAAGATGGAAGGTGG + Intronic
1183613057 22:38923698-38923720 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183613072 22:38923747-38923769 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183644839 22:39118976-39118998 AAAGTTTAAAAGAAGGAAGGGGG - Intergenic
1183698814 22:39438209-39438231 GAGGGAGAAGGGAAGGAAGGAGG - Intergenic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1184755170 22:46511766-46511788 GAGGGTGAGATGAGGGAAGGAGG + Intronic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
949111099 3:261326-261348 GAAGGAAGAAAGAAGGAAAGAGG + Intronic
949278041 3:2310514-2310536 GAGGTGAAAAAGTGGGAAGGCGG - Intronic
949313627 3:2727871-2727893 AGGGGTTAAAAGAAGGAAGGCGG + Intronic
949634444 3:5967574-5967596 GAGGGAAGAAGGAAGGAAGGGGG - Intergenic
949680708 3:6511372-6511394 GAGAGTAAAGAAAAGGAAGTAGG + Intergenic
949768222 3:7550357-7550379 GAGAGAGAAAGGAAGGAAGGAGG - Intronic
949868977 3:8570834-8570856 AAGGATAACAGGAAGGAAGGAGG - Intergenic
950582141 3:13869576-13869598 GAGAGAGAAAGGAAGGAAGGAGG + Intronic
950750108 3:15121775-15121797 GGAGAGAAAAAGAAGGAAGGTGG + Intergenic
950868691 3:16210707-16210729 GAGGGTGAGAAAAAGAAAGGAGG + Intronic
950924646 3:16728416-16728438 GAGGGTGAAAAGGGGGCAGGCGG + Intergenic
951144236 3:19207082-19207104 GTTAGTAAAAATAAGGAAGGAGG + Intronic
951376824 3:21928313-21928335 GAGGGAGGAAGGAAGGAAGGAGG + Intronic
951816829 3:26763788-26763810 AAGGAAAGAAAGAAGGAAGGAGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951906684 3:27713904-27713926 GAGGGAAAAAAGGAAGAAGGGGG - Intergenic
951974145 3:28484678-28484700 GAGGGAGACAGGAAGGAAGGAGG - Intronic
952196056 3:31076258-31076280 GAGCGTGAAAAGCAGGATGGTGG + Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952358517 3:32606426-32606448 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
952647613 3:35680722-35680744 GAAAGTAAAAAGAAAGAAGAAGG - Intronic
952740741 3:36731791-36731813 GAGGGAGAAAAGAAGGAGTGAGG - Intronic
953014163 3:39056810-39056832 GAGTGAACAAAGAAAGAAGGAGG + Intronic
953330046 3:42045196-42045218 GAGGGTAAAAATTTTGAAGGAGG + Intronic
953380975 3:42472894-42472916 GGGGGAAAAGAGAAGGGAGGTGG - Intergenic
953439253 3:42904112-42904134 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
953783644 3:45894283-45894305 CAGGGTAAAGAGGAGAAAGGTGG + Intronic
954074064 3:48163943-48163965 CAGGGTGAAAAGAAAAAAGGGGG - Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954495129 3:50951240-50951262 TAGGAGAGAAAGAAGGAAGGAGG - Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954659656 3:52220325-52220347 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
954730975 3:52661536-52661558 GGGGCTGAAAAGGAGGAAGGCGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955353345 3:58210048-58210070 GAGGGAGAGAGGAAGGAAGGAGG + Intronic
955366043 3:58311054-58311076 GAGGGTAGAGAGGATGAAGGAGG - Intronic
955536072 3:59925078-59925100 AAGGGAAAAAAATAGGAAGGAGG - Intronic
955572999 3:60327877-60327899 GAAGGAAACAAGAAGGGAGGTGG + Intronic
956360596 3:68442608-68442630 GAAGGAAAAAAGAAAGAGGGAGG + Intronic
956486025 3:69722724-69722746 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
956614421 3:71156825-71156847 GGAGATAAAAGGAAGGAAGGTGG + Intronic
956643670 3:71435961-71435983 GAGGAAAAAAGGAGGGAAGGAGG + Intronic
956732408 3:72208609-72208631 GAGGGAGAGAAGAAGGAAGTTGG + Intergenic
956774134 3:72550825-72550847 GAGGGTGAGACAAAGGAAGGAGG - Intergenic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957728840 3:84105772-84105794 GTGGTTACAAAGGAGGAAGGAGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957767586 3:84646437-84646459 GAGGGTAGAAGGAAGGGAAGTGG - Intergenic
957977312 3:87463147-87463169 GAAGGAAAAAAGAAAGAAGGAGG + Intergenic
958433242 3:94066867-94066889 GAAGGTATAGAGAAGAAAGGAGG - Intronic
958502439 3:94930706-94930728 GATGGAAAAGAGAGGGAAGGAGG - Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958650812 3:96933260-96933282 GAGGGAAAGAAGAAGAAAGTAGG + Intronic
958813305 3:98888256-98888278 GAGCTTAAAAAGAATGAAGCTGG - Intronic
958831323 3:99093817-99093839 GAGGGTAAAAAAAAATAAGTAGG + Intergenic
958929165 3:100190743-100190765 GAGGAGAGAAGGAAGGAAGGAGG + Intronic
959185256 3:103038658-103038680 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
959240894 3:103792444-103792466 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959440220 3:106365080-106365102 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
959497525 3:107068763-107068785 GTGAGGAAAAAGAAGGTAGGGGG - Intergenic
959740459 3:109712630-109712652 GAGGTTACAGAGAAGCAAGGAGG + Intergenic
959999716 3:112717916-112717938 GATGGGAAAAAGAAGAAAGGAGG + Intergenic
960288970 3:115861114-115861136 AAGGAAAGAAAGAAGGAAGGAGG - Intronic
960356184 3:116656196-116656218 GAGGGAATAAAGAAGGGAGAGGG - Intronic
960530293 3:118756459-118756481 GAGGAGAAAGAGAAGAAAGGAGG + Intergenic
960540407 3:118855298-118855320 GAAGATAAAAAGAATGAAAGAGG + Intergenic
960585535 3:119317695-119317717 GAGGGAAAAAGAAAGGAAGGAGG + Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
960897788 3:122523555-122523577 GAGTGAGAAAGGAAGGAAGGAGG - Intergenic
961133015 3:124486366-124486388 GAAGGTTAAAATAAGGAAAGGGG + Intronic
961340193 3:126212545-126212567 GAAGGAAGAAGGAAGGAAGGAGG + Intergenic
961345469 3:126260729-126260751 GAAGGGAAGAAGAAGGAAGGGGG - Intergenic
961347739 3:126274965-126274987 GAGGGAAAGAAGGAGGAAAGAGG - Intergenic
961778479 3:129307050-129307072 GAGGGTGAAAGGGAGGGAGGTGG - Intergenic
961862368 3:129927091-129927113 GAGGGAGAACAGAAGTAAGGAGG + Intergenic
962092298 3:132257221-132257243 GTGGGTGAAAGGAAGGCAGGGGG + Intronic
962102365 3:132356313-132356335 AAGCCTAAAAAGAAGGGAGGAGG + Intronic
962234809 3:133698900-133698922 GAGGGTTGAGAGATGGAAGGAGG - Intergenic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962482853 3:135812623-135812645 AAGGGGAAAAAGAAGTCAGGGGG - Intergenic
962533587 3:136305918-136305940 GAAGGGAAAATGAAGCAAGGGGG + Intronic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963000713 3:140679247-140679269 GATGGGAAAAAGAAGGTAGTAGG - Intronic
963057967 3:141202709-141202731 GACGGTGAAAAGGAGAAAGGGGG + Intergenic
