ID: 932188104

View in Genome Browser
Species Human (GRCh38)
Location 2:69715750-69715772
Sequence GCCTATGCACAGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 2, 1: 0, 2: 1, 3: 23, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932188097_932188104 3 Left 932188097 2:69715724-69715746 CCAAAATGTGTTTTGTCCCCTTC 0: 1
1: 1
2: 3
3: 43
4: 724
Right 932188104 2:69715750-69715772 GCCTATGCACAGAGGGCAGTGGG 0: 2
1: 0
2: 1
3: 23
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932188104 Original CRISPR GCCTATGCACAGAGGGCAGT GGG Intronic
900747125 1:4368035-4368057 GCAGGTGCACAGAGGTCAGTGGG + Intergenic
900764294 1:4493767-4493789 GCAAATGCACTGAGGGCAGCAGG - Intergenic
901781657 1:11598414-11598436 ACCTATCCTCAGAGGGCTGTGGG + Intergenic
903453890 1:23473767-23473789 GCCTCTGCACAGGGGGCCGAGGG - Intronic
903687194 1:25140451-25140473 CCCCATGGACAGAGGGCAGGAGG + Intergenic
904282682 1:29432449-29432471 GGATATGCACAGAGGGCTGTGGG - Intergenic
909071188 1:70995356-70995378 GGCTTTGTACAGTGGGCAGTGGG + Intronic
909504069 1:76368067-76368089 GCTAGAGCACAGAGGGCAGTTGG - Intronic
913272722 1:117109859-117109881 GACTATGCAGAGGGTGCAGTTGG + Intergenic
915492935 1:156261499-156261521 GCCTATGTTCAGAGGCCTGTGGG + Intronic
916498027 1:165362656-165362678 GACAATGCACAGGGAGCAGTTGG + Intergenic
916505520 1:165425043-165425065 GCCTCTGCACACAGCCCAGTTGG + Intronic
917990022 1:180365227-180365249 GCCTGTCAACAGAGGGCAGTAGG + Intronic
918128342 1:181603982-181604004 GGCAAGGTACAGAGGGCAGTGGG - Intronic
919965118 1:202515489-202515511 GCCTATGCAAAGAAGGCAGCAGG - Intronic
922568237 1:226616081-226616103 GCTTCTGCACAGAGGGGAGAGGG + Intergenic
1069797949 10:71065178-71065200 TCCGATGCACAAAGGGCACTCGG - Intergenic
1071227988 10:83553763-83553785 GCCAATGCACTGAGAGCAGAAGG - Intergenic
1072019191 10:91381660-91381682 GCCTGACCCCAGAGGGCAGTTGG + Intergenic
1074778805 10:116785707-116785729 GCCAGTGCTCAGAGGGCAGGTGG - Intergenic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1077147785 11:1053639-1053661 GCCTGGGCCCAGAGGGGAGTTGG + Intergenic
1078562099 11:12381120-12381142 GCCCAGGCAAAGAAGGCAGTGGG + Intronic
1079244410 11:18742443-18742465 GCCTGTCCTCAGGGGGCAGTGGG + Exonic
1080556802 11:33424907-33424929 GCCTCTGTACAGAGGGCATGAGG + Intergenic
1081702704 11:45162038-45162060 GCCACTGCCCAGAGGGCAGGAGG - Intronic
1083225681 11:61282993-61283015 TCCTATACACACAGGGCTGTGGG + Intronic
1084465448 11:69320552-69320574 GCATCTGCACACAGGGCACTGGG - Intronic
1084681979 11:70671730-70671752 GTCTCTGCACACAGGGCTGTGGG + Intronic
1084717080 11:70880797-70880819 GCCTATCCACAGGTGGCAGCTGG - Intronic
1085472961 11:76769672-76769694 GGCCAGGCACAGAGGGCAGGAGG - Intergenic
1085597282 11:77821127-77821149 GCGTATTCCCGGAGGGCAGTTGG + Exonic
1086017581 11:82184960-82184982 GCAGATGCTCAGAGGGCACTGGG - Intergenic
1086879630 11:92138209-92138231 GCTTGTGGACATAGGGCAGTTGG - Intergenic
