ID: 932194379

View in Genome Browser
Species Human (GRCh38)
Location 2:69770484-69770506
Sequence GAATGTGCCACAAGGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932194375_932194379 1 Left 932194375 2:69770460-69770482 CCAGCGAAGGGAAGGATTCAGTA 0: 1
1: 0
2: 0
3: 11
4: 160
Right 932194379 2:69770484-69770506 GAATGTGCCACAAGGCTGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932194379 Original CRISPR GAATGTGCCACAAGGCTGGC AGG Intronic
900018402 1:170413-170435 CAATGTCCCACCAGGTTGGCAGG + Intergenic
900048658 1:529008-529030 CAATGTCCCACCAGGTTGGCAGG + Intergenic
900070887 1:770832-770854 CAATGTCCCACCAGGTTGGCAGG + Intergenic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900484663 1:2916543-2916565 GAATGTGTCTGAAGGCTGGAGGG - Intergenic
906966404 1:50461306-50461328 GTATGTGCCTCAAGTCTGCCAGG + Intronic
911021760 1:93396479-93396501 GAAAGTTCCCCAAGGCTGGTGGG + Intergenic
912545596 1:110448930-110448952 CCATGTCCCACAAGGCAGGCTGG + Intergenic
913432448 1:118810037-118810059 GAGGGTTCCACAAGGCTGTCTGG + Intergenic
914791257 1:150879190-150879212 GACAGTGCAACAAAGCTGGCTGG + Intergenic
918181877 1:182091269-182091291 GAAAGTGGAACCAGGCTGGCTGG - Intergenic
921694360 1:218190627-218190649 GATTTTGCCACAAGGATGGATGG + Intergenic
922106253 1:222516278-222516300 CAATGTCCCACCAGGTTGGCAGG + Intergenic
923788412 1:237090458-237090480 GAAGGTGCCACATTGCTGGAAGG + Intronic
924348433 1:243093843-243093865 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1066727927 10:38411058-38411080 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1069001764 10:63274725-63274747 GAATGTGCTACAATGTTTGCTGG - Intronic
1070761839 10:79028771-79028793 GAATGTTCCAGAAGACTGCCTGG - Intergenic
1073382746 10:103092559-103092581 TAATGCGCATCAAGGCTGGCTGG + Intronic
1073437272 10:103526788-103526810 GCATGAGCCACCACGCTGGCTGG + Intronic
1074832918 10:117262475-117262497 GTATGAGCAACAAGGCTGGAGGG - Intronic
1076529520 10:131135304-131135326 GAAGGTGGCCCAAGGCTGGATGG - Intronic
1076647767 10:131965175-131965197 GAGGGGGCCACATGGCTGGCAGG + Intergenic
1076709747 10:132325999-132326021 GCATGAGCCACCACGCTGGCCGG + Intronic
1076745825 10:132513028-132513050 GAATTTACCAGAAGGCTGGCTGG - Intergenic
1076975005 11:165609-165631 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1077195215 11:1276429-1276451 GAGTCTGTCACAAGGCTGGCTGG + Exonic
1079051834 11:17167473-17167495 GCATGTGCCACTACACTGGCTGG - Intronic
1080025658 11:27611514-27611536 GAATGTGACACAAGACTGGGAGG - Intergenic
1083485485 11:62980941-62980963 GACTGAGACAAAAGGCTGGCTGG - Intronic
1084914500 11:72418236-72418258 GTAAGTCACACAAGGCTGGCTGG - Intronic
1088588805 11:111383467-111383489 GCATGAGCCACCATGCTGGCTGG - Intronic
1091154093 11:133357823-133357845 GAATGTGCTAGTAGCCTGGCAGG - Intronic
1095637965 12:44454324-44454346 GAATGGGCCATGAGGCTGGAAGG - Intergenic
1096402019 12:51315132-51315154 GCATGAGCCATTAGGCTGGCTGG + Intronic
1096406598 12:51348416-51348438 GAGTGTGCCAGAATGCTGGAGGG - Intergenic
1098320335 12:69237631-69237653 GCATGAGCCACCATGCTGGCTGG + Intergenic
1099457580 12:82882651-82882673 GTAAGTGCCACAATGCTGTCTGG + Intronic
1099799535 12:87440338-87440360 GTATGAGTCACAAGTCTGGCTGG - Intergenic
1101855477 12:108439297-108439319 CAGTGTGCAACAATGCTGGCTGG + Intergenic
1101900608 12:108788907-108788929 GAAGGTTCCAAAAGGCTGGCTGG + Exonic
1103583696 12:121935636-121935658 GAGTGTGTCAAAAGGCTGGTAGG - Intronic
1105547565 13:21361983-21362005 GACTGTGCCCCAGGGATGGCTGG - Intergenic
1109863294 13:68227761-68227783 GAATGTGCCACTATGCAGGCTGG + Intergenic
1111988174 13:95086730-95086752 GAATGAGCCAGAAGGATGGATGG - Intronic
1113834098 13:113317517-113317539 GAATGTGCCACATGGATCACAGG + Intronic
1114683413 14:24506181-24506203 GAATGTGCCGGGTGGCTGGCTGG - Exonic
1115144698 14:30212820-30212842 GAATGAGGCAGAAGGTTGGCTGG + Intergenic