963471082 3:145742658-145742680 GAGGGGAAAGAGAAAGAAGCAGG - Intergenic
963526083 3:146415172-146415194 TAGAGTAAAAATAAAGAAGGTGG + Intronic
963589490 3:147239292-147239314 GATTTTAAAAAGAAGGAAGAAGG + Intergenic
963690049 3:148488055-148488077 GAAGGTTAAAAGAAAGAAGGAGG + Intergenic
963897332 3:150701161-150701183 GAGAGAAGAAAGATGGAAGGAGG + Intronic
964180639 3:153880321-153880343 GGGGCAAAAAAGAATGAAGGAGG + Intergenic
964212919 3:154247922-154247944 GAGGGAAAAAAGAATGACAGTGG - Intronic
964617856 3:158688473-158688495 AAGGGTAAAGGGAAGGAAAGAGG - Intronic
964673679 3:159254705-159254727 GAGGGAAGGGAGAAGGAAGGAGG - Intronic
964903853 3:161693978-161694000 GAGGGAAGGAGGAAGGAAGGAGG - Intergenic
965128614 3:164664684-164664706 GAAAATAAAAAAAAGGAAGGGGG + Intergenic
965172173 3:165279878-165279900 GAAGGAGAAAAGAAGGAAGAAGG - Intergenic
965321208 3:167253339-167253361 GTAGGTGAAAAGAAGTAAGGAGG + Intronic
965323311 3:167273096-167273118 GAAGGAGAAGAGAAGGAAGGGGG - Intronic
965902357 3:173657751-173657773 GATGGAAGAAAGAAGGAAGAGGG + Intronic
966028138 3:175311604-175311626 GAGGGAAGAAGGAAGGAAAGAGG - Intronic
966273771 3:178141214-178141236 GAGGGTGGAAGGAAGGAAGGAGG - Intergenic
966370652 3:179247987-179248009 CAGGGTAAAAGGAAGGCAAGGGG - Intronic
966381286 3:179347534-179347556 GAGGGGAAGAAGTTGGAAGGGGG + Intergenic
966395123 3:179494552-179494574 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
966524150 3:180903139-180903161 GCGGTTAAAAAGAAGGAAAGGGG + Intronic
966598028 3:181745000-181745022 AAGGGCAGAAGGAAGGAAGGAGG - Intergenic
966605435 3:181816881-181816903 GAGGTTGGAATGAAGGAAGGTGG - Intergenic
966693422 3:182764121-182764143 AAGGATGAAAGGAAGGAAGGAGG - Intergenic
966739464 3:183218747-183218769 GAGGGTTAGCGGAAGGAAGGGGG - Intronic
966936482 3:184712948-184712970 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
967442983 3:189530573-189530595 GAAGGAGAAAAGAAGGAAGAAGG - Intergenic
967503389 3:190225420-190225442 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
968159973 3:196418243-196418265 AAGGAAGAAAAGAAGGAAGGAGG + Intronic
968840934 4:3005355-3005377 GAGGTTAAAGAGAGGGAAGATGG + Intronic
969143501 4:5100430-5100452 GAAGGAAGAAAGGAGGAAGGAGG - Intronic
969183278 4:5457909-5457931 GAGGGAGAGAGGAAGGAAGGAGG + Intronic
969228967 4:5816607-5816629 GAGGGAGAAAAGAAGGACAGAGG - Intronic
969353866 4:6613825-6613847 GAAGGAAAAAAGAGGGAGGGAGG + Intronic
969495192 4:7522634-7522656 GAGGGAGAAAAGGAGGGAGGAGG - Intronic
969547680 4:7842506-7842528 CAGGAGGAAAAGAAGGAAGGTGG + Intronic
969723645 4:8906869-8906891 GAGGGAGGCAAGAAGGAAGGGGG - Intergenic
970341862 4:15115732-15115754 GAGGAAAGAAGGAAGGAAGGAGG - Intergenic
970434685 4:16022088-16022110 GAAGGAGAAAGGAAGGAAGGAGG + Intronic
970479302 4:16457667-16457689 GAGGGAGAGAGGAAGGAAGGAGG - Intergenic
970914899 4:21321649-21321671 GAAGGAAGAAACAAGGAAGGAGG + Intronic
970914930 4:21321775-21321797 GAGGGAGAGAGGAAGGAAGGAGG + Intronic
970914982 4:21321994-21322016 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
971393753 4:26209776-26209798 GAGGGAAGGAGGAAGGAAGGGGG - Intronic
971393771 4:26209825-26209847 GAGGGAAGGAGGAAGGAAGGGGG - Intronic
971394446 4:26215383-26215405 GAGGGAGAGAGGAAGGAAGGGGG + Intronic
971432945 4:26587992-26588014 GACAGTATAAGGAAGGAAGGAGG - Intronic
971439176 4:26661327-26661349 GAGGGTAAGGAAAAAGAAGGTGG - Intronic
971750842 4:30645864-30645886 GAAGGAAGAAAGAAGGAAGAAGG - Intergenic
971932386 4:33101806-33101828 GAAGGAAAAAAGAAGGAAGGAGG - Intergenic
972103268 4:35447996-35448018 GAGGAAGAAAAGAAGGAAGAAGG + Intergenic
972180619 4:36460439-36460461 GGAGGTAAAAAGAAGAAAGAAGG - Intergenic
972211499 4:36843314-36843336 GAAAGAAAAAGGAAGGAAGGGGG - Intergenic
972279605 4:37589588-37589610 GAGAGCCAAAAGGAGGAAGGAGG - Intronic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
972368071 4:38394500-38394522 CAGGGGACAAAGAAGGAAAGGGG + Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972659187 4:41097839-41097861 GAGGTTAAAAAGAAGTGTGGAGG + Intronic
972785903 4:42326659-42326681 GAAGGAAGAAGGAAGGAAGGAGG + Intergenic
972874677 4:43343691-43343713 GAAGGAAAAAGGAAGGAAGGAGG - Intergenic
973063595 4:45761397-45761419 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
973818900 4:54645179-54645201 GAGGGTAAAATTAAGGAATGAGG - Intergenic
974020510 4:56688201-56688223 GAGGAAAGAAGGAAGGAAGGAGG + Intergenic
974219627 4:58949599-58949621 GTAGGTAAAAAGAAAGAAGAGGG - Intergenic
974446702 4:61993589-61993611 CAGGGTAGAAACAATGAAGGAGG - Intronic
974518351 4:62945752-62945774 GAAGGAAAAAAAAAGGGAGGGGG - Intergenic
974702344 4:65467829-65467851 AAGGGTAAAAAGAAGTGAAGAGG + Intronic
974941947 4:68480223-68480245 GAAGGAAAGAAGAAAGAAGGTGG - Intronic
974958612 4:68673228-68673250 GAGGGTTTGAAGAGGGAAGGGGG - Intergenic
975245673 4:72118004-72118026 AAGGAAAAAAGGAAGGAAGGGGG + Intronic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
975660444 4:76683433-76683455 GAGGGTAAAGGCAAGGAAGGAGG - Intronic
976048862 4:80986328-80986350 GATGGCAAAAAGAAGAAAGAAGG + Intergenic
976085440 4:81402942-81402964 GTTGGAAAAAGGAAGGAAGGAGG + Intergenic
976245493 4:83002385-83002407 GAGGGAGGAAGGAAGGAAGGAGG + Intronic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
976815001 4:89138037-89138059 GAGGGAAGAAGGAAGAAAGGTGG - Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
976929079 4:90541151-90541173 GAGGGTAAAAAGAAAGTAATTGG + Intronic
977157095 4:93588206-93588228 GAATATAAAAAGAAGAAAGGGGG + Intronic
977303332 4:95293686-95293708 CTGGGTACAAAGAAGGGAGGAGG - Intronic
977476169 4:97512653-97512675 GGGAGGAAGAAGAAGGAAGGGGG + Intronic
977593368 4:98851020-98851042 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
977700911 4:100021749-100021771 GAGGAAAGAAAGAAGGAAGAGGG - Intergenic
977767529 4:100817442-100817464 GAGGGTGAACAGAAAAAAGGAGG - Intronic
977810204 4:101348060-101348082 GAGGGCAAGAAGAGAGAAGGCGG + Intronic
977895726 4:102362800-102362822 GAAGGAAAACAGAAGCAAGGTGG + Intronic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
979217337 4:118181332-118181354 GATGGTTAAAAGGAAGAAGGAGG + Intronic
979269774 4:118746191-118746213 GAGGAAAGAAGGAAGGAAGGAGG + Intronic