1088904116 11:114141090-114141112 GCTTATCCACAGTGGGCAGGTGG - Intronic
1090051840 11:123386792-123386814 GCCGATGCACTGTGGCCAGTGGG - Intergenic
1090082678 11:123624531-123624553 GCCTATGCCCACAGCCCAGTGGG + Intronic
1091354467 11:134924996-134925018 GCACATGCACAGCGGTCAGTGGG - Intergenic
1095121615 12:38425751-38425773 GCCTATGCAGAGAAGACAGATGG - Intergenic
1096534205 12:52260534-52260556 GCTTGGGCACAGAGGGAAGTAGG - Intronic
1098132693 12:67366992-67367014 GCCAATGCACCAAGGACAGTGGG - Intergenic
1101228365 12:102712862-102712884 TCTTATGCACTGAGGTCAGTTGG + Intergenic
1101337373 12:103808307-103808329 GTCTATGCTCCGAGGGCAGAGGG - Intronic
1102001541 12:109560912-109560934 GCCTCTGCACAGCGGGCAGGAGG - Intronic
1104067096 12:125315096-125315118 GCTTATGCACAGAAGGAAGTAGG + Intronic
1105041428 12:132964482-132964504 GCCGAGGCAGAGAGGGGAGTGGG - Intergenic
1105545716 13:21349217-21349239 GCAGATGTGCAGAGGGCAGTAGG - Intergenic
1105681744 13:22735693-22735715 GCCTATGTACAGATGGCAAGAGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1112146489 13:96705817-96705839 GCCTGTGCCCAGAGGCCAGTGGG - Intronic
1117053373 14:51885011-51885033 TCCAATGCACAGAGGGGAGGCGG + Intronic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1121856839 14:97278005-97278027 GCCTCTGCAGAGATGTCAGTGGG + Intergenic
1122186049 14:99996948-99996970 CCCTATAAAAAGAGGGCAGTAGG - Intronic
1123697413 15:22889296-22889318 GCCCATGCACACAGGGCAGCAGG + Intronic
1129253267 15:74320163-74320185 GCTTCTGAACAGAGCGCAGTGGG - Intronic
1130321455 15:82846017-82846039 GACTGTGCACAGAGGGCAGTTGG - Intronic
1130846752 15:87754880-87754902 GGCCATGCACAGAGGGAAGGTGG - Intergenic
1132726480 16:1341108-1341130 GCCTGTGGACAGAGGGGCGTGGG - Exonic
1133223782 16:4330531-4330553 GCCTCTGCAGGGAGGGCGGTGGG + Intronic
1136683895 16:31983162-31983184 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1136784524 16:32926714-32926736 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1136885259 16:33927092-33927114 GTCTCTGCCAAGAGGGCAGTGGG - Intergenic
1138133108 16:54499105-54499127 GCCTTTGCCCAGAGGGAAGCTGG - Intergenic
1138321941 16:56121988-56122010 GCCTATGCCCACAGGGCACTTGG + Intergenic
1138533216 16:57646282-57646304 CCCTCTGCACGGTGGGCAGTGGG - Intronic
1138553925 16:57761473-57761495 GGCTGTGCCCAGACGGCAGTGGG - Exonic
1139362416 16:66408596-66408618 GCCTATAGACACAGGGCATTGGG + Intergenic
1142329475 16:89442094-89442116 GTCTGTGCACAGTGAGCAGTTGG + Intronic
1203087183 16_KI270728v1_random:1190720-1190742 GTCTCTGCCAAGAGGGCAGTGGG + Intergenic
1142501557 17:335998-336020 GCCTAGGCACAGCGCCCAGTGGG - Intronic
1142584974 17:966741-966763 GTCCAGGCACAGAGGGCAGCTGG - Intronic
1142711297 17:1725229-1725251 GCCTTTGCACAGAGCGCTGCAGG - Exonic
1143375729 17:6466000-6466022 GACTCTACGCAGAGGGCAGTGGG - Intronic
1144009567 17:11133780-11133802 TTATATTCACAGAGGGCAGTGGG - Intergenic
