ID: 932202405

View in Genome Browser
Species Human (GRCh38)
Location 2:69842910-69842932
Sequence ATTTGAAAATGGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1092
Summary {0: 1, 1: 2, 2: 10, 3: 118, 4: 961}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932202405_932202413 28 Left 932202405 2:69842910-69842932 CCCCCCACCTTCCATTTTCAAAT 0: 1
1: 2
2: 10
3: 118
4: 961
Right 932202413 2:69842961-69842983 ACTTTTTTCAGTATTTTTATTGG 0: 1
1: 1
2: 3
3: 124
4: 1269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932202405 Original CRISPR ATTTGAAAATGGAAGGTGGG GGG (reversed) Intronic
901303171 1:8214401-8214423 ATATGTAAAGGGAATGTGGGCGG - Intergenic
901949041 1:12726727-12726749 ATTTGAGAAGAGAAGTTGGGAGG + Exonic
902175064 1:14643316-14643338 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
903099311 1:21014467-21014489 ACTTGACGATGGATGGTGGGAGG - Intronic
903203227 1:21760630-21760652 ACTTGAAACTGGAAGGCGGGAGG + Intronic
903439446 1:23376628-23376650 ACTTGAAAATGGAAGAATGGAGG - Intergenic
903514237 1:23899729-23899751 ACTTGAACCTGGAAGGTGGAGGG + Intronic
903898974 1:26629062-26629084 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
904437875 1:30511028-30511050 AATTGAACATGAAATGTGGGAGG - Intergenic
905777896 1:40681914-40681936 ACTTGAACCTGGAAGGTGGAGGG - Intergenic
906552997 1:46681890-46681912 ATTTAACAATGGAAAGTGGCAGG + Intronic
906620425 1:47273185-47273207 AATTTAAAATGGAAGAGGGGAGG - Intronic
906750646 1:48256230-48256252 ACTTGAGAGTGGAAAGTGGGAGG + Intergenic
906888857 1:49685054-49685076 TCTTGAAGGTGGAAGGTGGGAGG - Intronic
906973818 1:50547495-50547517 ACTTAAACCTGGAAGGTGGGAGG - Intronic
906988806 1:50715292-50715314 ATTTTAAAATTGAAGGTGGCGGG + Intronic
907378461 1:54064780-54064802 ATTTGAACCTGGGAGGTGGAGGG - Intronic
907656802 1:56351661-56351683 ACTGGAAAATAAAAGGTGGGGGG - Intergenic
907770217 1:57454500-57454522 ACTTGAGGATGGAGGGTGGGAGG + Intronic
908664883 1:66478986-66479008 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
908861052 1:68490265-68490287 ATTGGACAATGGAAGGTGTGAGG - Intronic
908939449 1:69413845-69413867 ATTTGAAAGTGGAAGTCGAGAGG + Intergenic
909297043 1:73963829-73963851 GTTGGAGGATGGAAGGTGGGAGG - Intergenic
909320339 1:74277861-74277883 ATTTGAAAATGGGATATGGTAGG - Intronic
909409155 1:75328971-75328993 ACTTGAAAATGGAGGGTGTGAGG + Intronic
909431974 1:75598770-75598792 ATTGAAGAGTGGAAGGTGGGAGG + Intronic
909490723 1:76223396-76223418 ATTTCAGAGTGGAAGGTGGGAGG + Intronic
909750720 1:79157268-79157290 ATTGGAGAATGGAGGGTGGGAGG - Intergenic
909904714 1:81179896-81179918 ACTTGAAGGTGGAAGGTAGGAGG + Intergenic
910370492 1:86510437-86510459 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
910534755 1:88284459-88284481 ATATTAAAATTGAAGGTGAGTGG - Intergenic
911521822 1:98938969-98938991 ATTGGAGAGTGGAGGGTGGGAGG + Intronic
912025429 1:105164238-105164260 ATCTGAAAATGCATGGTTGGAGG + Intergenic
912075264 1:105866652-105866674 ACTTGAAATTGTAAGGGGGGGGG - Intergenic
912592428 1:110837618-110837640 ACTTGAAAGTGAAGGGTGGGAGG - Intergenic
913048693 1:115096124-115096146 ATAGGAAGGTGGAAGGTGGGAGG - Intergenic
913194196 1:116441610-116441632 ATTTGAGGGTAGAAGGTGGGAGG - Intergenic
913400095 1:118422428-118422450 ATCTGAAGGTGGAGGGTGGGAGG + Intergenic
914446565 1:147755792-147755814 ATTTGAAAATGGGATGTTGAGGG - Intergenic
914740865 1:150463897-150463919 CTTTGAAAAGCCAAGGTGGGAGG + Intronic
916373870 1:164130114-164130136 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
916457419 1:164985276-164985298 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
916616498 1:166446597-166446619 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
916642200 1:166742476-166742498 AATTGAGAGTGGAAGGTCGGAGG + Intergenic
916789618 1:168113821-168113843 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
916940642 1:169673651-169673673 ACTTGAGAATAGAGGGTGGGAGG + Intronic
916998006 1:170322335-170322357 ATTTGAGGGTGGAAGGTGGGAGG - Intergenic
917039450 1:170788144-170788166 ACATGAAGATGGAGGGTGGGAGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917270175 1:173263974-173263996 ATTTGAGGGTGGAAGGTGGGAGG + Intergenic
917566875 1:176221407-176221429 ATTAAAAAATTGGAGGTGGGTGG - Intergenic
917732060 1:177884454-177884476 AGAAGAAAATGGAAGATGGGGGG + Intergenic
918249937 1:182693965-182693987 ATTTGAGAGTGGAAGGTGGGAGG + Intergenic