979538442 4:121851396-121851418 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
979766477 4:124470415-124470437 AAGGAAAGAAAGAAGGAAGGAGG - Intergenic
979774594 4:124573357-124573379 GAGGGCAGAAAGAAGGGACGTGG + Intergenic
979940054 4:126751202-126751224 GAGGGTGAGATGAAGGGAGGTGG - Intergenic
980021380 4:127714350-127714372 GGGGGAAAAATGAAGGAAGCAGG - Intronic
980121190 4:128730225-128730247 GAAGGGGAAGAGAAGGAAGGAGG - Intergenic
980240832 4:130172646-130172668 CAGGGTATAAGGTAGGAAGGAGG - Intergenic
980253789 4:130350193-130350215 GAAGGAAAAAGGAAGGAGGGAGG - Intergenic
980521559 4:133942917-133942939 GAGGGGGAAAGGAAGGAAGGAGG - Intergenic
980726579 4:136769633-136769655 GAGGGTGAAGAGAAGGAAGTGGG - Intergenic
980795164 4:137673305-137673327 GAAGGAAAAAAAAAGGAGGGTGG - Intergenic
980879368 4:138693949-138693971 GAGGGTAAAGAGGGAGAAGGAGG + Intergenic
980945997 4:139320945-139320967 GAGGATAAAAAGAAGGTGGCTGG - Intronic
981215809 4:142165868-142165890 GAGGATAAAAAGAGTGGAGGAGG - Intronic
981254382 4:142644238-142644260 GAGGAGAAAGAGAAGGAAGGGGG + Intronic
981497524 4:145410895-145410917 GAGTGTAGAAAGAAGGTAGGAGG - Intergenic
981498251 4:145417550-145417572 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
981498253 4:145417554-145417576 GAGGGAAGAAGGAAGGAGGGAGG + Intergenic
981713532 4:147731938-147731960 GAAGGGAGGAAGAAGGAAGGCGG + Intergenic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
982778513 4:159466291-159466313 AAGGGGGAAAGGAAGGAAGGTGG - Intergenic
983167040 4:164490595-164490617 GAAGGTAAAAGGTAGGAAGCAGG + Intergenic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
983202209 4:164873325-164873347 GAGGGAGAAAGGAAGGAAGAAGG + Intergenic
983427382 4:167603365-167603387 GAGGGCAAAAATAACGAAGTAGG - Intergenic
983689096 4:170446358-170446380 GAAGGTTGAAAAAAGGAAGGGGG + Intergenic
983730939 4:170992373-170992395 GAGGAAGAAAGGAAGGAAGGAGG - Intergenic
984041651 4:174742615-174742637 GAGAGTAAAAAGAAGATAGATGG + Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984149376 4:176107900-176107922 GAAGAAAAAAGGAAGGAAGGAGG - Intronic
984255411 4:177384384-177384406 GAGGATAAACAGAACTAAGGAGG + Intergenic
984326626 4:178262551-178262573 GAGGGAGAAAAGTAGGAAGCAGG + Intergenic
985311783 4:188609495-188609517 GAGCGAGAAAAAAAGGAAGGAGG + Intergenic
985485831 5:147949-147971 CAGTGTAAACAGAATGAAGGGGG + Intronic
986190535 5:5492915-5492937 GAAAGGAAAGAGAAGGAAGGAGG + Intergenic
986202776 5:5593023-5593045 GAGGAAAAAAAGAAGGAAGCTGG - Intergenic
986278649 5:6304497-6304519 GAAGGGAAAAAGATGGAAGAAGG + Intergenic
986288939 5:6383370-6383392 GTGGGTAAAATGAAGGACTGAGG - Intergenic
986523975 5:8652791-8652813 GTGGGTAAAATTAAGGAAAGTGG + Intergenic
986701341 5:10412479-10412501 GAGAGTGAAAAAAAGGAAGTGGG + Intronic
986796533 5:11218063-11218085 AAGAGGAAAAGGAAGGAAGGAGG - Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987043477 5:14085104-14085126 GAGGACAATGAGAAGGAAGGAGG - Intergenic
987213848 5:15712712-15712734 AAGGAAAAAAGGAAGGAAGGAGG + Intronic
987619677 5:20324687-20324709 GAGGGTAAAATGTAGTAAGAAGG + Intronic
987910127 5:24132341-24132363 GAGAGAAGAAAGAAGAAAGGAGG + Intronic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988409134 5:30864079-30864101 AAGGAGAAAAAGAAGGAATGGGG + Intergenic
988460050 5:31427024-31427046 GAAGATAAAAATAAGGAAGGAGG + Intronic
988895207 5:35664816-35664838 GAGGGAGAGAGGAAGGAAGGAGG + Intronic
988934842 5:36071503-36071525 GAGGGACATGAGAAGGAAGGAGG + Intergenic
989214270 5:38888023-38888045 TAGGCAAGAAAGAAGGAAGGAGG + Intronic
989309763 5:40001027-40001049 GAGGGAAATAGGAAGGAAGGAGG + Intergenic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
989806986 5:45621314-45621336 GAGGAAAAAAAAAAGAAAGGTGG - Intronic
989960548 5:50409573-50409595 GAGGAAAAAAGGAAGGAAGGAGG + Intronic
989981893 5:50655475-50655497 GAGGGAAGAAGGAAGGAGGGAGG - Intergenic
989981895 5:50655479-50655501 GAGGGAGGGAAGAAGGAAGGAGG - Intergenic
990350933 5:54915364-54915386 GAAGGTTAAAGGAATGAAGGAGG - Intergenic
990822433 5:59857858-59857880 GAGAGCAGAAGGAAGGAAGGTGG + Intronic
991034496 5:62114593-62114615 GAGGCTAAACAGAAGGAATGTGG - Intergenic
991272167 5:64796864-64796886 GAGGAAAGAAGGAAGGAAGGAGG - Intronic
991344306 5:65646512-65646534 AAAGGTACAAATAAGGAAGGGGG - Intronic
991422016 5:66451755-66451777 GAGGAAAGAAAGAGGGAAGGAGG + Intergenic
991452791 5:66770629-66770651 GAGGGGAAAATTAAGGAAAGAGG + Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
991974782 5:72175048-72175070 GAGGAAAGATAGAAGGAAGGAGG - Intronic
992101537 5:73412319-73412341 AAGGCTAACAGGAAGGAAGGAGG - Intergenic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992873141 5:81025963-81025985 GAGGGAAGAGGGAAGGAAGGAGG - Intronic
992874191 5:81036289-81036311 GAAGGTAAGAAGATGGCAGGAGG - Intronic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
993032264 5:82718330-82718352 GAAGGAGAAAAGAAAGAAGGAGG + Intergenic
993045240 5:82858844-82858866 GAGGGAGAAAAGAAAAAAGGAGG - Intergenic
993410563 5:87567817-87567839 GAGGGCAAGCAGAAGCAAGGGGG - Intergenic
993747871 5:91624118-91624140 GAGGGAAGAAGGAAGGAAGAGGG + Intergenic
993894341 5:93513653-93513675 GAGGGGAGAGAGAAGGCAGGGGG + Intergenic
994204359 5:97017416-97017438 GAGAGTAAAAAAAAGCAAGATGG - Intronic
994287633 5:97989584-97989606 GGGAGGAAAAAGAAGGTAGGAGG - Intergenic
994432519 5:99685887-99685909 TAGGGAAAAATAAAGGAAGGTGG - Intergenic
994439346 5:99783220-99783242 GAGGGGGGAAAGAAGGGAGGGGG - Intergenic
994572561 5:101532906-101532928 GAGAACAAAAAGAAGAAAGGTGG - Intergenic
994876463 5:105429053-105429075 AAGGGAGAAAAGAAGGAATGAGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995678609 5:114691887-114691909 GAAGGTAAATAGGAGGGAGGAGG + Intergenic
995891186 5:116953704-116953726 AAAGGGATAAAGAAGGAAGGGGG + Intergenic
996408433 5:123129944-123129966 GAGGGAAGGAGGAAGGAAGGTGG - Intronic
996432587 5:123398236-123398258 GAGGGAAAAAAAAAGGGAAGTGG + Intronic
996719856 5:126619226-126619248 GGGGTTAAAAAGAATAAAGGAGG - Intronic
996900634 5:128538437-128538459 GAGGGGAAGAGGAAGGAAGGGGG + Intronic
997046623 5:130326725-130326747 GAGGGTAGAAGGTAGGAAGGAGG - Intergenic
997636577 5:135411855-135411877 GAAAGTAGAAAGAAGGAAAGAGG - Intergenic
