ID: 932170880

View in Genome Browser
Species Human (GRCh38)
Location 2:69554937-69554959
Sequence GTGGAGGAACTAAGAAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932170880_932170888 30 Left 932170880 2:69554937-69554959 CCTGTGCTTCTTAGTTCCTCCAC 0: 1
1: 0
2: 2
3: 18
4: 182
Right 932170888 2:69554990-69555012 CAGTGTGTTTTTAAATAAGGAGG 0: 1
1: 0
2: 0
3: 32
4: 326
932170880_932170887 27 Left 932170880 2:69554937-69554959 CCTGTGCTTCTTAGTTCCTCCAC 0: 1
1: 0
2: 2
3: 18
4: 182
Right 932170887 2:69554987-69555009 TCTCAGTGTGTTTTTAAATAAGG 0: 1
1: 0
2: 2
3: 37
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932170880 Original CRISPR GTGGAGGAACTAAGAAGCAC AGG (reversed) Intronic
900214653 1:1475080-1475102 CTGGAGCAACTCAGAGGCACAGG - Intronic
900221862 1:1513429-1513451 CTGGAGCAACTCAGAGGCACAGG - Intronic
901157731 1:7151649-7151671 GAGGAGGCTCTAAGAAGCACTGG - Intronic
901408376 1:9065674-9065696 GTGAAGGAACTGAGAAGCTCAGG - Intronic
905034465 1:34908410-34908432 GTGGAGGAAACAACAAGCACAGG + Intronic
908074440 1:60498911-60498933 CTAGAGGAAGAAAGAAGCACAGG + Intergenic
908823593 1:68113074-68113096 GTGGTGGGACTAAGGAGCATGGG - Intronic
911133057 1:94410477-94410499 GTGAAGGCAAAAAGAAGCACAGG - Intergenic
912113906 1:106380079-106380101 GTGTAGGGACTGAGAAGCACTGG - Intergenic
912970357 1:114275560-114275582 GTGTGGGGACTAAGAGGCACAGG + Intergenic
913105670 1:115612099-115612121 GTGGAGGAACGAGGAAGAAATGG - Intergenic
913264416 1:117030589-117030611 CTGGAGGTACTGGGAAGCACAGG - Intronic
915721934 1:157992452-157992474 ATGGAGGAACTAGGAAGGAAGGG - Intergenic
916273037 1:162964379-162964401 GTGAAGGTAGAAAGAAGCACAGG - Intergenic
918822471 1:189272398-189272420 GTTGAGGGACTAGGAAGCACTGG - Intergenic
918854892 1:189739270-189739292 GTGAAGGAACTCAGTAGTACTGG + Intergenic
919258082 1:195152452-195152474 GTTAAGGAACTGAGAAGCTCAGG - Intergenic
919756861 1:201071464-201071486 GTGGAGGAAGTAAGAAGGCGGGG - Intronic
922417264 1:225432873-225432895 GTGGAGGAACTTAGAAGATGTGG + Intergenic
923453754 1:234144189-234144211 GTGTTAGAACTGAGAAGCACTGG - Intronic
1064457846 10:15505178-15505200 GTGGCTGAACTCAGAAGCAAGGG + Intergenic
1064486442 10:15797155-15797177 GTGAAGAAACTAAGAATCAGAGG + Intronic
1071794082 10:88986773-88986795 GTGGAGGAAGGAAGTAGTACAGG + Intronic
1078156694 11:8805977-8805999 GTGCAGGCCCTCAGAAGCACTGG - Intronic
1079339488 11:19600173-19600195 ATGGAGGAACAAAGAAGCTGGGG + Intronic
1080702456 11:34655592-34655614 GTGGAGGATCTGAGAAACAGAGG - Intronic
1083518526 11:63283735-63283757 GTGGAGGAAATGTGAACCACTGG + Intronic
1084266821 11:68009257-68009279 GTGGAGGAACACGGAAGCACAGG + Intronic
1084867268 11:72069420-72069442 GTGAAGGAAGTGAGAAGCAGGGG - Intronic
1086252263 11:84830389-84830411 GTGGAGGAACTTAAAGGAACAGG + Intronic
1086325137 11:85691106-85691128 GTCAAGGAACTAAGAAGCCAGGG + Intergenic
1089350864 11:117820858-117820880 GTGGGGGCAATAAGAAGCGCAGG - Exonic
1090552016 11:127830138-127830160 CAGGAGGAACTGAGAAGCACTGG + Intergenic