1145823995 17:27862789-27862811 GCTGAAGCACAGTGGGCAGTGGG + Intronic
1147144822 17:38478865-38478887 GTCTCTGCCAAGAGGGCAGTGGG + Intronic
1147246592 17:39125168-39125190 GGCTATGTCCAGAGGGCAGCTGG - Intronic
1147826219 17:43271790-43271812 GCCCTTTCACAGAGGGCGGTGGG + Intergenic
1147981498 17:44277377-44277399 GCCTAAGGACAGTTGGCAGTAGG + Intergenic
1149782552 17:59409535-59409557 GCTTATGCAAAAAGGGGAGTGGG + Intergenic
1153255465 18:3165988-3166010 TCCTGGGCACAGTGGGCAGTGGG - Intronic
1155101519 18:22615023-22615045 GCCTATGAGCAGAAGGCAGCGGG + Intergenic
1155348841 18:24886045-24886067 GACTATGCCTAGCGGGCAGTAGG + Intergenic
1157601689 18:48896974-48896996 GCCTATGACATGAGGGCAGTGGG + Intergenic
1158187147 18:54783730-54783752 GCCTATGCCCAGAGGGAAGCAGG - Intronic
1161026481 19:2039585-2039607 ACCTATGTACAGAGGGGAGATGG + Exonic
1161568452 19:5016661-5016683 GCCGATGCAGACAGGGTAGTGGG - Intronic
1162041705 19:7974914-7974936 GCCCCTGCTCATAGGGCAGTGGG + Intronic
1162475199 19:10895657-10895679 CCCTAAGCACAGGGGGCAGTGGG - Intronic
1163374704 19:16923017-16923039 GCCTGGGGACAGAGGGCTGTGGG - Intronic
1163646470 19:18492298-18492320 GTCCTTGCACATAGGGCAGTGGG - Intronic
1164593321 19:29518012-29518034 CCCTCTGCTCAGAGGGCACTGGG - Intergenic
1164865222 19:31599129-31599151 ACTTATGGACACAGGGCAGTGGG - Intergenic
925557884 2:5152482-5152504 GCCCATGCACAGAGGGCACATGG - Intergenic
925935509 2:8755142-8755164 GCCTTTTCACAGATGGCAGTGGG - Intronic
927967907 2:27283109-27283131 GCCTGTGCATAGACGGCAGCTGG + Intronic
929764027 2:44829424-44829446 GCCTCTGCAGAGAAGGCAGTTGG - Intergenic
932188104 2:69715750-69715772 GCCTATGCACAGAGGGCAGTGGG + Intronic
933703837 2:85275109-85275131 GTCTAAACACAGAGGGCACTGGG - Intronic
933759299 2:85663136-85663158 GCCTCTGGACAAAGGGCTGTGGG - Intronic
934466899 2:94271501-94271523 GCTCATTCACAGAAGGCAGTGGG + Intergenic
936867142 2:117087706-117087728 GCCCAGGCACAGCGGGAAGTAGG + Intergenic
939041278 2:137191744-137191766 GCCTGTGCACAGGCTGCAGTGGG - Intronic
939334570 2:140809096-140809118 GCTTCAGCACAGAGGGCAGCAGG - Intronic
940754063 2:157661376-157661398 GTCTATGTACAAAGGGCAATGGG + Intergenic
941428979 2:165388853-165388875 GCCTATGTTAAGAGGGAAGTTGG + Exonic
941479789 2:165992176-165992198 GCCTATGTTAAGAGGGAAGTTGG - Exonic
946170531 2:217892764-217892786 GCCTGTGGACAGAGGGCGGGAGG - Intronic
946870113 2:224077194-224077216 CCCTCTGCACAGGGGGCAGCTGG + Intergenic
948246972 2:236494894-236494916 GCCTGAGGAGAGAGGGCAGTAGG + Intronic
948906487 2:240982067-240982089 GGCTGTGCACAGAGGGCAGCAGG + Intronic
1169298102 20:4417317-4417339 ACAGATGCACAGAGGGCAGATGG + Intergenic
1169408694 20:5348607-5348629 GCACATACACAGAGGGCAGATGG + Intergenic
1171274584 20:23845273-23845295 GCCTAGGCATGGAGTGCAGTGGG - Intergenic
1175758006 20:61542087-61542109 GCCCATACCCAGAGGGCAGCTGG + Intronic
1175769715 20:61616076-61616098 CCCTCCGCACAGAGAGCAGTGGG + Intronic