998075232 5:139230998-139231020 GAGGTTAAAAAGAAAAAAGAAGG - Intronic
998078847 5:139258137-139258159 GAGGGAGAAAACAGGGAAGGAGG + Intronic
998120417 5:139571806-139571828 AAAGGAAAAAGGAAGGAAGGAGG - Intronic
998261303 5:140633738-140633760 CAAGGAAAAAAAAAGGAAGGGGG - Intergenic
998484720 5:142491573-142491595 GAGGGAGGAAGGAAGGAAGGGGG + Intergenic
998698842 5:144673909-144673931 AAGAGTAAAAAGAAGTAATGGGG - Intergenic
999003546 5:147950211-147950233 GAAGGAAAAAAGAAGGGAGAGGG - Intergenic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999076861 5:148804535-148804557 GAGGGGAAAAAGGAGCAAGTTGG + Intergenic
999357286 5:150947162-150947184 GAGGGGAGAAAGAGGGAAGTGGG + Intergenic
999445025 5:151632469-151632491 GAGGTTAGAGAGGAGGAAGGTGG + Intergenic
999476899 5:151908390-151908412 GAAGGGAAAAAGAATGTAGGAGG - Intronic
999504222 5:152178703-152178725 GAGGAGAGAAAGATGGAAGGAGG + Intergenic
999692680 5:154162345-154162367 GAGGGAAAAAAGTAGGGAGGAGG + Intronic
999730495 5:154473604-154473626 GAGGGAAAAAAGAAAAAAGTAGG + Intergenic
999751701 5:154632325-154632347 GAGGGAAGGAAGAAGGAGGGAGG - Intergenic
1000210274 5:159101392-159101414 GGGGGAGAAGAGAAGGAAGGTGG + Intergenic
1000311190 5:160046479-160046501 GAGGGGAAAAAAAAAGAAGAGGG - Intronic
1000489116 5:161886833-161886855 GATGGCATAAAGGAGGAAGGGGG + Intronic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001026904 5:168232209-168232231 GAGGAAAGAAAGAAGGTAGGGGG + Intronic
1001108478 5:168875728-168875750 GAGGGAAACAGGAAGGAATGAGG + Intronic
1001220348 5:169895252-169895274 GAAAGGAGAAAGAAGGAAGGGGG - Intronic
1001234250 5:170015935-170015957 GAAAGAAACAAGAAGGAAGGAGG - Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1001649165 5:173303061-173303083 GAGGAAAACAAGAGGGAAGGAGG - Intergenic
1001756710 5:174175881-174175903 GTGGGTAAGAAGAGGGCAGGTGG + Intronic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001893818 5:175361913-175361935 GAGGAAAAAGAGAAGGAAGAGGG + Intergenic
1001919378 5:175588529-175588551 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
1001919427 5:175588710-175588732 GAGGGAAGAAGGAAGGAAGAAGG + Intergenic
1002029930 5:176420414-176420436 GAGAGAAAAAGGAAGGAAAGGGG - Intergenic
1003342970 6:5239647-5239669 GAAAGTGACAAGAAGGAAGGTGG + Intronic
1003579859 6:7329910-7329932 TAATGTAAAAAGGAGGAAGGGGG + Intronic
1003712130 6:8603813-8603835 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1004357867 6:14945622-14945644 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1004899514 6:20181392-20181414 GAGGGGAAGAAGAAGGCAGAAGG - Intronic
1005112120 6:22293777-22293799 AAGGGAAGAAGGAAGGAAGGAGG + Intronic
1005132051 6:22520535-22520557 AAGGGTAGAAAGAAGGAAAGAGG + Intergenic
1005351663 6:24941822-24941844 GAGGTTAAAAAAAGGGGAGGAGG - Intronic
1005418103 6:25622678-25622700 AAGGGTAACAAGAATCAAGGTGG - Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005761017 6:28968408-28968430 GAAGGTAGAAAGAAGCAAGATGG - Intergenic
1006263169 6:32894165-32894187 GAGGGGAAAGAGGGGGAAGGGGG - Intergenic
1006338724 6:33434051-33434073 TAGGGCAAGAAGAAGAAAGGGGG - Intronic
1006651850 6:35558066-35558088 GACGGTAAAAGGAAGGATGTGGG + Intergenic
1006744499 6:36331825-36331847 GGGGGTAAAAGAAAGAAAGGAGG - Intronic
1007079899 6:39092568-39092590 GAGGGAAAAAGGAAGGACAGAGG - Intergenic
1007166816 6:39834305-39834327 GAGTGAAAAAAGAAGGATGTAGG - Intronic
1007261622 6:40568056-40568078 GAGAGAGAAGAGAAGGAAGGGGG - Intronic
1007784962 6:44274565-44274587 GCGGGTGAGAAGCAGGAAGGAGG + Intronic
1007797705 6:44363703-44363725 AAAGGAAAAAGGAAGGAAGGAGG - Intronic
1007835522 6:44671177-44671199 GAGGCTGCAGAGAAGGAAGGTGG - Intergenic
1007913798 6:45541707-45541729 CAGGGCAGAAAAAAGGAAGGGGG - Intronic
1007972686 6:46068433-46068455 GATGGTTGAATGAAGGAAGGAGG - Intronic
1008023191 6:46603493-46603515 AAGGGGAGAAAAAAGGAAGGAGG - Intronic
1008125716 6:47666059-47666081 GGAGGAAGAAAGAAGGAAGGAGG - Intronic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008498563 6:52156972-52156994 GAGTGGAGAAAGAAGGATGGAGG + Intergenic
1008607489 6:53154370-53154392 GATGGAAAAAGGAAGGAAGGAGG + Intergenic
1008708633 6:54196035-54196057 GAGGATGAGAAGAAGGAAAGTGG - Intronic
1009476899 6:64103837-64103859 GAGGGTAATAACAAGAAAGAGGG + Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1010168177 6:72941559-72941581 GAGGGAAGGAGGAAGGAAGGAGG - Intronic
1010275401 6:73962948-73962970 AAGGGGAAAAAGCAGGCAGGAGG + Intergenic
1010298672 6:74232129-74232151 AAGGATAAAAGGAAGGAAAGAGG - Intergenic
1010345971 6:74811230-74811252 GAGGGAGGAAAGAAGGAAAGTGG + Intergenic
1010346001 6:74811345-74811367 GAGGGGGGAAGGAAGGAAGGGGG + Intergenic
1010704306 6:79089677-79089699 GAGGGAAAGAGGGAGGAAGGAGG - Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1011017799 6:82777765-82777787 GAAGGAAAGAAGAAGGAAAGTGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011031543 6:82929640-82929662 GAAGGAGAAAAGAAGAAAGGGGG - Intronic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1011245205 6:85314897-85314919 GAGGGTGAGAAGAAGCAGGGCGG - Intergenic
1011370289 6:86629869-86629891 CAGGGTATAAAGAAGAAAAGTGG + Intergenic
1012011025 6:93785677-93785699 GAAGGAAAAAAGAAAGAAGGAGG - Intergenic
1012073889 6:94658491-94658513 AAGGGTGAAAGAAAGGAAGGAGG - Intergenic
1012207548 6:96479190-96479212 GAGGGTGAACTGAAGCAAGGTGG - Intergenic
1012732698 6:102902045-102902067 AAGGGAATAAAGAATGAAGGAGG + Intergenic
1012754089 6:103202751-103202773 GAGTGTAAAAAGAAAGCAGTAGG + Intergenic
1012931849 6:105325746-105325768 GAGGATAAGAACAAGGAAGGTGG + Intronic
1012961902 6:105630967-105630989 GAGGAGATAAAGAAGGAGGGAGG + Intergenic
1012976251 6:105784095-105784117 GAGAGCAAAAATAAGAAAGGTGG - Intergenic
1013139075 6:107312740-107312762 GAGGGTAGAAGGAAGAAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013414004 6:109908599-109908621 GAAGGAAGGAAGAAGGAAGGAGG - Intergenic
1013677369 6:112480340-112480362 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1014212339 6:118720180-118720202 GAGGGAAAAAGGAAGGAAGGAGG - Intergenic
