ID: 932191364

View in Genome Browser
Species Human (GRCh38)
Location 2:69743524-69743546
Sequence CCCTGGCAACTAAAAACCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932191364_932191374 26 Left 932191364 2:69743524-69743546 CCCTAGGTTTTTAGTTGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 932191374 2:69743573-69743595 AGTAGGAGAGGAAGTGGACAGGG 0: 1
1: 0
2: 5
3: 84
4: 664
932191364_932191373 25 Left 932191364 2:69743524-69743546 CCCTAGGTTTTTAGTTGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 932191373 2:69743572-69743594 AAGTAGGAGAGGAAGTGGACAGG 0: 1
1: 0
2: 5
3: 54
4: 537
932191364_932191369 -4 Left 932191364 2:69743524-69743546 CCCTAGGTTTTTAGTTGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 932191369 2:69743543-69743565 AGGGAATTCTCAGACACAGGTGG 0: 1
1: 0
2: 0
3: 33
4: 440
932191364_932191367 -7 Left 932191364 2:69743524-69743546 CCCTAGGTTTTTAGTTGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 932191367 2:69743540-69743562 GCCAGGGAATTCTCAGACACAGG 0: 1
1: 0
2: 0
3: 10
4: 168
932191364_932191371 14 Left 932191364 2:69743524-69743546 CCCTAGGTTTTTAGTTGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 932191371 2:69743561-69743583 GGTGGAAGAGCAAGTAGGAGAGG 0: 1
1: 0
2: 7
3: 92
4: 712
932191364_932191370 9 Left 932191364 2:69743524-69743546 CCCTAGGTTTTTAGTTGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 932191370 2:69743556-69743578 ACACAGGTGGAAGAGCAAGTAGG 0: 1
1: 0
2: 3
3: 37
4: 295
932191364_932191372 20 Left 932191364 2:69743524-69743546 CCCTAGGTTTTTAGTTGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 94
Right 932191372 2:69743567-69743589 AGAGCAAGTAGGAGAGGAAGTGG 0: 1
1: 1
2: 10
3: 216
4: 1875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932191364 Original CRISPR CCCTGGCAACTAAAAACCTA GGG (reversed) Intronic
900924518 1:5695271-5695293 CCCTGTCAAAAAAAAAGCTATGG + Intergenic
901796653 1:11683385-11683407 CCCTGTCAACTAGAAACCTGTGG + Intronic
904294343 1:29508149-29508171 CCATGACAACTAAAAAGCCATGG + Intergenic
904910388 1:33930296-33930318 CCCTGGCAACCACACAGCTAGGG + Intronic
909310750 1:74145216-74145238 CCCTGACAAGTAAAAATCCAGGG - Intronic
909706849 1:78595718-78595740 CACTGGCAACTACTAATCTATGG - Intergenic
911850522 1:102813489-102813511 ACCTGTTACCTAAAAACCTATGG - Intergenic
917651604 1:177083244-177083266 CCCAGACAACCAAAAACATATGG - Intronic
920792458 1:209106229-209106251 CCCTGGCAACTTAGCAGCTAAGG - Intergenic
1063182708 10:3619941-3619963 CACTGGAAAGTACAAACCTAGGG - Intergenic
1068284333 10:54914538-54914560 CCATGGAAACTCAAAACATATGG + Intronic
1072898827 10:99389782-99389804 CCAATGCAAATAAAAACCTAAGG - Intronic
1072992584 10:100211504-100211526 CCCTGGCAACTATGATGCTATGG + Intronic
1076546647 10:131249850-131249872 GCCTGGCAAATAAGAACCTGGGG + Intronic
1083649943 11:64196880-64196902 CCCTGACAACTAAGACCCTGAGG + Intronic
1088199118 11:107310985-107311007 CCCTGGCTATTAAAAACAAATGG + Intergenic
1094264815 12:28544790-28544812 GACTGGCAAATAAAAAGCTAAGG + Intronic
1105062263 12:133163329-133163351 CCCAGGCAAATAAAAACTTAGGG + Intronic