1090647670 11:128778744-128778766 GTGGGGGAGCTCAGCAGCACAGG + Intronic
1090768332 11:129896004-129896026 ATGAAGGAACTCGGAAGCACAGG - Intergenic
1094096765 12:26713963-26713985 GTGATGGAACTGAGAAGCTCTGG - Intronic
1095375802 12:41527206-41527228 GTGAAGGCACTGACAAGCACAGG + Intronic
1095853588 12:46836784-46836806 GTGCAAGACCTAAAAAGCACAGG - Intergenic
1096552612 12:52383239-52383261 TTGGAGAAACTGAGAGGCACTGG - Intronic
1096661098 12:53124429-53124451 GTGGGGGAACTCAGAGGAACTGG + Exonic
1097661780 12:62437964-62437986 GTTGAGCAAATAAGAAGCAGAGG - Intergenic
1101419297 12:104536497-104536519 GTGGAAGAACAATGAAGCAAAGG - Intronic
1103261848 12:119594839-119594861 GGGGAGGAACTACGACGCGCTGG - Intronic
1103858875 12:123995691-123995713 GTGGAGGAACCCAGTAGCGCTGG + Intronic
1103979963 12:124730713-124730735 GTTGAGGACCCATGAAGCACTGG + Intergenic
1105944969 13:25181419-25181441 GTGGAGAAACTGAATAGCACAGG + Intergenic
1107011719 13:35677039-35677061 GTGGCAGACCTAAAAAGCACTGG - Intergenic
1107584728 13:41832273-41832295 GTTGAGAACCTGAGAAGCACTGG + Intronic
1110285291 13:73743087-73743109 GTGGAGGAACTAACAGAAACAGG - Intronic
1110355138 13:74558839-74558861 GTGGAGGAAATAAAAATCAGTGG - Intergenic
1115438885 14:33409031-33409053 GTGGGAGAACTTAGAAGCCCTGG - Intronic
1115631122 14:35246431-35246453 GTGGCTGAACTAAGGAGAACTGG - Intronic
1118321809 14:64757785-64757807 GAGGAAGAACCAAGAGGCACTGG + Intronic
1118978363 14:70696548-70696570 GTGGAGAAACAGAGATGCACAGG + Intergenic
1119849758 14:77858825-77858847 GAGGAGGAGATAGGAAGCACTGG + Intronic
1122562458 14:102625922-102625944 GTCAAGGAACTAAGAAGCCAAGG - Intronic
1124835501 15:33193070-33193092 TTGCAGGAACAAAGAAGCAATGG - Intronic
1125002229 15:34783675-34783697 TAGCTGGAACTAAGAAGCACAGG - Intergenic
1126874840 15:53030120-53030142 GTGGAAGAACAAAGAAAGACAGG - Intergenic
1127081982 15:55389819-55389841 CTGCAGAAACTGAGAAGCACAGG + Intronic
1128552705 15:68608638-68608660 GAGGAGGAACTGGGAAGCAGAGG - Intronic
1129898862 15:79130200-79130222 GGGCAGGAAGTGAGAAGCACTGG - Intergenic
1133782359 16:8949503-8949525 GTGGATGAAAATAGAAGCACAGG - Intronic
1136685014 16:31988895-31988917 CTGGAGGAGCCAGGAAGCACTGG + Intergenic
1136692160 16:32039895-32039917 GAGGAGGCACTCAGAACCACCGG + Intergenic
1136785626 16:32932430-32932452 CTGGAGGAGCCAGGAAGCACTGG + Intergenic
1136792703 16:32983333-32983355 GAGGAGGCACTCAGAACCACCGG + Intergenic
1136877153 16:33870721-33870743 GAGGAGGCACTCAGAACCACCGG - Intergenic
1136884143 16:33921374-33921396 CTGGAGGAGCCAGGAAGCACTGG - Intergenic
1137926371 16:52546196-52546218 GTGGGGGAGGTAAGAAGGACTGG + Intronic
1139123950 16:64055051-64055073 GTGTAAGACCTCAGAAGCACGGG + Intergenic
1203094913 16_KI270728v1_random:1244812-1244834 GAGGAGGCACTCAGAACCACCGG + Intergenic
1142848239 17:2692265-2692287 GTGGAGGAAGACAGGAGCACTGG + Intronic
1143163814 17:4887550-4887572 GGGGTGGCACAAAGAAGCACTGG - Intronic
1144152987 17:12468939-12468961 GAGGAGGAAGTCAGGAGCACAGG + Intergenic