1014378133 6:120702791-120702813 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1014378138 6:120702810-120702832 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1014550177 6:122781254-122781276 GGAGGGAAGAAGAAGGAAGGAGG - Intronic
1014580249 6:123128113-123128135 GAAGAAAAAAAGAATGAAGGAGG + Intergenic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014717616 6:124884888-124884910 GTGGTTAAAAAGAATTAAGGTGG - Intergenic
1014804859 6:125818068-125818090 GGTGGGAGAAAGAAGGAAGGGGG - Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015141084 6:129932442-129932464 GAGAGGAAAAGGAAGGAAAGGGG + Intergenic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015385896 6:132623035-132623057 AAGGAAAAAAGGAAGGAAGGAGG - Intronic
1015597038 6:134875733-134875755 GAGGGAAACAACAAGGAATGGGG + Intergenic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1015844152 6:137501131-137501153 GAGGGTGAAAAGAAAGAAGGAGG + Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1016063634 6:139656033-139656055 GTAGGTAGAAGGAAGGAAGGAGG - Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016185017 6:141188340-141188362 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1016668639 6:146674199-146674221 GAGGGGAGTAAGAAGGAAGTGGG + Intronic
1016771432 6:147856716-147856738 GACGGTTAAAAGGAGGAAGATGG - Intergenic
1016927617 6:149367619-149367641 GTTGGCAAAAAGAAGGAAGGTGG + Intronic
1017921565 6:158877462-158877484 GAAAGAAAAAGGAAGGAAGGAGG - Intronic
1018266261 6:162027868-162027890 GAGGGAGGGAAGAAGGAAGGTGG + Intronic
1018825147 6:167403317-167403339 AAAGGAAAGAAGAAGGAAGGAGG + Intergenic
1019041156 6:169107344-169107366 GAAGAAAAAGAGAAGGAAGGAGG + Intergenic
1019124103 6:169827786-169827808 GAGAATAAAGAGAAGGATGGAGG - Intergenic
1019142628 6:169957743-169957765 GGGGTGAAAAGGAAGGAAGGAGG - Intergenic
1019166542 6:170101258-170101280 GAGGTTGAAAGGAAGGAAAGGGG + Intergenic
1019257961 7:63644-63666 GAGGGTATAGAGAAGACAGGTGG + Intergenic
1019325084 7:434012-434034 AAAGGAAAAAGGAAGGAAGGGGG + Intergenic
1019483577 7:1277285-1277307 GAGGGAGAAGAGAGGGAAGGAGG - Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019730560 7:2627327-2627349 GAGGGAGAAAGGAGGGAAGGAGG + Intergenic
1019768833 7:2870776-2870798 GAGGAGAAGAGGAAGGAAGGAGG + Intergenic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1019916819 7:4138767-4138789 GAAAGAAAGAAGAAGGAAGGAGG + Intronic
1019955747 7:4413023-4413045 GAGGGGAAAAGGAAGGAATTGGG + Intergenic
1020173810 7:5866390-5866412 GAGGAAGGAAAGAAGGAAGGGGG + Intergenic
1020333315 7:7041978-7042000 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020782532 7:12534956-12534978 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
1020874353 7:13674313-13674335 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
1021006244 7:15397577-15397599 GAATGAAGAAAGAAGGAAGGAGG - Intronic
1021090793 7:16480256-16480278 GATGGCAAAAAGAAGTAAGTTGG + Intronic
1021112453 7:16710667-16710689 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1021962348 7:25885402-25885424 GAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1022343211 7:29487653-29487675 AAGGAGAAAAAGAAGAAAGGAGG - Intronic
1022370865 7:29770114-29770136 GAGAGGGAAAAGAAGGAGGGAGG - Intergenic
1022473329 7:30694853-30694875 AAGGGAAGAAAGGAGGAAGGAGG + Intronic
1022536529 7:31102006-31102028 GAGAGGAGAAGGAAGGAAGGAGG - Intronic
1022714901 7:32891086-32891108 GGGGGAATACAGAAGGAAGGGGG + Intronic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023241153 7:38149089-38149111 GAAGGAAAAAAGAAAGAAGAAGG + Intergenic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023575481 7:41621990-41622012 GAAGGAAGGAAGAAGGAAGGAGG + Intergenic
1023581610 7:41690107-41690129 GAAGGGAAAAAGAAGGGCGGAGG - Exonic
1024071003 7:45785159-45785181 AAGGAAAAAAGGAAGGAAGGAGG - Intergenic
1024323099 7:48089055-48089077 GAGGGTGGAGAGGAGGAAGGCGG + Intronic
1024471090 7:49769463-49769485 AAGGGAAGAAGGAAGGAAGGAGG - Intergenic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1024737735 7:52323505-52323527 AAGGGGAAAAGGAAGGAAAGGGG - Intergenic
1024864660 7:53891522-53891544 TAGGCAAACAAGAAGGAAGGAGG - Intergenic
1025614010 7:63102568-63102590 GAGGGAAAAAGCTAGGAAGGAGG - Intergenic
1026319256 7:69254737-69254759 AAGGAAAGAAAGAAGGAAGGAGG + Intergenic
1026379866 7:69788344-69788366 GAGGGTGCAAAGGAAGAAGGTGG + Intronic
1026396938 7:69964954-69964976 GGGGGTACTAATAAGGAAGGTGG - Intronic
1026492100 7:70872066-70872088 AAGGGCGGAAAGAAGGAAGGAGG + Intergenic
1026497298 7:70914249-70914271 GAGGGGAAAGGGAAGGGAGGGGG - Intergenic
1026638877 7:72106891-72106913 GAAAGAAAAAGGAAGGAAGGAGG + Intronic
1027591494 7:80124757-80124779 GGGAGAAAAAAGAAAGAAGGAGG + Intergenic
1027815059 7:82958293-82958315 GAAGGAAGGAAGAAGGAAGGAGG - Intronic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028584444 7:92439097-92439119 GAGGCTGATAAGAAAGAAGGAGG - Intergenic
1028618829 7:92801618-92801640 GAGGGAAGAAGGAAGGAAGGAGG - Intronic
1029165277 7:98584864-98584886 AAGGAGAAAAGGAAGGAAGGAGG - Intergenic
1029178674 7:98683739-98683761 GAGGAAGGAAAGAAGGAAGGAGG - Intergenic
1029184497 7:98728831-98728853 GAAGAAAAAAGGAAGGAAGGAGG - Intergenic
1029204879 7:98863634-98863656 GAGGGAAGGAAGAAGGAGGGAGG - Intronic
1029493181 7:100883379-100883401 GAGGGAAAACAGAAGAAATGAGG - Intronic
1029848099 7:103434098-103434120 GAGGGTATAAAGCAAGGAGGAGG - Intronic
1030136299 7:106253884-106253906 GACGTTACAAAGAAGCAAGGGGG + Intronic
1030205447 7:106948297-106948319 GATGATAATAAGAATGAAGGAGG - Intergenic
1030332519 7:108286475-108286497 AAGCGGAAAAAAAAGGAAGGAGG + Intronic
1030700250 7:112630282-112630304 CAGGATAAAAAGAATGGAGGAGG - Intergenic
1030740181 7:113100284-113100306 GAGAAAAAAATGAAGGAAGGGGG - Intergenic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1031281951 7:119815749-119815771 AAGGGGAAAAAGAAGAAATGTGG - Intergenic
1031317334 7:120273574-120273596 GAAGGTGAAAAGGAGGAGGGAGG + Intergenic
1031445238 7:121845728-121845750 GAAGAGAAAAAGAAGGAAAGAGG + Intergenic
1031448093 7:121879786-121879808 AAGGAAAAATAGAAGGAAGGAGG - Intronic
1031674465 7:124591521-124591543 GAGACTCATAAGAAGGAAGGTGG + Intergenic
