ID: 932195534

View in Genome Browser
Species Human (GRCh38)
Location 2:69779929-69779951
Sequence CCAGGTAATAGGGGGTAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932195525_932195534 -9 Left 932195525 2:69779915-69779937 CCTTAGTTGAACCCCCAGGTAAT 0: 1
1: 0
2: 0
3: 11
4: 71
Right 932195534 2:69779929-69779951 CCAGGTAATAGGGGGTAAGTCGG 0: 1
1: 0
2: 1
3: 8
4: 106
932195524_932195534 -8 Left 932195524 2:69779914-69779936 CCCTTAGTTGAACCCCCAGGTAA 0: 1
1: 0
2: 0
3: 9
4: 50
Right 932195534 2:69779929-69779951 CCAGGTAATAGGGGGTAAGTCGG 0: 1
1: 0
2: 1
3: 8
4: 106
932195520_932195534 12 Left 932195520 2:69779894-69779916 CCCAGGACTAGTTGGTTCTCCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 932195534 2:69779929-69779951 CCAGGTAATAGGGGGTAAGTCGG 0: 1
1: 0
2: 1
3: 8
4: 106
932195523_932195534 -7 Left 932195523 2:69779913-69779935 CCCCTTAGTTGAACCCCCAGGTA 0: 1
1: 0
2: 1
3: 6
4: 72
Right 932195534 2:69779929-69779951 CCAGGTAATAGGGGGTAAGTCGG 0: 1
1: 0
2: 1
3: 8
4: 106
932195517_932195534 30 Left 932195517 2:69779876-69779898 CCTTTGCTCAGGGTGTGTCCCAG 0: 1
1: 0
2: 3
3: 21
4: 236
Right 932195534 2:69779929-69779951 CCAGGTAATAGGGGGTAAGTCGG 0: 1
1: 0
2: 1
3: 8
4: 106
932195521_932195534 11 Left 932195521 2:69779895-69779917 CCAGGACTAGTTGGTTCTCCCCT 0: 1
1: 0
2: 0
3: 10
4: 92
Right 932195534 2:69779929-69779951 CCAGGTAATAGGGGGTAAGTCGG 0: 1
1: 0
2: 1
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932195534 Original CRISPR CCAGGTAATAGGGGGTAAGT CGG Intronic
900265519 1:1755365-1755387 TCAGGTGATAGAGGGTGAGTTGG - Exonic
902553588 1:17233733-17233755 CCAGGGCTTGGGGGGTAAGTGGG - Intronic
903934515 1:26885954-26885976 CCAGGTACTAGGGGCTAAGACGG - Exonic
906753964 1:48291495-48291517 CCAGGGAAGTGGGGGAAAGTCGG + Intergenic
909030140 1:70529704-70529726 CCAGGTAAACGGGGATGAGTTGG + Intergenic
910321594 1:85951519-85951541 CCAGATCATAGGGAGTAAGTTGG + Intronic
912083029 1:105961772-105961794 CCAGTTAATATGAGGTTAGTAGG + Intergenic
913089927 1:115469784-115469806 CCAGGGGATAGAGGGTAAGGTGG - Intergenic
913117052 1:115706980-115707002 CCAGGTAATAAGGCCTAAGGGGG - Intronic
917615782 1:176742812-176742834 TCAGGTCATAAGGGGTAAGAAGG - Intronic
919070533 1:192749816-192749838 ACAGGTAATAGGGAGTAAATTGG + Intergenic
922721401 1:227901923-227901945 CCAGGTAGTAGGGAGAAGGTGGG + Intergenic
1063126866 10:3143370-3143392 CCAGGTAGGAGGGTGTAGGTCGG - Exonic
1067061686 10:43081072-43081094 CCAGGGAATAGGGGCAAAGCAGG + Intronic
1068132391 10:52911026-52911048 CTAGGTGAAAGGGGGTAAGGGGG - Intergenic
1068808518 10:61228085-61228107 CCAGGGAATTGGGGGAAAGTCGG - Intergenic
1069717989 10:70532923-70532945 CCCGGGAATAGGGGGTGAGGGGG + Intronic
1070483832 10:76911005-76911027 GCAAGTAATAGGGGAAAAGTCGG + Intronic
1071044929 10:81361941-81361963 CCAGCTACTAGGGGGTAGGGCGG - Intergenic
1071131391 10:82397710-82397732 CCAGGAAATATGTGGTAAGGAGG + Intronic
1072791642 10:98322161-98322183 CCAGGTTATTGGGGGTGAGGTGG + Intergenic
1084570845 11:69958970-69958992 CCAGCTAAATGGGTGTAAGTGGG + Intergenic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1088954137 11:114603200-114603222 CCAGGTAATAGGAGTTACCTAGG - Intergenic
1088954151 11:114603294-114603316 CCAGGTAATAGGTGTTACCTAGG - Intergenic