1117491022 14:56248513-56248535 GAAGGAGCCTCCAGGCTGGCAGG + Intronic
1122989363 14:105229755-105229777 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989462 14:105230163-105230185 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989486 14:105230265-105230287 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989810 14:105231591-105231613 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989908 14:105231999-105232021 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122989932 14:105232101-105232123 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989956 14:105232203-105232225 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122989980 14:105232305-105232327 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990028 14:105232509-105232531 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990052 14:105232611-105232633 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990075 14:105232713-105232735 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990099 14:105232815-105232837 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990122 14:105232917-105232939 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990145 14:105233019-105233041 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990169 14:105233121-105233143 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990268 14:105233529-105233551 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990292 14:105233631-105233653 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990391 14:105234039-105234061 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990440 14:105234243-105234265 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990463 14:105234345-105234367 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990536 14:105234651-105234673 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990560 14:105234753-105234775 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990583 14:105234855-105234877 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990607 14:105234957-105234979 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990631 14:105235059-105235081 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990655 14:105235161-105235183 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990679 14:105235263-105235285 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990702 14:105235365-105235387 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990726 14:105235467-105235489 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990750 14:105235569-105235591 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990773 14:105235671-105235693 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990797 14:105235773-105235795 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990821 14:105235875-105235897 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990845 14:105235977-105235999 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990868 14:105236079-105236101 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990941 14:105236385-105236407 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122990965 14:105236487-105236509 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122990988 14:105236589-105236611 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991012 14:105236691-105236713 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991037 14:105236793-105236815 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991061 14:105236894-105236916 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991085 14:105236996-105237018 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991109 14:105237098-105237120 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991133 14:105237200-105237222 