918338105 1:183541725-183541747 ATGTGAAAATTGAAGCTTGGAGG - Intronic
918389514 1:184043682-184043704 ATTGGAGCATGGAAGGTGGGAGG + Intergenic
918442847 1:184585615-184585637 ATTAGAGGGTGGAAGGTGGGAGG - Intronic
918948622 1:191105470-191105492 ATCTGAGAGTGGAGGGTGGGAGG - Intergenic
919335648 1:196229160-196229182 ATTTATAAATGGAAGGTTTGTGG + Intronic
919695519 1:200570905-200570927 ATTTGAGGATGGTGGGTGGGAGG - Intronic
920602991 1:207347727-207347749 ATTTGAGAATGGAAGGTGGGAGG - Intronic
920787664 1:209057925-209057947 ATCTGAGGGTGGAAGGTGGGCGG + Intergenic
920796832 1:209146062-209146084 ATTTGGAAATTTAAGCTGGGAGG + Intergenic
920924026 1:210325145-210325167 ATTTGAAAATACACAGTGGGAGG - Intergenic
921003443 1:211068297-211068319 ATTGGAAATTGGAAGTTGGTAGG - Intronic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921354233 1:214270722-214270744 ACTTGAGAATGGAGGGTAGGAGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921571653 1:216786974-216786996 TTTTGCAAATGGAAGGTTTGTGG + Intronic
921614430 1:217249802-217249824 ATTTGTAAGTGGAAGATGAGTGG + Intergenic
921682965 1:218056042-218056064 ATTTGAGAAGCTAAGGTGGGAGG - Intergenic
921838060 1:219798569-219798591 AATTTAAAATGGAAGGCTGGAGG + Intronic
922193211 1:223338210-223338232 TTTTTAAAATGGAAGGTCAGTGG + Intronic
922201656 1:223407880-223407902 TTTTGAAAAAGAAAAGTGGGAGG + Intergenic
922823441 1:228501017-228501039 TGTTAAAAATTGAAGGTGGGTGG - Intergenic
922889905 1:229053829-229053851 ATGTGGAAATGGAAGCTGGGAGG - Intergenic
923220046 1:231884634-231884656 ACTTGAGATTGGAGGGTGGGAGG + Intronic
923762391 1:236858662-236858684 CTGTGAAAATGGAAGCAGGGTGG + Intronic
923855924 1:237845477-237845499 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
923974146 1:239240680-239240702 ATTTTAGAAAGGAAGGTGAGAGG + Intergenic
924128966 1:240885742-240885764 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
924283359 1:242460526-242460548 ATTTGAGAATGAAAGGAGGAAGG + Intronic
924329981 1:242931841-242931863 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
924377133 1:243423096-243423118 ATTGAAAAATGGAAGTTGGTAGG + Intronic
924907031 1:248466442-248466464 ATTTAAAAATGGCAGGTGGAGGG - Intergenic
1063403716 10:5772672-5772694 ACTTGAACCTGGAAGGTGGAGGG + Intronic
1063468042 10:6260914-6260936 ATATGTAAATGGGAGGTGGTAGG + Intergenic
1063586084 10:7353619-7353641 AATTGAAAATGCATGATGGGAGG - Intronic
1063600232 10:7474417-7474439 ATTTCCAAATAGAAGGGGGGGGG - Intergenic
1063699207 10:8368387-8368409 ATTGGAAGGTGGAAGGTGGGAGG + Intergenic
1063738589 10:8791644-8791666 ATTGGAGGGTGGAAGGTGGGAGG - Intergenic
1063906758 10:10788216-10788238 ATTTCAAAATAGAAGGTCAGAGG + Intergenic
1064101675 10:12469311-12469333 ATATGAAAAGGGGAGGGGGGCGG - Intronic
1064366573 10:14714024-14714046 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
1064437108 10:15320121-15320143 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
1064525759 10:16254912-16254934 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1064818395 10:19293750-19293772 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
1064843254 10:19620313-19620335 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
1064889167 10:20149567-20149589 ACTTGAGAGTGGAAGGTGAGAGG - Intronic
1065022824 10:21515148-21515170 ATATGGAAATGGCAGCTGGGCGG - Exonic
1065496415 10:26333161-26333183 ACTTGAAAATGGAAGGTATTGGG + Intergenic
1065652978 10:27913277-27913299 ACTTGAAGATGGAGGGTGGGAGG - Intronic
1065658042 10:27973483-27973505 ACTTGAGATTGGAGGGTGGGAGG - Intronic
1066218095 10:33308206-33308228 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1066388876 10:34963029-34963051 ATGTGACAACAGAAGGTGGGAGG + Intergenic
1066654243 10:37684135-37684157 AAGTGCAAATGCAAGGTGGGAGG + Intergenic
1066715552 10:38282007-38282029 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1067270316 10:44785947-44785969 AATTGAAAATGGAGATTGGGTGG - Intergenic
1067825244 10:49567334-49567356 ATTAGAAGGTGGAGGGTGGGAGG + Intergenic
1067967916 10:50934740-50934762 ACTTGAAGCTGGAAGGTGAGAGG - Intergenic
1068241981 10:54314682-54314704 ATTTGAGGTTGGAAGGTAGGAGG - Intronic
1068398944 10:56503385-56503407 ACTTGAAAATGGAGGGTAGGAGG + Intergenic
1069345762 10:67468176-67468198 ATCAGAAGATGGCAGGTGGGAGG - Intronic
1069887945 10:71635666-71635688 ATTGGAAAGAGGAAGGTGAGAGG + Intronic
