ID: 932194404

View in Genome Browser
Species Human (GRCh38)
Location 2:69770597-69770619
Sequence AAGGAGAGCTTCAGTTACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932194399_932194404 0 Left 932194399 2:69770574-69770596 CCGCCAAGTTGTGGTGGGGTCTG 0: 1
1: 0
2: 0
3: 15
4: 150
Right 932194404 2:69770597-69770619 AAGGAGAGCTTCAGTTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 82
932194400_932194404 -3 Left 932194400 2:69770577-69770599 CCAAGTTGTGGTGGGGTCTGAAG 0: 1
1: 0
2: 1
3: 6
4: 150
Right 932194404 2:69770597-69770619 AAGGAGAGCTTCAGTTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 82
932194394_932194404 12 Left 932194394 2:69770562-69770584 CCTGAATGGAGGCCGCCAAGTTG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 932194404 2:69770597-69770619 AAGGAGAGCTTCAGTTACCGGGG 0: 1
1: 0
2: 1
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932194404 Original CRISPR AAGGAGAGCTTCAGTTACCG GGG Intronic
911364053 1:96915465-96915487 AATGAGAGTTTCAGTTCCCATGG - Intergenic
912924798 1:113904752-113904774 AAGGAGCCCTCGAGTTACCGTGG - Exonic
1068196830 10:53727935-53727957 AAGCAGAGCTTCAGATGCCTTGG + Intergenic
1068490301 10:57714762-57714784 AAGGAAAGCTTCCCTTACAGGGG - Intergenic
1070080626 10:73182893-73182915 GAGGAGTGCTTCAGTTACTCTGG - Intronic
1071450365 10:85787507-85787529 AAGCAGAGCTCCAGTTCCTGTGG - Intronic
1073465673 10:103693314-103693336 AAGGTGAGCCCCAGTTAGCGGGG - Intronic
1073961829 10:108940124-108940146 AAGAAGAGCTTCAGTTACGGGGG + Intergenic
1075222451 10:120596896-120596918 AAAGAGAGCTTCAGTGAAAGGGG + Intergenic
1079310840 11:19364374-19364396 AAGGAGAGCTTCCTTTCCTGGGG - Intronic
1079604823 11:22352115-22352137 AAGCAGAGCTTCAGAGACAGTGG + Intronic
1081656510 11:44861225-44861247 AAGGAGAGCTTCTTTTTCCCAGG + Intronic
1082765907 11:57167515-57167537 ACGGAGAGCTGCAGTGTCCGAGG - Intergenic
1092101070 12:5884284-5884306 AAGGGCAGCTTCAGTTTCAGAGG + Intronic
1094460907 12:30695905-30695927 AAGCAGAGCTTCCTTTACGGCGG + Exonic
1096558421 12:52418518-52418540 TGGGAGAGCTTCAGTTCCCAAGG + Intergenic
1096776539 12:53967705-53967727 AAGGGGAGCTCCAGTTAGTGAGG + Intergenic
1098409391 12:70164377-70164399 AAGAAGAGGCTCAGTTACAGTGG + Intergenic
1100403243 12:94250464-94250486 ATGGAGAGCTTCAGCTATCCGGG + Intronic
1104017161 12:124968975-124968997 AAGGACAGGCTCAGTGACCGTGG + Intronic
1105728814 13:23191376-23191398 AAGGAGAACTTCAGTTGTCAAGG + Intronic
1106441617 13:29778569-29778591 AAGGAGAGCTTGGGTAACCTGGG - Intronic
1115946218 14:38664207-38664229 AAGGAGGGCTTCAGTTTTCCAGG + Intergenic
1117211218 14:53502360-53502382 ATGAAGTGCTTCAGTTACAGGGG - Intergenic
1118308189 14:64673614-64673636 AGAGAGAGCTTCAGTTCCCTGGG + Intergenic
1126447338 15:48763303-48763325 TAGGAGAACTTCAGATACCCAGG - Intronic
1126883183 15:53121193-53121215 AAAGAGATCTTCAGTTAAGGAGG - Intergenic
1133230731 16:4365355-4365377 TAGGAGAGCTACAGTCACCTTGG + Intronic
1134517090 16:14895984-14896006 AAGGAGAGTTCCAGTTGACGTGG + Exonic
1137729796 16:50681048-50681070 AAGGAGAGCTCCAGACACAGTGG + Intronic
1147391318 17:40111168-40111190 AAGGAGGGATTCAGTTGCCAGGG - Intergenic
1153450271 18:5219391-5219413 AAGAAGAGCTTCTGTTACCCTGG + Intergenic
1157752755 18:50194049-50194071 AAAGAGGGCTTCAGTGACTGCGG - Intronic
1158505397 18:58043070-58043092 AAGGAGAGCTTAAGGTAGCATGG + Intergenic
1158970509 18:62662319-62662341 CTGGAGAGCTGCAGTTACTGTGG - Intergenic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1166264151 19:41666809-41666831 AAGGAGAGCATCACACACCGGGG - Intronic