1105859317 13:24395176-24395198 CACAGGCAACTTAAAACCTGAGG + Intergenic
1109189143 13:59304774-59304796 GCTTGGCAACTAGAAACTTAGGG - Intergenic
1109472013 13:62820224-62820246 ACCGGGCAACTGAAAACCTAAGG - Intergenic
1113073919 13:106449509-106449531 CCCTGGAAAATAAACACCAATGG + Intergenic
1116034219 14:39608625-39608647 CCCTTGCAGCTAAAAAGCTTAGG + Intergenic
1117383710 14:55191151-55191173 CCATGGCAACTAAAAACGCCCGG - Intronic
1119609381 14:76048791-76048813 CCCTGGTAAATAAGAACCAAGGG - Intronic
1119706943 14:76788918-76788940 CCCTGGTAATTAAAAATCAAGGG + Exonic
1121270562 14:92635035-92635057 CACTGACAACAAAAAACCAAAGG - Intronic
1121658441 14:95616081-95616103 CCCTGTAAACTTAACACCTAAGG + Intergenic
1124601706 15:31138121-31138143 CCATGGCAACCAACAACCTAGGG + Intronic
1125333417 15:38604283-38604305 CCATTTCAACTAATAACCTATGG + Intergenic
1125788593 15:42344717-42344739 CCCTGCCAAGTAGAAACCTGAGG + Intronic
1128914968 15:71551643-71551665 CCCTGGGAAAAAAAAACCTCGGG - Intronic
1132531703 16:454021-454043 TCTTGGCAACTTAAAAGCTACGG - Intronic
1138652963 16:58472275-58472297 CCCTTGCAACCCACAACCTAAGG + Intronic
1143592476 17:7893949-7893971 CCCTGTCTACTAAACACCTGGGG + Intronic
1144172037 17:12667289-12667311 CACAGGCATCTAAAAACCAAGGG - Intronic
1146130130 17:30266055-30266077 TACTGGCAAATCAAAACCTAGGG - Intronic
1146152122 17:30482981-30483003 CCCTTCTAAATAAAAACCTAAGG + Intronic
1147847176 17:43412767-43412789 CCCTGGCAGCCCAAAACCTTTGG + Intergenic
1157026918 18:43855594-43855616 CCATCCCAACTAAAACCCTAGGG + Intergenic
1157720017 18:49916449-49916471 CCCTGGCTACTAAAGCCCTGTGG - Intronic
1166039731 19:40194546-40194568 CACTGGCTACAAAAAACCTGGGG - Intronic
925508314 2:4595429-4595451 CCCTTGCAACTAACCACATAGGG - Intergenic
929079672 2:38109902-38109924 CCCTGGCAGCTAAGAATGTACGG - Intronic
930788035 2:55291491-55291513 CGCTGACAGGTAAAAACCTATGG + Intronic
931832026 2:66062624-66062646 CCCTGCCCACTAAAAACCTCAGG - Intergenic
932191364 2:69743524-69743546 CCCTGGCAACTAAAAACCTAGGG - Intronic
932384879 2:71323248-71323270 CCCTGGTAACTAAAGACAAAGGG - Intronic
932991432 2:76792918-76792940 CCCTAACAACCAAAAACCCAGGG - Intronic
933204800 2:79493789-79493811 CTCTGGCAACTCAAAAGCCAAGG - Intronic
933336249 2:80963369-80963391 CCCTGGTAACTAGATAACTATGG - Intergenic
936376269 2:111943872-111943894 CCTTGGCCCCTAAAAACCCATGG + Intronic
937193418 2:120127175-120127197 CCCTCCCACCTGAAAACCTAAGG - Intronic
943129698 2:183840100-183840122 CCCTGGTAACTAAAGACAAAGGG + Intergenic
1174801423 20:53566179-53566201 CAATGGCAGCTAAAATCCTAAGG + Intergenic
1179337277 21:40469146-40469168 CCCTGGCAGCTAAAAGACAATGG + Intronic
1182778978 22:32852324-32852346 CCCTGGGAACTAAAAACATATGG - Intronic
949661576 3:6284711-6284733 CTCTGGCAACTCAAAAACCAGGG + Intergenic
950618152 3:14178716-14178738 CCGTGGCCACTAAAAAACTGCGG + Exonic
958882228 3:99685696-99685718 CTCTGGATACTAAAAGCCTATGG + Intronic
961950012 3:130739696-130739718 CCCTTGCAACTAATAACCTGTGG - Intronic
966834088 3:184036052-184036074 GCATGGCAACTGAGAACCTATGG + Exonic