1070455995 10:76616211-76616233 ACTTGAGGGTGGAAGGTGGGCGG + Intergenic
1070783364 10:79149922-79149944 ACTGGAAAATGAACGGTGGGAGG + Intronic
1071063603 10:81603872-81603894 TTTTGCAAATGGAAGGTTTGTGG - Intergenic
1071379042 10:85039313-85039335 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071691735 10:87827418-87827440 TTTTACAAATGGAAGGTGTGTGG + Intronic
1071751795 10:88487197-88487219 AGTTGAGAGTAGAAGGTGGGAGG + Intronic
1072053675 10:91731716-91731738 ACTTGAAGTTGGAAGGTGGCAGG - Intergenic
1072479753 10:95799290-95799312 ATTGGAGGGTGGAAGGTGGGAGG - Intronic
1072889598 10:99310914-99310936 TTTTTAAAATGGATGATGGGTGG - Intergenic
1073257779 10:102165234-102165256 ATTTGAAAATGGAAGCATGAAGG - Intergenic
1073553027 10:104421051-104421073 AGATGAAAATGGAAGGGAGGAGG - Intronic
1073627714 10:105116880-105116902 ACTTAAAAGTGGAGGGTGGGAGG + Intronic
1073904489 10:108262111-108262133 ATCAGAAGATGGAGGGTGGGAGG - Intergenic
1074265240 10:111895317-111895339 TTTTGAAAAAAGAATGTGGGAGG + Intergenic
1074416048 10:113267808-113267830 ATTTGAAAATGGAAATTATGTGG + Intergenic
1074794656 10:116930382-116930404 ACTTGATGATGGAGGGTGGGAGG - Intronic
1074959653 10:118430560-118430582 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1075162529 10:120037092-120037114 ACTTGAGGGTGGAAGGTGGGTGG + Intergenic
1075305878 10:121366644-121366666 ATGTAAAAATGGATGGAGGGTGG - Intergenic
1075500524 10:122969658-122969680 ATCAGAAGGTGGAAGGTGGGAGG + Intronic
1076444235 10:130500855-130500877 ATTTGGAAATGGAAGATGGAAGG + Intergenic
1076555290 10:131317554-131317576 ATTGGAGAGTGGAGGGTGGGAGG - Intergenic
1077528339 11:3082538-3082560 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1077701486 11:4445990-4446012 ATCTGAAGGTGGAGGGTGGGAGG + Intergenic
1077942821 11:6861748-6861770 ACTTGAGAGTGGAAGGTGGAAGG + Intergenic
1078380632 11:10836902-10836924 ACTTGAGGATGGAAGGTGGGAGG - Intronic
1078380786 11:10838408-10838430 ACTTGAGGATGGAAGGTGGAAGG - Intronic
1078755813 11:14208199-14208221 ATTGGAAGGTGAAAGGTGGGAGG + Intronic
1078841778 11:15083303-15083325 ATTGGAGGGTGGAAGGTGGGAGG + Intergenic
1079029684 11:16977285-16977307 GTTTGGAAAGGGAAGGAGGGAGG - Intronic
1079107517 11:17581008-17581030 TTTTGAAGAAGGAACGTGGGTGG + Intronic
1079343803 11:19634333-19634355 ACTTGAAGGTGGAGGGTGGGAGG + Intronic
1079454530 11:20625201-20625223 AGTTGAACATGGTAGGTAGGAGG - Intronic
1079662699 11:23060483-23060505 ATTTGAAAATGCAAGGTGAATGG + Intergenic
1079668901 11:23141558-23141580 ACTTGAGGATGGACGGTGGGAGG + Intergenic
1080260628 11:30346038-30346060 ACTTGAGGTTGGAAGGTGGGAGG + Intergenic
1080533288 11:33197651-33197673 AATTGAAAATTGGGGGTGGGGGG - Intergenic
1080706160 11:34696173-34696195 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1081198568 11:40190877-40190899 AATTGAAGGTGGGAGGTGGGAGG - Intronic
1081280983 11:41209035-41209057 ATTTGAAGGGGAAAGGTGGGAGG + Intronic
1081379993 11:42402703-42402725 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
1081530054 11:43952219-43952241 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1082638796 11:55629259-55629281 ACTTGAAGGTGGAAGCTGGGAGG - Intergenic
1082673790 11:56070354-56070376 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1082702718 11:56453089-56453111 CCTTGAGAATGGAGGGTGGGAGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082900719 11:58248067-58248089 ATTGGAGACAGGAAGGTGGGAGG + Intergenic
1083158743 11:60841808-60841830 AGTAGAAAAGGGAAAGTGGGAGG - Intergenic
1084439307 11:69162635-69162657 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1084675469 11:70631422-70631444 ATTTGGAGAAGGCAGGTGGGAGG - Intronic
1085263315 11:75221207-75221229 ATTGGAGGATGGAGGGTGGGAGG - Intergenic
1085345843 11:75767807-75767829 TTTTGCAGATGGAAGGTGTGAGG - Intronic
1085378425 11:76089523-76089545 AATTGAAAATGGAAGGAAGGGGG + Intronic
1085713156 11:78848502-78848524 ATTTAAAAAAGGAAAATGGGAGG - Intronic
1085780658 11:79405631-79405653 ATGGTACAATGGAAGGTGGGGGG - Intronic
1086041011 11:82478924-82478946 TTTGGAGAATGGAGGGTGGGAGG + Intergenic
1086187924 11:84041777-84041799 ATTTCAAGATGGAATTTGGGTGG - Intronic
1086369385 11:86141337-86141359 AGTTGGAAATGGGAAGTGGGTGG - Intergenic
1086538624 11:87881086-87881108 ATTTGAGAGTCCAAGGTGGGAGG - Intergenic
1086751103 11:90494628-90494650 ATTTGAGAATGGAGGATGCGAGG - Intergenic