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991181 14:105237404-105237426 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991204 14:105237506-105237528 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991228 14:105237608-105237630 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991252 14:105237710-105237732 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991275 14:105237812-105237834 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991299 14:105237914-105237936 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991323 14:105238016-105238038 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991372 14:105238220-105238242 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991396 14:105238322-105238344 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991420 14:105238424-105238446 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991444 14:105238526-105238548 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991468 14:105238628-105238650 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991492 14:105238730-105238752 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991516 14:105238832-105238854 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991540 14:105238934-105238956 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991589 14:105239138-105239160 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991613 14:105239240-105239262 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991661 14:105239444-105239466 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991684 14:105239546-105239568 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991708 14:105239648-105239670 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991732 14:105239750-105239772 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991756 14:105239852-105239874 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991780 14:105239954-105239976 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991804 14:105240056-105240078 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991828 14:105240158-105240180 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991852 14:105240260-105240282 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991875 14:105240362-105240384 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991899 14:105240464-105240486 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991923 14:105240566-105240588 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991946 14:105240668-105240690 GAGGGTGCCACAGGGCTGTCAGG - Intronic
1122991970 14:105240770-105240792 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1122991994 14:105240872-105240894 GAGGGTGCCACAGGGCTGCCAGG - Intronic
1129205548 15:74035290-74035312 GTATGTGCCACAGGGCAGGCTGG - Intronic
1134221844 16:12361063-12361085 TAATGTGCAACACGGGTGGCAGG - Intronic
1134320528 16:13158628-13158650 GCCTGTGCCACAAGGGAGGCTGG + Intronic
1136041099 16:27579581-27579603 GAATCAGCCTCAAGTCTGGCTGG - Intronic
1140724602 16:77800691-77800713 AAATGTGCCACAGCGCAGGCAGG - Intronic
1141472322 16:84247422-84247444 GGAAGTGACACAAGGCAGGCTGG + Intergenic
1142136579 16:88454362-88454384 GGAGGTGTCACCAGGCTGGCGGG - Intronic
1142445258 16:90132050-90132072 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1142462251 17:103416-103438 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1142573241 17:889137-889159 GTAAGTGCCACATAGCTGGCAGG - Intronic
1142768920 17:2082621-2082643 GAATGTGCCACCAGCCTGGCAGG - Intronic
1143761669 17:9108721-9108743 GAAGGTGTCCCAAGGCTGGCTGG + Intronic
1143835634 17:9690090-9690112 GCATCGGCCACAAGGCTGGTGGG - Intronic
1147059585 17:37864586-37864608 GAATGTGCCAGAATGCTGAGAGG - Intergenic
1147212552 17:38880354-38880376 GAAGCTGCCACAAGGTTGGGTGG + Intronic