1088954165 11:114603388-114603410 CCAGGTAATAGGTGTTACCTAGG - Intergenic
1088954179 11:114603482-114603504 CCAGGTAATAGGAGTTACCTAGG - Intergenic
1088954193 11:114603576-114603598 CCAGGTAATAGGAGTTACCTAGG - Intergenic
1088954200 11:114603623-114603645 CCAGGTAATAGGAGTTACCTAGG - Intergenic
1089451885 11:118604604-118604626 CAAGGGAATTGGGGGTAAGGGGG - Intergenic
1104076383 12:125393530-125393552 CCAGATAATTGGGGGTAAAAGGG + Intronic
1105985275 13:25560302-25560324 CCAGGGAATAGGGAGTGAGTGGG - Intronic
1108025785 13:46175891-46175913 CTAGGTAATAGGTGCAAAGTGGG - Intronic
1110366641 13:74694216-74694238 CCAAGTAGTAGGTGGTAAGCTGG - Intergenic
1110656920 13:78011428-78011450 ACAGGTAATATGGCTTAAGTGGG - Intergenic
1114329025 14:21617630-21617652 CCAGGGAAGTGGGGGAAAGTCGG + Intergenic
1114548565 14:23520492-23520514 CCAGGAAGAAGGGGGTGAGTGGG - Intergenic
1116314278 14:43367464-43367486 CCAGGTGCTAGGGAATAAGTGGG + Intergenic
1125693498 15:41616042-41616064 CCACTTACTAGGGAGTAAGTGGG - Intergenic
1126496089 15:49292183-49292205 CCAAGTAATGGTGGGAAAGTTGG + Intronic
1146687490 17:34851059-34851081 CCAGGTGATAGGGGGAGAGGTGG + Intergenic
1150456107 17:65308163-65308185 CCAGGTGACTGGGGGTCAGTAGG + Intergenic
1151276276 17:73036891-73036913 CCAGGGAATAGCGGGGAAGGAGG - Intronic
1151711360 17:75808856-75808878 CCAGATGTAAGGGGGTAAGTGGG + Intronic
1153993520 18:10420447-10420469 CCAGGGATTAAAGGGTAAGTAGG + Intergenic
1156012058 18:32507355-32507377 CCATTTCATAAGGGGTAAGTGGG - Intergenic
1158602227 18:58864516-58864538 CCAGGTTGTGGGAGGTAAGTGGG + Intronic
1168592253 19:57647089-57647111 CCAGGTAATAATGTGTAACTGGG - Intergenic
926227833 2:10981053-10981075 CCGGGAGATAGGGGGAAAGTGGG - Intergenic
926298982 2:11588900-11588922 CCAGGTAGTAGACGGTAAGCAGG - Exonic
927047264 2:19291752-19291774 CCAGGAAATGGAGGGTAAGAAGG - Intergenic
928130790 2:28648641-28648663 CCAGGGAGTAGGGGATAAGATGG + Intergenic
930084496 2:47485029-47485051 CCAGGGAATAGGGGGTAGGTGGG + Intronic
932195534 2:69779929-69779951 CCAGGTAATAGGGGGTAAGTCGG + Intronic
935304044 2:101719541-101719563 CCAGGAAAGAGGGGGAAAGTGGG + Intronic
941381510 2:164798717-164798739 TCAGTTAAGAGGGGGTAAGCAGG + Intronic
942743554 2:179206673-179206695 CCAGGGAGTAGGGGGCAAATGGG + Intronic
944219358 2:197286927-197286949 CCAGGGGTTAGGGGGTAAGCAGG + Intronic
945262898 2:207861244-207861266 GCAGGTAATAGAGGGAAAGCTGG - Exonic
948027807 2:234791704-234791726 CTAGGAAACAGGGGGCAAGTGGG + Intergenic
1169967139 20:11230209-11230231 CCAGGTAAAAGGGAATGAGTTGG + Intergenic
1172766906 20:37355866-37355888 CCAGGTACAAGGGGGTTAGAAGG + Intronic
1173467052 20:43291482-43291504 CCAGGTAACAGGAGATAAGATGG + Intergenic
951242157 3:20299741-20299763 CCAGGTTAGAGGAGCTAAGTTGG - Intergenic
951374893 3:21901767-21901789 ACAAGTATTAGGGGATAAGTTGG + Intronic
954340435 3:49949290-49949312 TAAAGTAAGAGGGGGTAAGTAGG - Intronic
954419416 3:50410687-50410709 CCAAGGGAAAGGGGGTAAGTGGG + Intronic
955887612 3:63617729-63617751 CCAGGAAATAAGGGGGAATTGGG - Intergenic
960570225 3:119178340-119178362 CCTGGCAATAGGAAGTAAGTAGG + Intronic
963466507 3:145688815-145688837 CTAGGTAAAAAGGGGTATGTTGG - Intergenic