1087034107 11:93739229-93739251 ACTTGCAAATCGAAGGTGAGTGG - Exonic
1087122558 11:94589995-94590017 AATTGAACATGGAAGATGAGGGG - Intronic
1087376660 11:97351234-97351256 ATTGGAGGCTGGAAGGTGGGAGG + Intergenic
1087701277 11:101439467-101439489 ATTTGAGGGTGGAGGGTGGGAGG + Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088434963 11:109802234-109802256 ATTTGCAATTGGCAAGTGGGAGG - Intergenic
1088841349 11:113630105-113630127 GGTAGAAAATGGAAGATGGGAGG + Intergenic
1088928323 11:114324336-114324358 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1089481414 11:118808156-118808178 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1089927406 11:122272865-122272887 ACTTGAAGGTGGAAGGAGGGTGG + Intergenic
1090035565 11:123246682-123246704 ATCCAAAAATGGAAGGTGGAGGG - Intergenic
1090102346 11:123812665-123812687 ACTTGAGATTGGAGGGTGGGAGG - Intergenic
1090115851 11:123972304-123972326 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1090262424 11:125331137-125331159 ATTGGCAAATGGAGGCTGGGTGG - Intronic
1090698950 11:129278380-129278402 ACTTGAAGATGGAAGGAAGGAGG - Intronic
1090741477 11:129665526-129665548 ATTAGAGGATGGAGGGTGGGAGG - Intergenic
1091137040 11:133201125-133201147 ACTTGAGAGTGGAAGGTGGAAGG + Intronic
1091577099 12:1748106-1748128 ATTTAAAAATAAAGGGTGGGGGG - Intronic
1091952725 12:4608350-4608372 AGTTGAAAATCAGAGGTGGGAGG - Intronic
1092008898 12:5092983-5093005 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1092044259 12:5417609-5417631 ATTTGTAAGTGGAAGCTGAGAGG - Intergenic
1092069885 12:5623867-5623889 ATTTGGGAATGGGGGGTGGGTGG + Intronic
1092440808 12:8500495-8500517 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
1092730180 12:11524176-11524198 ATTTGAAAATGAAAAAAGGGTGG - Intergenic
1093062571 12:14623042-14623064 ATCAGAAACTGGAAGCTGGGAGG + Intronic
1093097791 12:14991752-14991774 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1093099595 12:15011639-15011661 TTTTCAAAATGGAAGGTTGAGGG - Intergenic
1093491808 12:19713558-19713580 ACTTGAAGGTGGAAGGTAGGAGG - Intronic
1093497387 12:19774176-19774198 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1093747037 12:22753854-22753876 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1094250436 12:28353890-28353912 ATTGGAAGGTGGAGGGTGGGAGG + Intronic
1094576953 12:31695566-31695588 ACTTGAACCTGGGAGGTGGGAGG - Intronic
1094815715 12:34181409-34181431 ATTTAAATATGAAATGTGGGAGG + Intergenic
1095090916 12:38103947-38103969 ATTTGAAGTTAGAGGGTGGGAGG - Intergenic
1095194712 12:39299946-39299968 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
1096160065 12:49368648-49368670 AATTGAAACTGGAAGGTATGAGG - Intronic
1097302283 12:58031864-58031886 ACTTGACAGTGGAGGGTGGGAGG - Intergenic
1097318066 12:58194490-58194512 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1098072595 12:66692070-66692092 AATGGAAAACTGAAGGTGGGAGG - Intronic
1098283189 12:68882235-68882257 ACTTGAGGATGGAGGGTGGGAGG - Intronic
1098403591 12:70100010-70100032 ATTAGTAAATGGAGGGTGGATGG - Intergenic
1098663618 12:73131662-73131684 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1098796507 12:74894966-74894988 ATTCGAAAATGGAAAATGGCCGG + Intergenic
1099166144 12:79309349-79309371 ATTTCAAAATAGAACATGGGAGG - Intronic
1099238237 12:80107942-80107964 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
1099396675 12:82148304-82148326 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1099718346 12:86327987-86328009 CTTTGAAAATGGGAGGTTGGAGG - Intronic
1099771434 12:87063605-87063627 ACTTGAAGATGGAGGGTGGGAGG - Intergenic
1099824993 12:87763728-87763750 ATTAGAGGGTGGAAGGTGGGAGG + Intergenic
1099885199 12:88520837-88520859 ATGTGAAAATGGGAGGAGGTAGG - Intronic
1100114743 12:91290874-91290896 ATTTGAAGGTGGAGGGTGGAAGG - Intergenic
1100423133 12:94457199-94457221 ACTTGAAAAGGCAAGGTGAGAGG + Intronic
1100602681 12:96125654-96125676 GTTTGAATGTGGCAGGTGGGGGG - Intergenic
1101082004 12:101196157-101196179 ATTGGAGGGTGGAAGGTGGGAGG - Intronic
1101264820 12:103073172-103073194 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
1101275384 12:103194944-103194966 ACTTGAAGCTGGAAGGTGGAAGG - Intergenic
1101363733 12:104052251-104052273 ATATGAACTTTGAAGGTGGGAGG + Intronic
1101470947 12:104996515-104996537 ACTTGAGGATGGAGGGTGGGAGG - Intronic