1144274643 17:13653817-13653839 GTGGACGAACTCAGATGCAGAGG + Intergenic
1147145955 17:38484576-38484598 CTGGAGGAACCAGGAAGCACTGG + Intronic
1147177814 17:38667424-38667446 GTGGAGGAGCAAAGTAGCTCTGG - Intergenic
1149106313 17:52971523-52971545 GTGAAAGAACTCAAAAGCACAGG + Intergenic
1149361393 17:55899245-55899267 GTGCAAGAACTAACTAGCACAGG + Intergenic
1149491567 17:57088546-57088568 GTAGAGGAACTAGGAAGCGTGGG + Intronic
1150956624 17:69867032-69867054 GTGGAGGAACCAAGAGGGCCGGG + Intergenic
1151160882 17:72164683-72164705 GTGGAGGATCTTTGAAGCAATGG + Intergenic
1151194598 17:72422698-72422720 ATGGGGGAACTAACAAGCGCCGG - Intergenic
1155150352 18:23118046-23118068 GTGGAGCCACGAAGAAGCCCTGG + Intergenic
1155439546 18:25847527-25847549 GTGGAGCAACTGGGAAGGACTGG - Intergenic
1157090928 18:44636117-44636139 CTGGAAGAACTTGGAAGCACAGG + Intergenic
1162019214 19:7861062-7861084 GGGGAGGAACCCAGAAGCCCTGG - Intronic
1168063299 19:53906207-53906229 ATGGAGGAACCAAGAGACACAGG - Intronic
926410764 2:12599942-12599964 TTTGAGGAACTAAGAAGGATAGG + Intergenic
928612005 2:33000164-33000186 TTGGAGAAACTAAAAAGTACAGG + Intronic
930062859 2:47305364-47305386 GGGTAAGAACTAAGAAGAACAGG + Intergenic
932170880 2:69554937-69554959 GTGGAGGAACTAAGAAGCACAGG - Intronic
932476126 2:72007105-72007127 TTGAAGAAACTAAGAAGCAAAGG + Intergenic
932483344 2:72063461-72063483 TTTGAGGAACTAAGAAAAACAGG - Intergenic
935288196 2:101584835-101584857 GGGTAAGAACTTAGAAGCACAGG - Intergenic
937546121 2:123022999-123023021 TTGGTGAAACTTAGAAGCACGGG - Intergenic
938737726 2:134201640-134201662 GTGGAGGATCTGACAAGCACAGG - Intronic
938800428 2:134758457-134758479 GTGTAAGACCTAAAAAGCACAGG + Intergenic
939929250 2:148212132-148212154 GTGAATATACTAAGAAGCACTGG - Intronic
939976447 2:148722238-148722260 GGGGAAAAACTGAGAAGCACTGG - Intronic
940713994 2:157197203-157197225 GAGGACGGTCTAAGAAGCACTGG + Intergenic
940719045 2:157261358-157261380 GTATAGAAACTAAGAAGCACTGG - Intronic
942892377 2:181007069-181007091 GTGGAAGAACTTTGAAGGACTGG - Intronic
942927618 2:181452857-181452879 GTGTAAGACCTAAAAAGCACAGG - Intergenic
943261641 2:185672091-185672113 GTGGATGGAGTTAGAAGCACTGG + Intergenic
943281076 2:185933481-185933503 GTGGAGGAACTAGAGAGTACTGG + Intergenic
945840413 2:214881100-214881122 GTGGAAGAAATGAGAATCACTGG + Intergenic
947040601 2:225914820-225914842 GTGTAGGATCTCAGAAGCACAGG - Intergenic
948804819 2:240448930-240448952 GGGGAGGAAATGAGAAGCCCAGG - Intronic
1169029236 20:2395197-2395219 GTGGAGGGCCTCAGAAGCCCGGG - Exonic
1169250896 20:4060582-4060604 TGGGAGGAACTAAGAAGCTGTGG - Intergenic
1170502030 20:16983805-16983827 ATGGAAGAACAAAGAAGCATAGG - Intergenic
1170842188 20:19933038-19933060 GTGGTGGAACTAGAAAGAACGGG - Intronic
1171492830 20:25533145-25533167 GTGGAGGGTCTCAGAAGCAGTGG + Intronic
1173029371 20:39340703-39340725 GTGGAGGAAACAAGAAACACTGG + Intergenic
1179560260 21:42211418-42211440 GTGGAGAAAGGAAGAAGAACAGG - Intronic