972928634 4:44042616-44042638 CCCAGGCAAATAAAAGCTTAGGG + Intergenic
978259949 4:106743725-106743747 CCATTCCAACTAAAAACCGACGG - Intergenic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
982571098 4:157051530-157051552 CACTGGCAACCAGAACCCTAAGG - Intergenic
984509627 4:180663246-180663268 CACTGGCAAGAATAAACCTATGG - Intergenic
986976314 5:13398432-13398454 CCGTGGCAACCAGTAACCTATGG - Intergenic
987596561 5:20008639-20008661 TGCTGGAAACTAAAACCCTAAGG - Intronic
988917101 5:35905507-35905529 CCCTTCCCACTAAAAACATAAGG + Intronic
989277700 5:39608974-39608996 ACCTGGCCACTGAAACCCTAGGG + Intergenic
989600355 5:43194572-43194594 CCTTTTCAACTAAAAACCTAGGG - Intronic
999924653 5:156361544-156361566 CCCTGTCAACTTAAAACATTTGG + Intronic
1005770930 6:29070306-29070328 ACCTGTTACCTAAAAACCTATGG + Intronic
1007957082 6:45927878-45927900 CCCTTCCAACTAAGAACCTATGG + Intronic
1008527825 6:52424598-52424620 CCCTGAAAACCAAAAACTTATGG - Intronic
1008675954 6:53818935-53818957 CCCTGACAACTTGAAACCCAAGG - Intronic
1009798538 6:68503012-68503034 CCCTGGTAACTGAAAACAAAGGG + Intergenic
1012614488 6:101260075-101260097 CTCTGACAACTAAAAAACTCTGG - Intergenic
1018004659 6:159610542-159610564 CCATTCCAACTAAGAACCTATGG - Intergenic
1018472573 6:164109656-164109678 CCCTGGCAACCCAAAACTGAAGG - Intergenic
1018834946 6:167476000-167476022 CCCTGGCTACCAAATACCGAGGG + Intergenic
1027337097 7:77162811-77162833 CACTGGAAACTATAAAACTATGG - Intronic
1029778702 7:102708299-102708321 CACTGGAAACTATAAAACTATGG + Intergenic
1030297735 7:107945735-107945757 TCCTTGCAACAAAGAACCTATGG - Intronic
1031278596 7:119765510-119765532 TCCTGGCAACTAATATCATAAGG - Intergenic
1031996836 7:128238266-128238288 CCCTGTCCTCTTAAAACCTAAGG + Intergenic
1032287477 7:130552016-130552038 ACCTAGCAAATAAAACCCTATGG + Intronic
1034860248 7:154588618-154588640 CCCTGGAAACCAAATACCTATGG + Intronic
1036716658 8:11131201-11131223 GCCTGGGAACTATAAAGCTATGG - Intronic
1037475646 8:19254418-19254440 CACTAGAAACTAAAAACTTATGG + Intergenic
1038451846 8:27644506-27644528 TGCTGGGACCTAAAAACCTATGG - Intronic
1039708695 8:40033725-40033747 CACTGGCAAATAAATACCAATGG - Intergenic
1041626166 8:60029757-60029779 CCTTTGCAACTGAAAAACTATGG + Intergenic
1042778275 8:72460191-72460213 GCCTGGCAAAGAAAAACCTCAGG - Intergenic
1044931143 8:97252767-97252789 CCATGGAAGCTAGAAACCTATGG + Intergenic
1046907351 8:119587912-119587934 CCCTGGCATCTAAATACCAGTGG + Intronic
1049555806 8:143281429-143281451 GCCTGGGAACTAAACCCCTAAGG + Intergenic
1051442157 9:17096755-17096777 GCCTGACAAATAAAAACATAGGG - Intergenic
1051632824 9:19156134-19156156 CTTTTGCAAATAAAAACCTATGG + Intergenic
1052189206 9:25637675-25637697 GCCTGGAAATTATAAACCTAAGG + Intergenic
1188067999 X:25685322-25685344 ACCTGGCAAATAAAAAAGTAGGG - Intergenic
1189174767 X:38944966-38944988 CCCTGTTCCCTAAAAACCTATGG - Intergenic
1190404854 X:50076836-50076858 CCTTGGCATCAAAAAACATATGG - Intronic
1194894503 X:99423635-99423657 GCTTGGAAGCTAAAAACCTAAGG - Intergenic
1196490768 X:116263126-116263148 CCCTGGCAGGAACAAACCTATGG - Intergenic