1147973895 17:44236782-44236804 GGATGTGACCCAGGGCTGGCAGG - Intergenic
1148070038 17:44903433-44903455 GACTTTTCCACCAGGCTGGCAGG + Exonic
1148227197 17:45907177-45907199 GAAGGAGCCACAGGGCAGGCTGG - Intronic
1152290136 17:79435667-79435689 GAATGGGGCACAGGGCTGGAGGG - Intronic
1152893025 17:82893149-82893171 CAAAGTGCCACAAAGCTGGCAGG - Intronic
1154336631 18:13471172-13471194 GATTGGGCCCCAAGGCTGCCTGG + Intronic
1157674447 18:49558727-49558749 ACAAGTGCCAGAAGGCTGGCTGG - Intergenic
1158206195 18:54995832-54995854 TAATGTGCCAAAAGGATGACGGG + Intergenic
1158696704 18:59710045-59710067 GAGTGAGCCACTGGGCTGGCTGG - Intergenic
1160159622 18:76461369-76461391 GCATGTGCCACAGGGCTCGGAGG - Intronic
1160651957 19:235792-235814 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1160946175 19:1645022-1645044 GAAGTGGCCACAGGGCTGGCCGG - Intronic
1162486695 19:10964915-10964937 GAAAGTTCCACCAGACTGGCTGG - Intronic
1163013312 19:14439055-14439077 GGAGGTGCCACTGGGCTGGCTGG + Intronic
1163732677 19:18958950-18958972 GAGTAGGCTACAAGGCTGGCAGG + Intergenic
1165247430 19:34505385-34505407 GCATGTGTCACAGGGCTGCCAGG + Exonic
1165381826 19:35487246-35487268 GAATGAGCCCCAAGGCTGATAGG - Intergenic
1166948394 19:46411313-46411335 GAGTGTGCCAGAAGGCTCTCCGG + Exonic
927493701 2:23537868-23537890 GAATGTGTCCAAAGGGTGGCAGG + Intronic
927778620 2:25921587-25921609 GCATGAGCCACACGCCTGGCTGG - Intergenic
927908755 2:26881359-26881381 CACTGTGCCACAGGGGTGGCAGG - Intronic
931184650 2:59938249-59938271 GACTGTGCTACATGCCTGGCTGG - Intergenic
932194379 2:69770484-69770506 GAATGTGCCACAAGGCTGGCAGG + Intronic
933506248 2:83180845-83180867 GCATGTGCCACCAGGCTGAGAGG + Intergenic
934077741 2:88442229-88442251 GAATGTGCCTGGAGGCTGGAAGG + Intergenic
935590641 2:104843627-104843649 GAATGTACCAGAAGTCTCGCTGG + Intergenic
938551533 2:132386753-132386775 GGATGTGCCAGGAGGCAGGCAGG + Intergenic
938711192 2:133977547-133977569 AGTTGTGCCACAAGGCTGACTGG - Intergenic
940772208 2:157851455-157851477 GTATGAGCAACAAGGCAGGCAGG + Intronic
943066369 2:183090872-183090894 GAATGTGCCAAGAGGCCTGCTGG - Intronic
944065352 2:195614119-195614141 CAATTTTCCAGAAGGCTGGCTGG + Intronic
946299472 2:218813899-218813921 GAATTTGCCACTAGCCTAGCAGG - Intronic
1172838578 20:37888424-37888446 GAAGGTGGCACCAGGCTGGGAGG - Intergenic
1173284830 20:41660857-41660879 GAATGAGCCACATGGCTATCTGG - Intergenic
1175312338 20:58020454-58020476 GAAGGGGACACATGGCTGGCTGG - Intergenic
1175565896 20:59976805-59976827 GAATGAGCCACAAGTCTGCAGGG + Intronic
1175674829 20:60937628-60937650 CTATTTGTCACAAGGCTGGCTGG - Intergenic
1176069151 20:63217001-63217023 GAGTTAGCCACAAGGGTGGCAGG - Intergenic
1176132357 20:63501738-63501760 GTAGGCCCCACAAGGCTGGCTGG + Intergenic
1179073474 21:38094997-38095019 GAAGGGGCCTCAAGGCTGCCGGG - Intronic
1180018112 21:45100821-45100843 GAATGGGCCACAGGGCCAGCGGG + Intronic
1184325235 22:43778124-43778146 CACTGTGCCACAGGGCTGGAAGG - Intronic
955773054 3:62405389-62405411 GCATGTTGCACAAGGCTTGCTGG - Intronic
957281376 3:78155054-78155076 GAATTTGCCACAATCCAGGCTGG - Intergenic
958999679 3:100948629-100948651 AAATGTGCCACCAGCCTGGGAGG - Intronic
960331760 3:116368301-116368323 GCATTTGCCACAAGTCAGGCAGG + Intronic
960998159 3:123352927-123352949 GAAGGTGCCACAAGGGTGCTGGG + Intronic
964477224 3:157107910-157107932 GAATATGCCACATTGCTTGCTGG - Intergenic
965687381 3:171318882-171318904 GTATGAGCCACCATGCTGGCCGG - Intronic
965887354 3:173463425-173463447 GAATGTACCACAAGGTCAGCGGG - Intronic
968365873 3:198184180-198184202 CAATGTCCCACCAGGTTGGCAGG - Intergenic
971409451 4:26354728-26354750 GCATGAGCCACATGCCTGGCCGG + Intronic
974839271 4:67282798-67282820 GCATGTGGCACAGGACTGGCAGG - Intergenic
975262495 4:72320088-72320110 GAATGTGACACAATGCTAGTAGG - Intronic
977766495 4:100805037-100805059 GGATGTGCCAGAAGGCAGGGGGG + Intronic