1031856123 7:126924615-126924637 AAGGGAGGAAAGAAGGAAGGAGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032362077 7:131265368-131265390 GAGAGAAGAAAGAAAGAAGGGGG - Intronic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032945416 7:136846466-136846488 AAGGGAAAAAAGAAAGAAAGAGG + Intergenic
1032982995 7:137306377-137306399 GAGGGTAGAAAGAAGGATAAAGG + Intronic
1033062046 7:138118838-138118860 GAGGGGAAAGAAAAAGAAGGAGG + Intergenic
1033352911 7:140576787-140576809 GAGCACAAAAAGAAGGAAGAGGG + Intronic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033604835 7:142919276-142919298 GTGGATAAAAAGTAGGAGGGAGG - Intronic
1033832600 7:145271570-145271592 GAGGAAGAAAAGAAGGAAGAAGG + Intergenic
1033970429 7:147032724-147032746 GAGAGAAAAAGGAAGGAAGTTGG + Intronic
1034020820 7:147640727-147640749 CAGGCAAGAAAGAAGGAAGGAGG + Intronic
1034119877 7:148617494-148617516 GAAAGGAAAAAGAAGGGAGGAGG + Intergenic
1034232846 7:149546204-149546226 GAGGGTGGAAAGAAGGGACGTGG + Intergenic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1034995148 7:155572218-155572240 GAGGGAAGGAGGAAGGAAGGAGG + Intergenic
1035432431 7:158832017-158832039 GAAGGTAAAAACATGGAAGAGGG + Intergenic
1035776588 8:2191868-2191890 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1035791852 8:2313565-2313587 GAAGTTACAAATAAGGAAGGGGG - Intergenic
1035800953 8:2408140-2408162 GAAGTTACAAATAAGGAAGGGGG + Intergenic
1035834152 8:2730347-2730369 GAGGATAAAGAGAAAGAATGGGG + Intergenic
1035841278 8:2813987-2814009 GATGTTAATATGAAGGAAGGAGG - Intergenic
1035853664 8:2948440-2948462 AAAGCTATAAAGAAGGAAGGAGG + Intronic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036130645 8:6106469-6106491 GATGGAAGAAAGAAGGAAGGAGG - Intergenic
1036188836 8:6650833-6650855 GAGGAGAGAGAGAAGGAAGGAGG - Intergenic
1036446624 8:8826797-8826819 GATGGAAAAAAGATGTAAGGAGG - Intronic
1036546124 8:9771463-9771485 GAGGGAGAGAAGAAGGAAGGGGG + Intronic
1037293646 8:17378224-17378246 GAGGGAAAAAAGAAATAAGGAGG + Intronic
1037378930 8:18263532-18263554 GATGGCAAAAAGAAAGGAGGAGG - Intergenic
1037409245 8:18577862-18577884 GATGGAAAAAAGAAAGAAGCAGG - Intronic
1037458573 8:19086360-19086382 AAAGGAAGAAAGAAGGAAGGAGG + Intergenic
1037460631 8:19104937-19104959 GAGGGAGAGAAGAAGAAAGGAGG + Intergenic
1037480655 8:19302221-19302243 GAGGAAGGAAAGAAGGAAGGGGG + Intergenic
1037547586 8:19939594-19939616 GAGGATGAGAAGAAGGAAGTTGG + Intronic
1037753260 8:21696159-21696181 GAGGGGAGAAAGAGGGAAAGGGG - Intronic
1037916641 8:22777191-22777213 GAGGGGAAGCAGAAGGAAAGAGG - Intronic
1038012453 8:23486015-23486037 GAGGGAGGAAGGAAGGAAGGTGG - Intergenic
1038022874 8:23564545-23564567 GAAGGGAGGAAGAAGGAAGGAGG + Intronic
1038087690 8:24218025-24218047 GAGGGTGGAGAGATGGAAGGAGG + Intergenic
1038390075 8:27189363-27189385 GAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038653479 8:29427414-29427436 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1038898298 8:31812587-31812609 GAGGAGATAAAAAAGGAAGGAGG - Intronic
1038902684 8:31861701-31861723 AAGGGGAAGAAGAAGGAAAGAGG - Intronic
1039028671 8:33285952-33285974 GAGGGAAGGAAGAAAGAAGGAGG + Intergenic
1039151546 8:34512236-34512258 AAGGATGGAAAGAAGGAAGGAGG - Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039335004 8:36579111-36579133 GAGGGTAAAGGGCAGGAAGAGGG + Intergenic
1039379117 8:37068263-37068285 GAGGGTAAGTGGAAGGAATGTGG - Intergenic
1039417726 8:37409927-37409949 GAGGGAAAGAAGAAGGAAAGAGG - Intergenic
1039446638 8:37638412-37638434 GGGGGGGAAAAGAAGGTAGGGGG + Intergenic
1039625777 8:39050917-39050939 AAGGCTACAAAGAATGAAGGTGG - Intronic
1039725887 8:40216081-40216103 GAGAGTAAAAGGGAGGTAGGGGG + Intergenic
1039750373 8:40473198-40473220 GAGGAAGAAAGGAAGGAAGGAGG + Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039867910 8:41521764-41521786 AATTGTAAAAAGAAGGAAGGAGG + Intergenic
1039884099 8:41645726-41645748 GAGGGTAAATCGGAGAAAGGAGG + Exonic
1040445970 8:47493996-47494018 GAAGGAGAAAAGAAGGAAGGAGG - Intronic
1040866030 8:52049925-52049947 GAGGCTATTAAGAAGGAAGTTGG + Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041773119 8:61494288-61494310 GAGGGTAGAATAAAGGAGGGTGG + Intronic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1041953610 8:63533127-63533149 GAGGAGAAAAGGAAGGAAGGTGG - Intergenic
1041989265 8:63966238-63966260 GAGGGAAGAAAGAAGAAAGAAGG - Intergenic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1042758218 8:72241777-72241799 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1042837592 8:73092445-73092467 GAGGGTTGACAGAATGAAGGTGG + Intronic
1042852024 8:73226080-73226102 GAGGTTAAAAACAAAGAGGGAGG + Intergenic
1043058566 8:75471597-75471619 GAAATTAATAAGAAGGAAGGAGG - Intronic
1043319721 8:78968869-78968891 GAGGGTAAAAGGGAAGCAGGAGG + Intergenic
1043520119 8:81035649-81035671 GAGGGAACAAGGAAGGCAGGAGG + Intronic
1043751975 8:83948936-83948958 GAGGGAGAAAAAAGGGAAGGAGG + Intergenic
1043769278 8:84177489-84177511 CAGGGGAAAAAGAAGGAATTTGG + Intergenic
1043834109 8:85026943-85026965 GATTGTCAAAGGAAGGAAGGAGG + Intergenic
1044176428 8:89129522-89129544 GAGGGTGACAAGAAAGAAAGAGG + Intergenic
1044216158 8:89613209-89613231 GAGGGAATCAGGAAGGAAGGTGG - Intergenic
1044239893 8:89876711-89876733 GTGGGTAAAAATAAGGAAGAGGG - Intergenic
1044350745 8:91163271-91163293 GAGGCTAAAAAAATGGAGGGTGG - Intronic
1044356712 8:91230833-91230855 GAGGGTATAATCAAGCAAGGAGG + Intronic
1044520072 8:93189084-93189106 GAGGAAAGAAGGAAGGAAGGAGG + Intergenic
1044823613 8:96176387-96176409 GAGAGTAAAACACAGGAAGGAGG - Intergenic
1044825129 8:96188589-96188611 GAGGGAAAAAAGAGAGGAGGGGG + Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1045446409 8:102269446-102269468 TAGGGTAGAAAAAAAGAAGGGGG + Intronic
1045755277 8:105534204-105534226 GAGGAAGAAAAGAAGGAAGAAGG - Intronic
1045760175 8:105596425-105596447 CAGGGTAAAAACTAGGATGGTGG - Intronic
1045961571 8:107974707-107974729 GAGAGGAAAAAGCAGGGAGGGGG + Intronic
1046092945 8:109524809-109524831 GAGGGAGGAAGGAAGGAAGGAGG - Intronic
1046145973 8:110158727-110158749 GAAGACAGAAAGAAGGAAGGAGG - Intergenic
1046179450 8:110624852-110624874 GAGGGAGAGAGGAAGGAAGGAGG - Intergenic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1046478249 8:114778368-114778390 GAGGGGAGAAGGAAGGATGGGGG + Intergenic