926223749 2:10953162-10953184 AAGGAGAGCTTCAGATTTCCTGG - Intergenic
926524915 2:13968205-13968227 AAGTGGAGCTTCAGTGACCTGGG - Intergenic
928071009 2:28216780-28216802 AAGGAGAGGGTAAGTTACTGGGG - Intronic
929900113 2:45993309-45993331 AAGGGGAGCTCCAGTTACTCTGG - Intronic
930176999 2:48311763-48311785 AAGAAGAGCTTCAGGTACAGTGG - Intergenic
932134216 2:69214249-69214271 AAGGAGAGAAACAGTTACAGAGG - Intronic
932194404 2:69770597-69770619 AAGGAGAGCTTCAGTTACCGGGG + Intronic
933470336 2:82714993-82715015 AAGGAGAGCATCACACACCGGGG + Intergenic
939261430 2:139815393-139815415 AAGGAGTGCCTCAGTTGCTGAGG + Intergenic
942006853 2:171711039-171711061 AAGGAGAACATCACATACCGGGG - Intronic
942717061 2:178905029-178905051 AAGTAGAGCTTTAGTTCCCAAGG - Intronic
942949772 2:181709152-181709174 AAACAGAGCTTCAGTAACAGGGG - Intergenic
1170824974 20:19785755-19785777 AAGGAGAGCTTCATTCTCCTTGG + Intergenic
1175201756 20:57282939-57282961 GAAGAGAGCTCCAGTTACCAGGG + Intergenic
1178385151 21:32143036-32143058 AAAGACTGCTTGAGTTACCGTGG - Intergenic
1179768394 21:43593140-43593162 GACTAGAGCTTCAGTTACAGTGG + Intronic
951454374 3:22873974-22873996 AAGGGGAGCTTCTGTTGCAGAGG + Intergenic
955836490 3:63061209-63061231 AAGCAGAGCTTCAGGTTTCGGGG + Intergenic
957408213 3:79800020-79800042 AAGGAGAGCTTCAGATAAAAGGG + Intergenic
958089224 3:88854641-88854663 AAGGAGAACATCACATACCGGGG - Intergenic
958444831 3:94202771-94202793 CAAGAGAGCATCAGTTACAGTGG + Intergenic
968150394 3:196333525-196333547 AAGCAAAGCTTCAGTTAAGGGGG + Intronic
969640142 4:8392932-8392954 GAGCAGACCATCAGTTACCGAGG - Intronic
970682065 4:18520754-18520776 AAGCAGAGCAGCAGTTACCAGGG - Intergenic
974384124 4:61183088-61183110 AAGAAGTGCTTCAGTTCCAGAGG + Intergenic
977848084 4:101790525-101790547 AAGGAGAGCTACAATAACAGCGG + Intronic
985896328 5:2751690-2751712 AAGGAGCGCTCGAGTTTCCGAGG + Intergenic
986517666 5:8581011-8581033 AAGGAGAGGGGCAGGTACCGGGG - Intergenic
993689770 5:90985631-90985653 AAGCAGAGCTTCAGACACTGTGG - Intronic
996796677 5:127355189-127355211 AAGGAGAGCTTCAGGAAAGGAGG + Intronic
1005039586 6:21588830-21588852 AAGGAGAGGTTCGGCTGCCGCGG + Intergenic
1005203861 6:23378602-23378624 AGGGAGAGCTGCATTTACCAAGG - Intergenic
1005800473 6:29417293-29417315 AAGGAGAAATTCAGTGACTGAGG - Intronic
1006177156 6:32129244-32129266 AAGCAGAGCTTCAGCTGCCTGGG - Exonic
1008576703 6:52867479-52867501 AAGGAGAACATCACTCACCGGGG + Intronic
1031030780 7:116732316-116732338 CAGGAGAGCTTGAGTTACAATGG - Intronic
1031441748 7:121803178-121803200 AAGGAGTGCTTCAGTAACCTTGG + Intergenic
1037316518 8:17604555-17604577 AAGGGGAACTTCACATACCGGGG + Intronic
1037724764 8:21473981-21474003 AAGGTGAACTTCAGTTATCTGGG - Intergenic
1042863685 8:73338078-73338100 AAGGTGAGGTTCAGTTGCCTAGG - Intergenic
1043492316 8:80762005-80762027 AAGGACATCTTCATTTACTGAGG + Intronic
1047962024 8:130017463-130017485 AAGGAGAGTATCAGTTTCCTAGG - Intergenic
1048003493 8:130399513-130399535 AAGTAAAGCTTCATTTACCCTGG + Intronic
1051813522 9:21077296-21077318 TAGGAGATCTTCAGTTTCGGAGG + Exonic
1058624137 9:106916613-106916635 AAGAAGAGCTGCAGTTTCCAAGG + Intronic
1059658593 9:116379039-116379061 AAAGAAAGCTTGAGTTACCTGGG + Intronic
1060220123 9:121760122-121760144 AAGGAGCGCAACAGTTACCTGGG + Exonic
1186307657 X:8280976-8280998 AAGGAGAGCTTCATGTCCCATGG + Intergenic
1196135129 X:112200607-112200629 AAGGACAGGTTCAGGTACTGGGG + Intergenic
1201865421 Y:18647991-18648013 AAGGGGAACTTCACATACCGGGG + Intergenic