1181390740 22:22579224-22579246 GTGGAGGAAACAAGGAGCAATGG - Intergenic
1182492107 22:30680026-30680048 GTGTGGGGACTCAGAAGCACAGG - Intergenic
1183324691 22:37184843-37184865 GTGGAGGACCCATGGAGCACAGG - Intronic
1185164543 22:49253173-49253195 GGAGAGGAGCTAAGAATCACTGG + Intergenic
1185236047 22:49713669-49713691 GGCAATGAACTAAGAAGCACAGG + Intergenic
951421377 3:22489794-22489816 TTGGAGAAACTGAGAAGCAGAGG + Intergenic
952018303 3:28986066-28986088 GTGTAGTAATTAAGAAGCAAAGG - Intergenic
953548260 3:43880707-43880729 GTGGAGGAACCAAGAAGAGTAGG + Intergenic
955546986 3:60041522-60041544 GTGGAGAAAACAAGGAGCACAGG + Intronic
956960354 3:74392089-74392111 GAAGAGGAACTAAGAAGAAGGGG + Intronic
961171745 3:124802134-124802156 GTGGAGGAAATAACATGCAGAGG - Intronic
963176974 3:142309026-142309048 ATGGAGGATGTAAGAAGCAGAGG - Exonic
963836366 3:150061798-150061820 GTGGGGGCTCTAAGATGCACAGG + Intergenic
964839487 3:160978391-160978413 GTGGCGGAAATAAGAGGTACGGG + Intronic
964915459 3:161836224-161836246 AGGGGAGAACTAAGAAGCACTGG + Intergenic
969935302 4:10674241-10674263 GTGGAGGTACAAAGGAGCCCAGG + Intronic
970294020 4:14608526-14608548 GGGAAGCAACTAAAAAGCACTGG + Intergenic
975969499 4:80016407-80016429 GTGGAGGAACTGAGACAGACAGG - Intronic
977066069 4:92317451-92317473 GTGGAGAAAAATAGAAGCACTGG - Intronic
978113475 4:104991079-104991101 GTGGGGGAAGTGAGAAGTACCGG + Intergenic
978976302 4:114878864-114878886 GCAGAGGAACAAAGAAACACTGG - Intronic
980825010 4:138062505-138062527 TTGGAGGAAATGAGAAGTACAGG + Intergenic
981300860 4:143184879-143184901 GTGAAGGACCTAAGAACCTCCGG - Intergenic
981499786 4:145437706-145437728 GTGGAAGAAGTAAGAAGCAGAGG + Intergenic
984148922 4:176101249-176101271 CTGGGGGTACTGAGAAGCACTGG + Intronic
984843770 4:184092751-184092773 GTAGGGGAACTAGAAAGCACAGG - Intronic
985200865 4:187484183-187484205 GTGGAGGAAAAACGAAGCAGGGG + Intergenic
988873347 5:35415343-35415365 AAGAAGGAAATAAGAAGCACAGG + Intergenic
989985411 5:50691219-50691241 GGGGAGGAAAAAAGAAGCAAAGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
992768542 5:80025739-80025761 GTGGAGGACCTCAGAAGGACAGG - Intronic
998251965 5:140559461-140559483 CTGGAGGCACTAGGAAGCACTGG - Intronic
998592414 5:143491181-143491203 GTGGGGGAAGTGAGAAGGACAGG - Intergenic
1000653028 5:163841375-163841397 ATGGAGGAACGCAGAATCACAGG + Intergenic
1002178181 5:177414378-177414400 GTGCAGGAATTAAGAGCCACTGG - Intronic
1003839067 6:10101589-10101611 GAGGAGTAACTAAAAAGCAGGGG - Intronic
1005719777 6:28589968-28589990 GCGGAGAGACTAAGAAGTACAGG - Intronic
1005735112 6:28738413-28738435 GTGGAGGAGAGAAGAAGCAGCGG + Intergenic
1006276272 6:33007584-33007606 GTGGAGGCACTAGGAGGAACAGG + Exonic
1006500009 6:34452374-34452396 GGGGATATACTAAGAAGCACAGG - Intergenic
1007485664 6:42179010-42179032 GTGGAGGAAGTGACCAGCACGGG - Intronic
1008046195 6:46853995-46854017 GTTGAGCAACGAAGAAGCACTGG + Exonic
1011818814 6:91225715-91225737 GGTGAGGAACTAAGAAGCACAGG + Intergenic
1014810791 6:125883410-125883432 GTGAAGAAACTAAAAATCACTGG - Intronic
