ID: 932188497

View in Genome Browser
Species Human (GRCh38)
Location 2:69718644-69718666
Sequence GTGTATGCATGTGTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2623
Summary {0: 1, 1: 4, 2: 43, 3: 315, 4: 2260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932188497 Original CRISPR GTGTATGCATGTGTGTGCTG TGG (reversed) Intronic
Too many off-targets to display for this crispr