1101619325 12:106369429-106369451 ATTTAAAAATGGGATGGGGGGGG + Intronic
1101741753 12:107505680-107505702 ATTGGAGAGTGGACGGTGGGAGG - Intronic
1103478030 12:121232818-121232840 CTTGGAGAAGGGAAGGTGGGAGG - Intronic
1104107091 12:125673325-125673347 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
1104147320 12:126047632-126047654 CTTTGAAAAGCCAAGGTGGGAGG - Intergenic
1104676454 12:130715069-130715091 CTCTGAAAATGGAAGATCGGTGG - Intronic
1105056505 12:133104944-133104966 ATTTGAGGGTGGAATGTGGGAGG - Intronic
1105337044 13:19482358-19482380 ATATCAAAATGTATGGTGGGAGG - Intronic
1106604640 13:31216596-31216618 ATTTGAGAGTGGCGGGTGGGAGG - Intronic
1106610214 13:31272085-31272107 TTTTCAAACTGGAGGGTGGGGGG - Intronic
1106647953 13:31656949-31656971 ATTAGCAAATGAAAGCTGGGAGG + Intergenic
1106917515 13:34530813-34530835 TATTGAAAGTGGAGGGTGGGAGG - Intergenic
1106963554 13:35031794-35031816 ATTTGAAGGTGGAGGGTGGGAGG - Intronic
1107176143 13:37400997-37401019 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1107400484 13:40064328-40064350 ATTAGGAAATGGAAGTTGAGAGG - Intergenic
1107418232 13:40221165-40221187 ATTTGAAAAGGGACAGTGGTGGG - Intergenic
1107476724 13:40744195-40744217 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
1107969924 13:45631571-45631593 AGTTGGAAATGGAAGGAAGGTGG - Intergenic
1108129548 13:47283029-47283051 ACTTGTAGATGGAGGGTGGGAGG - Intergenic
1108162329 13:47653992-47654014 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1108232113 13:48356578-48356600 ATCTGAAAATGGAGAGGGGGAGG - Intronic
1108711804 13:53040536-53040558 GTTTCTAAATGGAAGGAGGGTGG + Intronic
1108759689 13:53547630-53547652 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1108795721 13:54027568-54027590 ATTTGAGGGTGGCAGGTGGGAGG + Intergenic
1108913885 13:55585240-55585262 AGTTGAGAAAGGAAGGAGGGAGG + Intergenic
1109000514 13:56796573-56796595 ATTTGAAGGTGAAGGGTGGGAGG + Intergenic
1109498318 13:63204623-63204645 TTTTGAAATTGGAATGTGAGTGG - Intergenic
1109714179 13:66199554-66199576 ACTTGAGAGTAGAAGGTGGGAGG + Intergenic
1110050887 13:70897712-70897734 ACTTGAGAATGGAGGGTAGGAGG - Intergenic
1110387266 13:74928023-74928045 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1110716018 13:78705043-78705065 ATCTGAGAATGGAGGGTGGAGGG + Intergenic
1110915366 13:81014342-81014364 TTTTGAAAATAGAAGATGGATGG + Intergenic
1110993001 13:82068287-82068309 ACTTGAAGATGGAGGGCGGGAGG + Intergenic
1111344820 13:86937730-86937752 ATTTCAGAATGGAAGTTGGCAGG + Intergenic
1111492060 13:88991966-88991988 ACTTGAAGGTTGAAGGTGGGAGG + Intergenic
1111606302 13:90544008-90544030 ATTTGAAGTTGGATGGTAGGAGG + Intergenic
1111877359 13:93913932-93913954 ATCTAGAAATGGAAGGTGTGGGG - Intronic
1111894439 13:94123701-94123723 ATTTGAAAAGGGAGTGGGGGAGG + Intronic
1112102349 13:96203115-96203137 ATCTTAAAATGGAAAGTGAGAGG - Intronic
1112787405 13:102966396-102966418 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1112958434 13:105090864-105090886 ATTTGATGATGGAGGGTGGGAGG - Intergenic
1113068657 13:106396506-106396528 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1113540807 13:111107512-111107534 ACTTAAAGTTGGAAGGTGGGAGG + Intergenic
1113792774 13:113038668-113038690 ATATGAAAATGCAAGGGGTGAGG + Intronic
1114147700 14:19995936-19995958 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1114159672 14:20150401-20150423 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1114481186 14:23035818-23035840 ATTTGAAAAATGAAGGTGGGTGG - Intergenic
1114556472 14:23565209-23565231 GGTTGAAAATGGAAAGTTGGAGG + Intronic
1114763683 14:25346495-25346517 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1114770664 14:25426578-25426600 ATTTGAAAATTGATTTTGGGGGG + Intergenic
1115133091 14:30076664-30076686 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
1115726377 14:36221681-36221703 ATTTGAAAATAAGGGGTGGGAGG - Intergenic
1115933008 14:38519081-38519103 ATTGGAAGTTGGAAGTTGGGAGG + Intergenic
1116130621 14:40852365-40852387 ATTGGAAAGTGGAGAGTGGGAGG - Intergenic
1116150651 14:41137503-41137525 TTTTGCAAATGGAAGGTTTGTGG - Intergenic
1116504254 14:45659431-45659453 ACTTGAGGATGGAAGGTGGGAGG - Intergenic
1116736219 14:48695517-48695539 ATTTGAGGGTGGAGGGTGGGAGG + Intergenic
1116775059 14:49169632-49169654 ATTTGAAATTAGAAAGTGTGAGG + Intergenic
1117001108 14:51372371-51372393 ATTGGAGCATGGAGGGTGGGAGG - Intergenic