1046605335 8:116365492-116365514 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1046605344 8:116365519-116365541 GAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1046885132 8:119358506-119358528 GAGGACAGAAGGAAGGAAGGAGG - Intergenic
1046987875 8:120410766-120410788 GAGAGAGAAAGGAAGGAAGGAGG - Intronic
1047021085 8:120775672-120775694 GAGGGAGGAAGGAAGGAAGGAGG + Intronic
1047131263 8:122022698-122022720 GAGGGGAGAAAGGAGAAAGGAGG - Intergenic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047259113 8:123240679-123240701 GAAGCTAAATAGAGGGAAGGGGG + Intronic
1047606568 8:126480496-126480518 GAAGGTGAAAAGTAGGAAGAAGG + Intergenic
1047646585 8:126876672-126876694 GAGGGAGGAAAGTAGGAAGGAGG + Intergenic
1047946569 8:129886820-129886842 GAGGGTAGCAAGAAGTAGGGAGG - Intronic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048170828 8:132104670-132104692 GGGGGCATAAAGAATGAAGGAGG + Intronic
1048313445 8:133344262-133344284 AAGGGGAGAGAGAAGGAAGGAGG - Intergenic
1048376950 8:133831245-133831267 TAGAGGAAAAAGAAAGAAGGGGG + Intergenic
1048426580 8:134329122-134329144 GAGGGTCAGAGGAAGAAAGGAGG - Intergenic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048512826 8:135078079-135078101 GAGGGCAGAGAGAAGGAAGAGGG - Intergenic
1048551695 8:135439086-135439108 GAGGGAGCAAGGAAGGAAGGAGG + Intergenic
1048828364 8:138451954-138451976 AAGGTGAAAAAGAATGAAGGAGG - Intronic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049083166 8:140458028-140458050 GAGGGGTGAAAGAAGGAGGGAGG + Intronic
1049210764 8:141385445-141385467 GAAGGGAAAAAGAGGGAGGGAGG - Intergenic
1049922865 9:381216-381238 GAGCATAAAAAGAGGCAAGGAGG - Intronic
1050362612 9:4844950-4844972 GAAGGTTAAAAAAAGGAAGCAGG + Intronic
1050948836 9:11562495-11562517 AAGGGAGAAAGGAAGGAAGGAGG - Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1050957443 9:11682443-11682465 GAAAGAAAAAAGAAGGAAGGAGG + Intergenic
1051014961 9:12463188-12463210 GAGGGAGAAAGGAAGGAAGGAGG - Intergenic
1051039645 9:12791675-12791697 GTGTGTAAAAAGAAGGGAGGAGG - Intronic
1051209628 9:14728046-14728068 CAGGGTGAAAAGAAGGACCGTGG - Intergenic
1051301846 9:15660463-15660485 GAGGGAAAAGGGCAGGAAGGGGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052174634 9:25443598-25443620 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1052174645 9:25443630-25443652 GAGGGAGGAAGGAAGGAAGGAGG - Intergenic
1052273175 9:26648974-26648996 GAATTTAAAAAGAAGGTAGGTGG - Intergenic
1052724271 9:32211121-32211143 TAGGGTAGAATGAAAGAAGGGGG - Intergenic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053298062 9:36929216-36929238 GAAGGAAGAAGGAAGGAAGGAGG + Intronic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053616182 9:39768978-39769000 GCGGGTAAAGAGAGAGAAGGAGG + Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053874351 9:42528284-42528306 GAGGGTAAAGAGAGAGAAGGAGG + Intergenic
1053898262 9:42766304-42766326 GAGGGTAAAGAGAGAGAAGGAGG - Intergenic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054237335 9:62573412-62573434 GCGGGTAAAGAGAGAGAAGGAGG - Intergenic
1054267984 9:62938470-62938492 GAGGGTAAAGAGAGAGAAGGAGG - Intergenic
1054551470 9:66607923-66607945 GCGGGTAAAGAGAGAGAAGGAGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054958253 9:70938415-70938437 GAGGGTATCTAGGAGGAAGGTGG - Intronic
1055018549 9:71645078-71645100 AAGGAAAAAAAGAGGGAAGGAGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055644693 9:78352012-78352034 GAGGGAAGGAAGAAGGATGGTGG - Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055730272 9:79273804-79273826 GAGAGAAAGAGGAAGGAAGGAGG + Intergenic
1055845915 9:80563464-80563486 GAGGGAAGGAGGAAGGAAGGAGG + Intergenic
1056006364 9:82275793-82275815 GAGGAGGAAAACAAGGAAGGTGG - Intergenic
1056042348 9:82681490-82681512 GAGGATGAAAAGAAGGAAACAGG - Intergenic
1056107608 9:83362788-83362810 GAAGGAAAAAGGAAGGAAGGAGG - Intronic
1056112723 9:83411503-83411525 GGGGGAAGAAAGAAGGGAGGAGG + Intronic
1056115539 9:83437936-83437958 CAGGATAAAAAGAGAGAAGGGGG + Intronic
1056282776 9:85058159-85058181 GAGGAAAGAAGGAAGGAAGGAGG + Intergenic
1056455877 9:86759342-86759364 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1057813876 9:98279729-98279751 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1057961094 9:99457825-99457847 GAGGGAGAAGGGAAGGAAGGAGG + Intergenic
1058125662 9:101191486-101191508 GACAGTGAAAAAAAGGAAGGAGG - Intronic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058665762 9:107313923-107313945 GAAGGAGAAAGGAAGGAAGGAGG - Intronic
1058742183 9:107954904-107954926 GAGAGGAAAGAGGAGGAAGGAGG - Intergenic
1058914854 9:109555838-109555860 AAGGGATAAAAGAAGGAAGGGGG + Intergenic
1058956999 9:109958619-109958641 GAAGGAAGAAAGAAGGAAGGAGG + Intronic
1059077277 9:111206842-111206864 TGGGGTAGAAAAAAGGAAGGAGG + Intergenic
1059454278 9:114389888-114389910 GTGGGTAAAAGGCAGGAAAGGGG - Intronic
1059761686 9:117343942-117343964 GAGGGAGAGAAGAAGGAAGGAGG + Intronic
1059904731 9:118970106-118970128 GAGGGAACAAAGAAGTAATGAGG - Intergenic
1059965449 9:119609386-119609408 GAGGGGGGAAAGAAGGAAAGCGG + Intergenic
1060026070 9:120172622-120172644 GAGGGGAAAGAGTGGGAAGGGGG + Intergenic
1060185294 9:121560425-121560447 GAGGGGAAAGAGATGGGAGGAGG + Intergenic
1060465604 9:123902116-123902138 AAGGGTAAAATGACTGAAGGTGG - Intronic
1060503894 9:124183367-124183389 GGTGGGAAAAAGAGGGAAGGAGG + Intergenic
1060675433 9:125510167-125510189 AAAGGTAAAAAGTAGGAAGGGGG + Intronic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1061777964 9:132978291-132978313 GAAGGAAAAAGGAGGGAAGGAGG + Intronic
1061943058 9:133893315-133893337 GAGGGAGGAAAGAAGGAAGGAGG + Intronic
1062003688 9:134229025-134229047 AAGGGGAGAAAGGAGGAAGGGGG - Intergenic
1062050638 9:134444754-134444776 GAAGGAGAAAAGAAGGAGGGAGG - Intergenic
1062085488 9:134645952-134645974 GAGGGAGGAAAGAAGGAAGGAGG - Intronic
1062190716 9:135246619-135246641 GAGGATGAGCAGAAGGAAGGAGG - Intergenic
1062334773 9:136060274-136060296 GAGGGAAAAACGGCGGAAGGTGG + Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1185477867 X:425782-425804 GAGGAAAGAAGGAAGGAAGGAGG - Intergenic
1185593019 X:1291232-1291254 GAGGAAGGAAAGAAGGAAGGAGG - Intronic
