ID: 932183997

View in Genome Browser
Species Human (GRCh38)
Location 2:69675889-69675911
Sequence CTCAGATTCTCGGGAGGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151034
Summary {0: 1, 1: 4, 2: 267, 3: 9850, 4: 140912}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932183990_932183997 19 Left 932183990 2:69675847-69675869 CCCTGTCTCTACTAAAAATACAA 0: 62759
1: 158911
2: 184886
3: 115845
4: 74212
Right 932183997 2:69675889-69675911 CTCAGATTCTCGGGAGGTTGAGG 0: 1
1: 4
2: 267
3: 9850
4: 140912
932183991_932183997 18 Left 932183991 2:69675848-69675870 CCTGTCTCTACTAAAAATACAAA 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
Right 932183997 2:69675889-69675911 CTCAGATTCTCGGGAGGTTGAGG 0: 1
1: 4
2: 267
3: 9850
4: 140912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932183997 Original CRISPR CTCAGATTCTCGGGAGGTTG AGG Intronic
Too many off-targets to display for this crispr