1117580697 14:57148794-57148816 TTATGAAAATTGAAGGTGGTTGG - Intergenic
1117752044 14:58934620-58934642 ACTTGAGGATGGAGGGTGGGTGG - Intergenic
1117786357 14:59289974-59289996 ACTTGAACAGGGAAGGTGGTGGG + Intronic
1118912448 14:70072946-70072968 ATTTGAAAATATCAGGTGGCAGG - Intronic
1119555199 14:75547599-75547621 AGTGAAGAATGGAAGGTGGGAGG - Intergenic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1120039087 14:79731782-79731804 ATTTAAAAAAGGAAGGAAGGAGG - Intronic
1120298103 14:82670796-82670818 ATTTTCAACTGGTAGGTGGGGGG + Intergenic
1120400398 14:84023448-84023470 TTTTGAAGATGGAAGATAGGAGG - Intergenic
1120452205 14:84682697-84682719 ATTTCAGTGTGGAAGGTGGGAGG - Intergenic
1120853906 14:89196444-89196466 ATTTTAAAATGATGGGTGGGTGG + Intronic
1120892577 14:89504358-89504380 ATTTGGAAATGGGAAGTGGATGG + Intronic
1121238351 14:92410034-92410056 ATTTGAGGGGGGAAGGTGGGAGG + Intronic
1121291629 14:92780347-92780369 CTTTGAACATGGAGTGTGGGTGG - Intergenic
1121427793 14:93865083-93865105 ATTGGAATATGCAAGGTGGCTGG + Intergenic
1121722653 14:96121495-96121517 ATGTGAAAATGGCAAGAGGGTGG + Intergenic
1122135636 14:99631365-99631387 ATTTGAAAATGGAACCAGGCCGG - Intergenic
1122498765 14:102179676-102179698 ATTTGAAAATGAAGGGGGTGAGG - Intronic
1123196084 14:106618056-106618078 ATTTGAAAGTCTGAGGTGGGAGG - Intergenic
1123823858 15:24061297-24061319 ATGTGAAAATGGAGGTTGTGGGG + Intergenic
1123917385 15:25046411-25046433 ACTTGAAGGTAGAAGGTGGGAGG - Intergenic
1124228256 15:27916189-27916211 ACTTGAGGGTGGAAGGTGGGAGG + Intronic
1124812045 15:32950684-32950706 ATTAGAAGGTGGAGGGTGGGAGG + Intronic
1125053809 15:35334123-35334145 ATTTAAAAATGGAAGAGGGAAGG + Intronic
1125406196 15:39354583-39354605 TTTTGAAAATGGAAGTTGTAGGG + Intergenic
1125988531 15:44080890-44080912 ATTTGCAAATGGAAGGTCAGAGG + Intronic
1126236209 15:46387845-46387867 ACTTGACACTGGAGGGTGGGAGG + Intergenic
1126253234 15:46593486-46593508 ATTGGAGAATGGAAGGAGGGAGG - Intergenic
1127406786 15:58657400-58657422 ATTTGAAAATGTAAAGTCAGAGG - Intronic
1127408632 15:58681684-58681706 AATTGAAAATGCATGTTGGGGGG - Intronic
1127420263 15:58798366-58798388 CTTTGAGAGTGTAAGGTGGGTGG - Intronic
1127988118 15:64090847-64090869 AATTGAAAATATAAGTTGGGAGG + Intronic
1128554525 15:68622240-68622262 ATGTGAAAATGGAGTGTGTGGGG + Intronic
1128955548 15:71939352-71939374 AGTTGAAGATGGAGGTTGGGAGG - Intronic
1128992308 15:72271460-72271482 AGTTGGAAAAGGAAGGTGGTGGG + Intronic
1130123412 15:81071717-81071739 ACTTGAGGATGGAAGGTGGGAGG - Intronic
1130228028 15:82074827-82074849 ATTTTTAAATGGTTGGTGGGGGG - Intergenic
1131295506 15:91145133-91145155 ATTGGAGGATGGAGGGTGGGAGG - Intronic
1131648122 15:94367824-94367846 GTTTTAAAAGAGAAGGTGGGAGG - Intronic
1131859481 15:96637234-96637256 CTATGATAATGGCAGGTGGGTGG + Intergenic
1131901275 15:97090296-97090318 CTTTGAGAAGGGAAGGTGGCTGG - Intergenic
1132471056 16:103382-103404 CTTTGAAAAGCCAAGGTGGGAGG - Intronic
1133109602 16:3539464-3539486 ATTTGAAAAGGGAGAGAGGGAGG + Intronic
1133378243 16:5307379-5307401 ATTTTTAAATGGAGGGAGGGAGG - Intergenic
1133399410 16:5473791-5473813 ATTGAAAGAGGGAAGGTGGGTGG + Intergenic
1133581924 16:7152816-7152838 AAGAGACAATGGAAGGTGGGTGG + Intronic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1134155599 16:11840482-11840504 ATTTGAACCTGGAAGGCGGGGGG + Intronic
1134359846 16:13521045-13521067 AATTGAAAATGAGAGGTGGAGGG - Intergenic
1134817434 16:17217573-17217595 ATTTGAGAAGGGAAGGAGGAGGG - Intronic
1135351655 16:21734366-21734388 ATTGGAGAGTGAAAGGTGGGAGG + Intronic
1135568932 16:23533436-23533458 GTTTGAAAGTAGAAGGAGGGCGG - Intronic
1135935836 16:26779266-26779288 GTTTAAAAAAAGAAGGTGGGGGG + Intergenic
1135997600 16:27263539-27263561 ATTTGAGGATGGAGGGTGGGAGG + Intronic
1136522128 16:30803901-30803923 CTTTGAGAAGCGAAGGTGGGTGG - Intergenic
1136648374 16:31643389-31643411 ACTTGAATGTGGAAGGTGGGAGG - Intergenic
1137944878 16:52724224-52724246 ACTTGAGCATGGAGGGTGGGAGG - Intergenic
1138058075 16:53857231-53857253 ACTTGAGGGTGGAAGGTGGGAGG - Intronic
1138121827 16:54406273-54406295 ATTAGGGAATGGAGGGTGGGAGG + Intergenic
1138488045 16:57359267-57359289 TTTAAAAAATGGATGGTGGGAGG - Intronic
1138620045 16:58203759-58203781 CTTTGAAGACGGAAGGGGGGTGG + Intergenic
1138808235 16:60118712-60118734 TTTTGAGGGTGGAAGGTGGGAGG - Intergenic