1014814095 6:125916653-125916675 GTGGAGGAACTCAGGAGTCCTGG - Intronic
1015344874 6:132144662-132144684 GGGGAGGAAGTGAGAAGAACTGG - Intergenic
1015526116 6:134176277-134176299 GTGGCAAAACTAAGAAGCCCTGG - Intronic
1015683616 6:135834836-135834858 GTGGAGGAACTAGACAGAACTGG - Intergenic
1016195988 6:141340923-141340945 GTGTAAGACCTAAGAAGTACAGG + Intergenic
1016775545 6:147900581-147900603 GAGGAGGAATGAAGAATCACAGG + Intergenic
1018996051 6:168711391-168711413 CTGGAGGAGCTAAGAAGGGCGGG - Intergenic
1020395693 7:7714908-7714930 GTGGTTGAACTAAGCAGAACAGG + Intronic
1021667364 7:22998033-22998055 ATGGAGGATCTGAGAAGAACAGG - Intronic
1022029508 7:26479497-26479519 GTGGAGCATCTATGAAGCATTGG - Intergenic
1023058092 7:36305552-36305574 GTGTAGGAGCTCAGAAGCGCGGG - Intergenic
1023196411 7:37644239-37644261 GTGGAGGAAAAATGAAACACTGG + Intergenic
1024502970 7:50132936-50132958 GTGGAGGAAGTGAGAATCACTGG + Intronic
1026791140 7:73332784-73332806 GTGGAGGACCTAATAAGCACTGG - Intronic
1028091592 7:86709344-86709366 GAGGGGGAACTATGAAGCAGTGG - Intronic
1029709914 7:102293813-102293835 GTGGAGGCACCAAGAGACACAGG + Intronic
1031890740 7:127290725-127290747 CTGCAGGACCTAAGAGGCACAGG - Intergenic
1034460195 7:151193805-151193827 GTGGTGGAACTGAAAGGCACGGG + Intronic
1040790405 8:51222660-51222682 GTTGAAAAACTAACAAGCACAGG + Intergenic
1041005781 8:53495828-53495850 CTGGAGGAAGGAAGAAGCATTGG + Intergenic
1041405697 8:57496957-57496979 GTGGAAGAACTGAGCAGGACTGG - Intergenic
1045285587 8:100788647-100788669 GTGGGGGAATTAACAAGCAGAGG - Intergenic
1046084786 8:109418795-109418817 GTAAGGAAACTAAGAAGCACAGG - Intronic
1047889312 8:129290434-129290456 GTGGTGAAACTAAGAAACCCTGG - Intergenic
1048940378 8:139395557-139395579 GTGCTGGAGTTAAGAAGCACTGG - Intergenic
1050215920 9:3323188-3323210 GGGGATGAACTAATATGCACAGG + Intronic
1052440076 9:28485017-28485039 ATGGAGAAACTGAGAACCACAGG - Intronic
1053651196 9:40171304-40171326 GTTGAGCAACGAATAAGCACTGG - Intergenic
1053901582 9:42800652-42800674 GTTGAGCAACGAATAAGCACTGG - Intergenic
1054380462 9:64485477-64485499 GTGGAGGAACTAGGATGGAGAGG + Intergenic
1054533384 9:66204899-66204921 GTTGAGCAACGAATAAGCACTGG + Intergenic
1057498545 9:95578843-95578865 GAGGAGTAGCTTAGAAGCACAGG - Intergenic
1057729277 9:97594682-97594704 GGGGAGGACCGAAGACGCACTGG - Intronic
1059865612 9:118510872-118510894 GTGGAGTGACTAACAAGCAAAGG - Intergenic
1060442385 9:123654096-123654118 GTGGAGGAACCAAGATACACTGG - Intronic
1062314349 9:135958866-135958888 GTGGAGGATCTGAGTAGCAGGGG - Intronic
1186022013 X:5267284-5267306 TTAGAGGAAATAAGAAACACGGG + Intergenic
1190585658 X:51938128-51938150 GTGTAGGACCTCAAAAGCACAGG + Intergenic
1191900202 X:66032879-66032901 TTGGAGGAAATAAGAAGGAAAGG + Intronic
1194802504 X:98290340-98290362 ATGGAGGAACAAATGAGCACAGG - Intergenic
1198446157 X:136716384-136716406 GCGGGAGAACTAGGAAGCACGGG + Intronic
1200204797 X:154308165-154308187 GTGGAGGAGGTAGGAGGCACTGG + Intronic