1177658708 21:24054329-24054351 GCACATGCACAGAGGGAAGAAGG - Intergenic
1179832550 21:44006459-44006481 CCCTCTGCACAGAGGGCAAAAGG - Intergenic
1179939042 21:44626599-44626621 GGCAATGAACAGAGGGCAGGAGG + Intronic
1179947496 21:44688176-44688198 GGCTATGATCAGAGGGAAGTGGG + Intronic
1181688168 22:24543428-24543450 CCCTGTGCCCGGAGGGCAGTAGG + Intronic
1181964108 22:26644675-26644697 GCCTTAGCACTGAGGGGAGTTGG + Intergenic
1182683982 22:32106526-32106548 GCCTGTGAACTGAGGGCAGATGG + Intronic
1184537279 22:45095720-45095742 GCCAGCGCTCAGAGGGCAGTGGG - Intergenic
950068666 3:10134700-10134722 GCTTGGGCACAGAGGGAAGTAGG + Intergenic
952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG + Intergenic
952884600 3:38004486-38004508 GCCTCTGTACACAGGGCTGTGGG + Intronic
953025380 3:39142094-39142116 GCCCATGCCCTGAGGCCAGTTGG - Exonic
956917196 3:73884250-73884272 GCCGACTCACAAAGGGCAGTAGG + Intergenic
957034908 3:75284991-75285013 GCCTGTGCAAGGAGGGCAGTGGG - Intergenic
957271223 3:78032651-78032673 GCCTAAGCAGGGAGGGCAGTGGG - Intergenic
957314442 3:78559394-78559416 GTGAATGCACAGCGGGCAGTGGG + Intergenic
961304684 3:125949864-125949886 ACCTGTGCAAGGAGGGCAGTGGG + Intergenic
961448403 3:126991736-126991758 GCAGAGGCACAGAGGGGAGTGGG - Intronic
966417290 3:179702373-179702395 GCCTGGCCACAGATGGCAGTGGG + Intronic
968910861 4:3476328-3476350 ACCTATGCACTGCGGGCAGGCGG - Exonic
969554518 4:7897137-7897159 GCCTACCCAAAGAAGGCAGTTGG - Intronic
969621799 4:8282354-8282376 GCCTATGCCCAGTGGGCAGAAGG - Intronic
976358707 4:84151749-84151771 GCGTCTGCACAGAGGGAATTAGG - Intergenic
984448786 4:179872458-179872480 GTCTATGCACAGAGAGGAATGGG + Intergenic
985336870 4:188905483-188905505 GGTTATGCACAGAGGGCGGATGG - Intergenic
986849756 5:11797253-11797275 TGATATGCACACAGGGCAGTGGG + Intronic
992138667 5:73773222-73773244 GCCCCTGCACAGAGGGCCCTTGG - Intronic
992509540 5:77419383-77419405 GTGTTTGCACAGAGTGCAGTGGG + Intronic
992963496 5:81978478-81978500 GCCTTTGAACAGTGGGTAGTAGG - Intronic
993784194 5:92108482-92108504 GCCTATGCACATATGGCATCAGG + Intergenic
996712383 5:126555945-126555967 GCCTATGCACAGATCCGAGTTGG - Exonic
999471616 5:151859714-151859736 GTCTATGCCCAGAAGGTAGTGGG + Intronic
1000419927 5:161027140-161027162 GCCTCTGAAGAGAAGGCAGTGGG + Intergenic
1001527273 5:172437775-172437797 CCCTGTGGACAGAGTGCAGTAGG - Intronic
1001756461 5:174174018-174174040 GACCATGGACTGAGGGCAGTGGG - Intronic
1001939271 5:175729236-175729258 GCCTCTGTCCTGAGGGCAGTGGG - Intergenic
1002029495 5:176417170-176417192 GCCTGTTCACAGAGGGCAGCGGG - Intergenic
1003383475 6:5646399-5646421 ACCTGTGCAGTGAGGGCAGTGGG + Intronic
1005787500 6:29260881-29260903 TCTTATGTACAGAGGGCAGATGG + Intergenic
1007092571 6:39193395-39193417 CCTTTTGCCCAGAGGGCAGTGGG - Intronic
1007251434 6:40497781-40497803 GCCTTTGCAGAGAGGGCCTTGGG + Intronic
1010760760 6:79719776-79719798 GAGTCAGCACAGAGGGCAGTGGG - Intergenic
1012999439 6:106007919-106007941 GCGAATGCACAGGGTGCAGTGGG - Intergenic