979212332 4:118120272-118120294 GAGTGTGCCACAAGGATGCAGGG + Intronic
979254911 4:118599338-118599360 CAATGTCCCACCAGGTTGGCAGG - Intergenic
979334057 4:119446681-119446703 CAATGTCCCACCAGGTTGGCAGG + Intergenic
980980796 4:139653171-139653193 GCATGCCCCACAACGCTGGCAGG - Intergenic
981229070 4:142331891-142331913 GAATGTACCACAAAGCTGGGGGG + Intronic
981550859 4:145939031-145939053 GAAAGTGCCCCAAGGCTCCCAGG + Intergenic
982130580 4:152225298-152225320 GAATGTCAGAGAAGGCTGGCAGG + Intergenic
982370180 4:154625673-154625695 GAATGATCCACCAGGCTGTCGGG + Intergenic
984805279 4:183746423-183746445 GCATGTGGCACAGGACTGGCGGG - Intergenic
985840144 5:2299934-2299956 GAGGCTGCCACAATGCTGGCTGG + Intergenic
986447257 5:7832215-7832237 GAATTTGCTAGAAGGCTGGCTGG + Intronic
987977161 5:25029134-25029156 GCATGTGCTAGAAAGCTGGCTGG - Intergenic
988991641 5:36677257-36677279 GAAGGTGCCACGAGGCAGGATGG + Intronic
993229240 5:85210680-85210702 GTATGTCCGACAAGCCTGGCAGG - Intergenic
993960131 5:94287822-94287844 GGCTGTGTCACAAGGCTGGCTGG + Intronic
995283559 5:110361661-110361683 GCATGAGTCACAAGGCAGGCAGG - Intronic
996111520 5:119571520-119571542 CAAGGGGCCACAAGTCTGGCAGG + Intronic
997838261 5:137214510-137214532 CAATGTGCCACAAGTCTGCTTGG - Intronic
1002725099 5:181289404-181289426 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1008022741 6:46599613-46599635 GAATGTACCCCAAGACTGCCAGG + Intronic
1010852126 6:80790213-80790235 GAATGTCCAACAAGTTTGGCAGG + Intergenic
1013510534 6:110840585-110840607 GAATGTTCCTGAAGGGTGGCAGG - Intronic
1018481358 6:164194407-164194429 GAATGTGCCGTAAGGGGGGCAGG - Intergenic
1022235283 7:28454841-28454863 GAATGTGACCCAGGGCTGGTGGG + Intronic
1024069999 7:45777015-45777037 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1025742990 7:64215796-64215818 TAATCTGCCACAAGGTTGCCAGG - Intronic
1025990315 7:66492425-66492447 CAATGTCCCACCAGGTTGGCAGG + Intergenic
1026038434 7:66846169-66846191 CAATGTGCCACCAGGTTGGCAGG - Intergenic
1026672042 7:72399187-72399209 CAATGGGCTGCAAGGCTGGCTGG + Intronic
1026888427 7:73968051-73968073 ACATGAGCCACAAGGCAGGCAGG - Intergenic
1027960453 7:84939755-84939777 CCCTGTGCCAGAAGGCTGGCTGG - Intergenic
1029188896 7:98758304-98758326 GAATGAGCCACATGGGTGTCTGG + Intergenic
1029206687 7:98873477-98873499 GAATTAGCCAAAGGGCTGGCCGG - Intergenic
1032047397 7:128621303-128621325 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1034398556 7:150846388-150846410 GAGTGGGCCACAAGGATGCCTGG - Intronic
1035083038 7:156233421-156233443 GGATGTGCCCCACCGCTGGCAGG + Intergenic
1037607568 8:20450347-20450369 GAGTGAGGCAAAAGGCTGGCTGG + Intergenic
1039547716 8:38421662-38421684 GGATGTGGCACCAGGCAGGCAGG + Intronic
1044713124 8:95075947-95075969 GAATCTCCCAGAAGGCTGGTGGG + Intronic
1049008793 8:139873877-139873899 GAATGTGGCACCATGGTGGCTGG - Intronic
1049657349 8:143804692-143804714 GAATGTGGCAGAGGGCTGGGAGG + Exonic
1050105140 9:2157656-2157678 GACTGTGCCACATGGCTTGGTGG + Intronic
1053412673 9:37925745-37925767 GAATGTGGCACAAAGCTGTTGGG + Intronic
1056165564 9:83937479-83937501 GGAAGTGCCAGAAGGGTGGCAGG + Intergenic
1057887007 9:98837420-98837442 AACTGTGCCCCAAGTCTGGCAGG - Intronic
1059311238 9:113390371-113390393 GAATGCAGCACAGGGCTGGCAGG - Intronic
1062163213 9:135091202-135091224 GAATGTGCCAAAAGGCTGGTGGG - Intronic
1062503000 9:136859235-136859257 CAATGGGCCCCAGGGCTGGCTGG - Exonic
1062750243 9:138247047-138247069 CAATGTCCCACCAGGTTGGCAGG - Intergenic
1188956488 X:36440270-36440292 GATTGTTTCACAAGGCTGCCAGG - Intergenic
1190061956 X:47217501-47217523 GGATGTGCCAGAAGGCCTGCTGG + Intergenic
1190128010 X:47723098-47723120 GACTGTGGCATGAGGCTGGCAGG + Intergenic
1193149347 X:78108368-78108390 GAATGTACTTTAAGGCTGGCAGG + Intronic
1193549338 X:82871465-82871487 GAAGGTGCCACAATCCAGGCTGG + Intergenic