966352580 3:179046730-179046752 CCAGGGAATTGGGGGAAAGCTGG - Intronic
970655685 4:18228094-18228116 CCAGGTAATATGGGGGGAGGGGG + Intergenic
971377518 4:26067079-26067101 ACAGGTAATAGGTGGTAACAGGG + Intergenic
971855125 4:32033038-32033060 CCAGGAAAGAGAGGATAAGTTGG - Intergenic
973582975 4:52362404-52362426 TCAGGAAATAGGAGGTAGGTTGG - Intergenic
974277480 4:59743197-59743219 CCTGGTAATGTGGGGTAAGGAGG - Intergenic
974627944 4:64447584-64447606 ACTGGTAATATGGGGTAACTTGG + Intergenic
986739846 5:10696321-10696343 CCAGGGAATAGGGGGTGTGGCGG + Intronic
994700090 5:103122586-103122608 CCAGGTAATAGGGAATAAATAGG - Intronic
994871013 5:105350724-105350746 CCAGGGAAGTGGGGGAAAGTTGG + Intergenic
996788163 5:127263398-127263420 GCAGGTATTAGAGGGTAATTTGG + Intergenic
998179840 5:139928979-139929001 CCAGGATAAAGGGGGAAAGTTGG - Intronic
998405301 5:141870869-141870891 CCAGGTAAAAGTGAGGAAGTGGG - Intronic
999107455 5:149086323-149086345 CCAGCAACTAGGGGATAAGTGGG + Intergenic
1000219260 5:159196527-159196549 AGAGGCAATAGGGGATAAGTAGG - Intronic
1001693792 5:173654175-173654197 CCAGGGAATTGGGGGAAAGCTGG + Intergenic
1005988797 6:30890943-30890965 CCAGGAAACAGGGGGTGGGTGGG - Intronic
1006253463 6:32810574-32810596 ACAGGTAATAGGGAGAATGTAGG + Intergenic
1012950028 6:105507760-105507782 CCAGGGAATAGGACATAAGTGGG + Intergenic
1015190409 6:130465726-130465748 ACTAGTCATAGGGGGTAAGTTGG + Intergenic
1015640717 6:135328567-135328589 CCTGGTGGTAGGGGGTAAGAGGG - Intronic
1016431588 6:143991324-143991346 CCAGGAAATATGAGGTAAATTGG - Intronic
1021122758 7:16815479-16815501 TCATGGGATAGGGGGTAAGTCGG + Intronic
1022967812 7:35489586-35489608 CCAGGTTATAGGGCCTAACTTGG + Intergenic
1023251626 7:38269441-38269463 CAAGGTAATAGAGGGAAAGCAGG - Intergenic
1025912583 7:65840229-65840251 CCAGGAAATAGGTGGAAACTTGG - Intergenic
1029014507 7:97301632-97301654 TCAGGAAATAGGGAGTAACTTGG - Intergenic
1031312855 7:120220489-120220511 ACAAGTCATAGTGGGTAAGTTGG + Intergenic
1031627413 7:124006256-124006278 CCATGTAGTAGGGGGGAAGGAGG + Intergenic
1034203385 7:149296081-149296103 CCAGGTAATGGGGAGCAAGGGGG - Intronic
1040880012 8:52194228-52194250 TGAGGTAATAGTAGGTAAGTGGG + Intronic
1043795566 8:84534289-84534311 CCAGGCAAAAGGGATTAAGTGGG - Intronic
1050739798 9:8806503-8806525 CAATGTAAAAGGGGGTAAGATGG - Intronic
1052663143 9:31461491-31461513 CCAGGTAAAAGGAGGTAAAGAGG - Intergenic
1053651807 9:40176978-40177000 ACAGGTAAAAGGGGGAAAATGGG - Intergenic
1053902199 9:42806291-42806313 ACAGGTAAAAGGGGGAAAATGGG - Intergenic
1055108908 9:72540270-72540292 CCAGGAAATGGGGGGTAGGAAGG + Intronic
1055653389 9:78430285-78430307 CCTGGTAAAAGGGGGGAAGAGGG - Intergenic
1057700102 9:97357863-97357885 CCATGAAACAGGGGTTAAGTAGG - Intronic
1060126646 9:121054013-121054035 TCAGTCAATAGGGGGCAAGTTGG - Intergenic
1191054198 X:56225402-56225424 CCAACTAATAGGTGGTAAGGGGG + Intergenic
1192947482 X:75981951-75981973 CCAGGCACAAGGGGGGAAGTGGG - Intergenic
1193753810 X:85381379-85381401 ACAGAGAATAGGGGTTAAGTGGG + Intergenic
1194231558 X:91331312-91331334 CCAGGGAAGTGGGGGAAAGTTGG - Intergenic
1195336506 X:103859941-103859963 TCAGGTAATAGGGCTTAAGTAGG + Intergenic
1196656389 X:118222204-118222226 CCACATAATAAGGGGTAAATGGG + Intergenic