1139305018 16:65977815-65977837 ATTCGAGAGTGGAGGGTGGGAGG + Intergenic
1139310873 16:66027076-66027098 ATTTGGCAATTCAAGGTGGGGGG - Intergenic
1139620719 16:68139505-68139527 ATGTGAAAATGGAAAGTAGAAGG + Intronic
1139741949 16:69042925-69042947 ATTTGAAAATACAAGTTGGTCGG + Intronic
1139938639 16:70589386-70589408 ATCTGAAGGTGGAGGGTGGGAGG - Intronic
1140083867 16:71777024-71777046 GTTTGAAATTTGAAGGCGGGAGG + Intronic
1140344861 16:74203362-74203384 ATTTGAGAATGGAAGCTGTAGGG - Intergenic
1140425595 16:74858596-74858618 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1140561542 16:75988008-75988030 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1140783673 16:78319157-78319179 CTTTGAAAATGGAGGGAGGCGGG + Intronic
1140947659 16:79784930-79784952 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
1141311666 16:82919356-82919378 ATTTGAGGGTGGAGGGTGGGAGG - Intronic
1141857398 16:86693012-86693034 ATCTGAAAATGAACGGTGGGTGG - Intergenic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142548928 17:725793-725815 ATTTGAGGAGGCAAGGTGGGAGG + Intergenic
1142942798 17:3396831-3396853 CTTTGAAAGTCCAAGGTGGGAGG + Intergenic
1143999983 17:11044749-11044771 TCTTGAAGGTGGAAGGTGGGGGG - Intergenic
1144393353 17:14817820-14817842 ACTTGAGAGTGGAAGGTGGAAGG - Intergenic
1144532747 17:16055520-16055542 ATTGGAGGATGGAGGGTGGGAGG + Intronic
1144820256 17:18067903-18067925 ACTTGAAAAGGGTGGGTGGGTGG - Exonic
1144838265 17:18169361-18169383 ACTTGAAACTGGCAGGTGGAGGG + Intronic
1146025113 17:29313688-29313710 ATTAGAAACTGGAATGTGGCTGG - Intergenic
1146489697 17:33271500-33271522 AATTGAGAATGGAAGGCTGGGGG - Intronic
1147491164 17:40867416-40867438 ATATGAAAAAGAAAGCTGGGTGG + Intergenic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1149153602 17:53599180-53599202 ATTTGAGAGTAGAGGGTGGGAGG - Intergenic
1149678790 17:58489118-58489140 ATTTGAAAACGGAAATTGGCCGG + Intergenic
1150559679 17:66283762-66283784 GCTTGAACCTGGAAGGTGGGAGG - Intergenic
1151530123 17:74698701-74698723 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1153061328 18:997972-997994 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1153186014 18:2487266-2487288 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1153243898 18:3055054-3055076 CTTTGAGAAGGCAAGGTGGGAGG + Intergenic
1153513921 18:5887240-5887262 ATTTATAAATTAAAGGTGGGGGG + Exonic
1153543456 18:6181659-6181681 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
1154183116 18:12154964-12154986 GCTTGAGAGTGGAAGGTGGGAGG + Intergenic
1154247659 18:12713992-12714014 ATTTGAAAGGCCAAGGTGGGTGG - Intronic
1155090781 18:22508002-22508024 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
1155180188 18:23338636-23338658 ATGTGAAAATGGCTGGGGGGTGG - Intronic
1155262606 18:24059360-24059382 ACTTGACGATGGAGGGTGGGAGG - Intronic
1155495919 18:26441607-26441629 ATTTTAAAATGAAAGCTGGGGGG + Intergenic
1155770802 18:29695773-29695795 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1155793343 18:30001693-30001715 ATTTACAAATGGATGGTGGGTGG - Intergenic
1155835636 18:30580531-30580553 TTTTGAAAATAGAAGGTGCATGG + Intergenic
1155844727 18:30691641-30691663 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1155931278 18:31711403-31711425 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1156108138 18:33690831-33690853 AGAGGAAAATGCAAGGTGGGTGG - Intronic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156572576 18:38275014-38275036 ATTTGAAGGTGGAGGGTGGGAGG + Intergenic
1157018399 18:43747349-43747371 ACTTGACAGGGGAAGGTGGGAGG + Intergenic
1157642496 18:49232195-49232217 ATATGAATATGGAAAGTGGGGGG - Intronic
1158122043 18:54059196-54059218 ATTTGAACATGGAAGCTAAGAGG + Intergenic
1158511829 18:58097488-58097510 AGTTGAGAATGCAACGTGGGGGG - Intronic
1158738090 18:60106937-60106959 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
1159170801 18:64763826-64763848 ATTTGACAGTTGTAGGTGGGAGG + Intergenic
1159386989 18:67739975-67739997 ATTGGAGGGTGGAAGGTGGGAGG - Intergenic
1159537499 18:69733546-69733568 ACTTAAAAATGTAAAGTGGGTGG - Intronic
1159915069 18:74181559-74181581 ATTTGAGAATGGATCGCGGGAGG - Intergenic
1160383812 18:78481561-78481583 ATTTCAACATGGAAGGTTTGAGG - Intergenic
1160473078 18:79156520-79156542 ATTTGATAATGGAAGGGGAGGGG - Intronic
1160833873 19:1115712-1115734 CCCTGAAAACGGAAGGTGGGAGG + Intronic