1013547897 6:111177597-111177619 GCTTATGCAGTGTGGGCAGTTGG + Exonic
1015455037 6:133416902-133416924 GCGTAACCACAGAGGGCAGTGGG - Intronic
1016126727 6:140412742-140412764 ACCAAGGGACAGAGGGCAGTGGG - Intergenic
1016376788 6:143429763-143429785 GCATAGGCACAGAGGACAGGAGG + Intronic
1018632780 6:165835068-165835090 GGCAGTGCACAGAGGGCAGTTGG + Intronic
1019815513 7:3197116-3197138 GCATTTGCAGAAAGGGCAGTAGG + Intergenic
1020042424 7:5014164-5014186 GCCTATGCACAGAGGGCAGTGGG + Intronic
1020901817 7:14012993-14013015 GCCTGAGCTCAGATGGCAGTGGG + Intergenic
1021531883 7:21655898-21655920 GTTTCTGCACACAGGGCAGTTGG + Exonic
1026329748 7:69341464-69341486 TCAGATGCACAGAGGGCAGGTGG + Intergenic
1030539222 7:110808543-110808565 GGCTGTGCACAGGGGGCATTTGG + Intronic
1032293529 7:130613114-130613136 TCCCATGGACAGAGGGCAGAGGG + Intronic
1037599145 8:20379257-20379279 GCATGTGGACATAGGGCAGTGGG - Intergenic
1039611502 8:38922939-38922961 GGCTGAGCACAGAGGTCAGTGGG - Intronic
1044813692 8:96089394-96089416 TCCTATGGGCAGAGGGAAGTGGG - Intergenic
1045442547 8:102228499-102228521 GCCTTTTCACATGGGGCAGTTGG - Intronic
1047403666 8:124567388-124567410 ACCTGTGCACAGGGGACAGTGGG + Intronic
1049344144 8:142129446-142129468 GCCGAGGCACAGAGGGCGATGGG - Intergenic
1050176602 9:2875540-2875562 GCATCTGCACAGAGAGCTGTGGG + Intergenic
1052735242 9:32335091-32335113 GCCTGTGCACAGATGACAGAGGG - Intergenic
1052965505 9:34337735-34337757 GCTGATGCAGAGAGGGCAGCTGG - Intronic
1059404964 9:114093835-114093857 GCCTCTGGACAGAGGGCAGCTGG - Intronic
1060474733 9:123978205-123978227 GGCAATGCTCAGAGGGCACTGGG + Intergenic
1060476629 9:123991918-123991940 GGCAATGCTCAGAGGGCACTGGG - Intergenic
1060916574 9:127395531-127395553 GCCTATGAAAAGGGGGCAGGAGG + Intergenic
1061958756 9:133977382-133977404 GCCCAGTCACAGAGGGCAGGAGG + Intronic
1062283012 9:135760286-135760308 TCCTCTGCTCAGTGGGCAGTGGG - Intronic
1062480126 9:136747267-136747289 GGCTCTGCACAGAGCCCAGTGGG + Intronic
1190865900 X:54384316-54384338 TCCTATGCCCAGAGGACATTTGG - Intergenic
1191104070 X:56761424-56761446 GCATGTGCACAGAGGCCTGTTGG - Intergenic
1191784825 X:64906073-64906095 GACAATAGACAGAGGGCAGTAGG - Intergenic
1192608597 X:72545218-72545240 GCATATGGACAAAGGGTAGTGGG + Intronic
1192798813 X:74446734-74446756 ACCTATCCAAAGATGGCAGTGGG - Intronic
1193049767 X:77087545-77087567 GCCTACTCACAGACGGCATTGGG + Intergenic
1197712056 X:129678493-129678515 GCCTACGCACCGGGGGCACTGGG + Intergenic
1199829848 X:151538617-151538639 GCATATGCACTGGGGGAAGTGGG - Intergenic
1199856909 X:151766779-151766801 GCATATACATAGAGGGCAGGTGG + Intergenic
1199941275 X:152630274-152630296 GCAGAAGCACAGAGAGCAGTCGG - Intergenic
1200747701 Y:6916985-6917007 TCCTGTGCACACAGGGCACTGGG - Intronic
1202300748 Y:23411307-23411329 GCCTATGCAAAGAAGGCAGCAGG - Intergenic
1202570063 Y:26259291-26259313 GCCTATGCAAAGAAGGCAGCAGG + Intergenic