1185686743 X:1935063-1935085 GAAGGAAGAAAGAAGGGAGGAGG + Intergenic
1185712814 X:2317594-2317616 AAGGGAAAAAAGCAGGCAGGAGG + Intronic
1185726529 X:2426387-2426409 AAGGAAAAAGAGAAGGAAGGAGG - Intronic
1185766874 X:2732752-2732774 GAGGGGAAAAGGAAAGAAGGAGG - Intronic
1185820211 X:3195879-3195901 GAGAGTTAAAGGAAGGAAGGAGG + Intergenic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186020574 X:5251084-5251106 AAGGAAAGAAAGAAGGAAGGAGG + Intergenic
1186077582 X:5897906-5897928 GAGAGAGAAAAGAGGGAAGGGGG - Intronic
1186077693 X:5898368-5898390 GCGGAGAAAAGGAAGGAAGGAGG - Intronic
1186327832 X:8498787-8498809 GAGGGACAAAGGAAGAAAGGGGG + Intergenic
1186330972 X:8533999-8534021 GAGGGAAGAATGAAGGAGGGAGG + Intronic
1186672339 X:11780515-11780537 GAAGGAAGAAGGAAGGAAGGAGG - Intergenic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1186946456 X:14573817-14573839 GAGGATATAAAGAAGGAGTGGGG + Intronic
1187097677 X:16164824-16164846 GAGGGAGAAAGGAAGGAAGAAGG - Intergenic
1187126341 X:16457693-16457715 GGAGGGAAAAGGAAGGAAGGAGG + Intergenic
1187163971 X:16787359-16787381 GAGGGGAAAAAAGAGGAGGGTGG - Intronic
1187737164 X:22316793-22316815 ATGGGTAAAAAGCAGTAAGGGGG - Intergenic
1187808646 X:23150488-23150510 GAGGAAGGAAAGAAGGAAGGAGG - Intergenic
1187912098 X:24120524-24120546 AAGGAAGAAAAGAAGGAAGGAGG - Intergenic
1187912104 X:24120559-24120581 AAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1188238354 X:27755545-27755567 GAAGAAAGAAAGAAGGAAGGAGG - Intergenic
1189197146 X:39162252-39162274 GAGAGAAGAAGGAAGGAAGGTGG - Intergenic
1189215783 X:39321950-39321972 GAGGGAAAAAAAACGGAAGATGG + Intergenic
1189262023 X:39686180-39686202 AAGAAAAAAAAGAAGGAAGGAGG + Intergenic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1190260381 X:48793482-48793504 GAGGGTAATAACAGAGAAGGGGG - Intronic
1190260388 X:48793505-48793527 GAGGGAATGGAGAAGGAAGGAGG - Intronic
1190490522 X:50978364-50978386 GAGGGTAAAAAAAGGGGAAGGGG + Intergenic
1190553606 X:51611573-51611595 GAGAGGAAAGAGAAAGAAGGAGG - Intergenic
1190953135 X:55165512-55165534 GAGGGAAAGAGGAAGGAAGGAGG - Intronic
1191085543 X:56563793-56563815 GAGGGAAGGAGGAAGGAAGGAGG - Exonic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1191821796 X:65318348-65318370 GAAGGAAGAAAGAAGGAAGAAGG - Intergenic
1191890198 X:65931906-65931928 GAGGGGGAAAAGGAGGAAAGAGG - Intergenic
1191923863 X:66287497-66287519 GAGGGAATTAAGAAGGAATGAGG - Intergenic
1191954790 X:66632480-66632502 GAAGGAAGAAAGAAGGAAGAAGG + Intronic
1192249672 X:69401395-69401417 GAGTAATAAAAGAAGGAAGGAGG - Intergenic
1192627167 X:72741943-72741965 AAGGCCAAAAAGAAGGAAAGGGG - Intergenic
1192654541 X:72978870-72978892 AAGGCCAAAAAGAAGGAAAGGGG + Intergenic
1192968401 X:76204940-76204962 GAGGGTACAGAGAAAGAAGTGGG - Intergenic
1193158724 X:78203755-78203777 AAGGGTACAAAGAAGAAAAGAGG - Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193273605 X:79557830-79557852 GCAGGCAAGAAGAAGGAAGGAGG + Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193701643 X:84769904-84769926 GAGGGTAAAAAGGAGGTGGTAGG - Intergenic
1193750624 X:85339019-85339041 GAGGGTAGAGAAAAAGAAGGGGG + Intronic
1193972297 X:88069447-88069469 GAGGGGAAAGAAAAGCAAGGAGG + Intergenic
1194071754 X:89332948-89332970 GAGGGTAAAAACAAAGGAAGAGG - Intergenic
1194140547 X:90203739-90203761 GAAGGTAAAGAGAAAGAAGGAGG - Intergenic
1194275531 X:91876208-91876230 TCGGGGAAAGAGAAGGAAGGTGG + Intronic
1194782905 X:98047213-98047235 TAGGCTAAAAAAAAGGGAGGAGG - Intergenic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195563636 X:106315892-106315914 GAAGGAAGAAAGAAAGAAGGAGG + Intergenic
1195751006 X:108161981-108162003 GAGGATGAGAAGAAGGGAGGAGG - Intronic
1196081894 X:111641475-111641497 GTGGGTAGAAATAAGGATGGTGG - Intergenic
1196376447 X:115038393-115038415 GTGTGTAAAAAACAGGAAGGTGG + Intergenic
1196410973 X:115418195-115418217 GAGGGTAGAAAAAATAAAGGGGG - Intergenic
1196834495 X:119801932-119801954 GAAAGAAAAAAGAAAGAAGGAGG - Intergenic
1197334523 X:125195971-125195993 GAAGAAAAAAAGAAGGAAGGAGG + Intergenic
1198197015 X:134373404-134373426 GAGGGTAAAGAGAAAGAAGTCGG - Exonic
1198229171 X:134673281-134673303 AAGGGAAGAAGGAAGGAAGGAGG + Intronic
1198247408 X:134843403-134843425 TAGGGTAAAAAAAAAAAAGGGGG + Intronic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198316387 X:135470993-135471015 GAGGGAACAAAGAAAGAAGGAGG - Intergenic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1199038814 X:143085764-143085786 AAGGGAAGAAGGAAGGAAGGAGG + Intergenic
1199179662 X:144838606-144838628 AAGGGAAAAAGAAAGGAAGGAGG - Intergenic
1199662054 X:150061474-150061496 AATGGCAAAAAGAAAGAAGGAGG - Intergenic
1199751550 X:150824134-150824156 GAGGAGGAGAAGAAGGAAGGAGG + Intronic
1200232616 X:154451575-154451597 GAAGGAAGAAGGAAGGAAGGAGG - Intergenic
1200486306 Y:3772844-3772866 GAAGGTAAAGAGAAAGAAGGAGG - Intergenic
1200592778 Y:5097643-5097665 TTGGGGAAAGAGAAGGAAGGTGG + Intronic
1200726002 Y:6668676-6668698 GAGGGTAAAAACAAAGGAAGAGG - Intergenic
1201341098 Y:12935491-12935513 GAGGGAAGGAGGAAGGAAGGAGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201409082 Y:13680669-13680691 GAGGGTGAGAAGAAGTAGGGTGG + Intergenic
1201434182 Y:13939262-13939284 GAGGGACAAAGGAAGAAAGGGGG - Intergenic
1201550072 Y:15210251-15210273 GAGGGAGGAAGGAAGGAAGGAGG + Intergenic
1201625635 Y:16011891-16011913 AAGGAAAAAAGGAAGGAAGGAGG + Intergenic
1201625747 Y:16012461-16012483 GAGGGAGGGAAGAAGGAAGGAGG + Intergenic
1201690525 Y:16759864-16759886 GAGAGAGAAAGGAAGGAAGGAGG + Intergenic
1201691741 Y:16774850-16774872 GAGGGAAGGAGGAAGGAAGGAGG - Intergenic
1201946313 Y:19514661-19514683 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1202034888 Y:20622005-20622027 GAGGGAAAAAACAGGAAAGGTGG - Intergenic
1202173820 Y:22079355-22079377 GTGGGCATAAAGAAGGAAGAAGG + Intronic
1202217540 Y:22507027-22507049 GTGGGCATAAAGAAGGAAGAAGG - Intronic
1202325645 Y:23689032-23689054 GTGGGCATAAAGAAGGAAGAAGG + Intergenic
1202374414 Y:24220524-24220546 GAGAAAAAAAGGAAGGAAGGAGG + Intergenic
1202496366 Y:25449596-25449618 GAGAAAAAAAGGAAGGAAGGAGG - Intergenic
1202545126 Y:25981022-25981044 GTGGGCATAAAGAAGGAAGAAGG - Intergenic