1161030007 19:2053440-2053462 CTTTGAAAAGCCAAGGTGGGAGG - Intergenic
1161347644 19:3776215-3776237 ATGTGTGAATGGATGGTGGGTGG + Intergenic
1161970948 19:7579848-7579870 ACTTGAACCTGGGAGGTGGGTGG - Intergenic
1162078836 19:8206879-8206901 ATTTGAAAAGGGAAAGAGGCTGG + Intronic
1162665417 19:12206338-12206360 ACTTGACAGTGGAAGGTGGGAGG - Intergenic
1163071085 19:14842213-14842235 ATTTGAGGGTGGAAGGTGGGAGG - Intergenic
1163257321 19:16164679-16164701 ATGTGCAAATGGACTGTGGGCGG + Intronic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164239014 19:23366998-23367020 ATTTAAGAATGCCAGGTGGGTGG + Intronic
1164975450 19:32569737-32569759 ACTTGAAACTGGAAGGGGGGAGG - Intergenic
1165107371 19:33479566-33479588 ATTGGAAGGTGGAGGGTGGGAGG - Intronic
1166401745 19:42486548-42486570 ATTTGAAAGGCCAAGGTGGGAGG - Intergenic
1167716950 19:51148333-51148355 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
1167776063 19:51557460-51557482 AGTTGAGGATGGAAGGTGAGAGG + Intergenic
1167837638 19:52087361-52087383 ACCTGAGAGTGGAAGGTGGGAGG - Intronic
1168294201 19:55370656-55370678 AGTTGAAAAGGGAAAGGGGGGGG + Intergenic
1168471872 19:56646634-56646656 AGTCAAGAATGGAAGGTGGGAGG + Intronic
1168512460 19:56983827-56983849 ATTTGACGGTGGAAGATGGGAGG - Intergenic
925419361 2:3699174-3699196 AATTGAAGGTGGAGGGTGGGAGG - Intronic
925568305 2:5281148-5281170 ATTTGAAATTAGAAAATGGGAGG - Intergenic
925647453 2:6051150-6051172 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
925774696 2:7323336-7323358 GTTTGAAAAAGGAAGAAGGGAGG - Intergenic
926050381 2:9740523-9740545 ATTTGAAGTTGGGGGGTGGGGGG + Intergenic
926290233 2:11523224-11523246 ACTTGAGAATGGAGAGTGGGAGG + Intergenic
926783015 2:16492760-16492782 ATTTGAAGGAGGAGGGTGGGAGG + Intergenic
926835460 2:17014356-17014378 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
926867229 2:17373052-17373074 ATTTGAAAAAGGCAGGATGGAGG - Intergenic
927035492 2:19170936-19170958 ATTTGGGAAGGGTAGGTGGGAGG - Intergenic
927078506 2:19603675-19603697 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
927366209 2:22299720-22299742 AGTTGAAATTGGAGGGTGGGTGG - Intergenic
927784383 2:25963287-25963309 ATTTGAACCTGGGAGGCGGGAGG - Intronic
928180357 2:29064445-29064467 ATATGAAAACCGAAGGTGTGGGG - Exonic
928356244 2:30618560-30618582 ACTTGACAAGGGAGGGTGGGAGG + Intronic
928410700 2:31051924-31051946 AGTTGAAAATGAGAGTTGGGTGG - Intronic
928540489 2:32279259-32279281 ATTTGAAAATGGCCGGGGCGCGG - Intronic
928786844 2:34897983-34898005 ACTTGAAAGTGAAGGGTGGGGGG - Intergenic
928825723 2:35419058-35419080 ATTAGAGAGTGGAAGGTGAGAGG + Intergenic
928905072 2:36358961-36358983 TTTTAAAAATGGCAGGCGGGGGG - Intronic
929429503 2:41875144-41875166 ACTTGAACCTGGAAGGTGGAGGG + Intergenic
930347068 2:50196903-50196925 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
930996960 2:57731023-57731045 ATTGGACAGTGGAGGGTGGGAGG + Intergenic
931117862 2:59184144-59184166 ATATGAAAAAGGAAGGGAGGTGG + Intergenic
931596098 2:63945386-63945408 ATTGGAGAGTGGAGGGTGGGAGG + Intronic
931929871 2:67119684-67119706 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
932003844 2:67908410-67908432 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
932033479 2:68215126-68215148 ACTTGACAGTGGAGGGTGGGAGG + Intronic
932090706 2:68803810-68803832 ATTTGATAATGGAAGGAAAGAGG + Intronic
932149653 2:69358137-69358159 AATTTTAAATGGAGGGTGGGGGG + Intronic
932202405 2:69842910-69842932 ATTTGAAAATGGAAGGTGGGGGG - Intronic
932755649 2:74407436-74407458 ATTTGGGAGTGGAAGGTGGGAGG - Intergenic
933168969 2:79104304-79104326 ACTTGAAGATAGAAGGTGGAAGG + Intergenic
933335428 2:80952181-80952203 ATCTGAAAGTGGAGGGTGGGAGG - Intergenic
933395722 2:81728506-81728528 ATGTGAACTTGGGAGGTGGGTGG + Intergenic
933494839 2:83037332-83037354 CTTTGGAAATCCAAGGTGGGTGG + Intergenic
933823097 2:86132680-86132702 ATTTGAAAATGTAAAATGAGAGG - Intronic
935225741 2:101050906-101050928 ATTTGAGGGTGGAGGGTGGGAGG - Intronic
935888520 2:107649771-107649793 ATTGGAGGATGGAAGCTGGGAGG + Intergenic
936590079 2:113795297-113795319 ATCTAAACATGGGAGGTGGGAGG + Intergenic
936771070 2:115914371-115914393 ATTTAAAAACAAAAGGTGGGTGG - Intergenic
937285100 2:120745748-120745770 ATTTGAAATTGTGATGTGGGTGG + Intronic
937504210 2:122517931-122517953 ATTTTCAACTGGAAGTTGGGTGG + Intergenic
937676760 2:124599163-124599185 ATTTAAATATTGAAGGTGGGAGG - Intronic
937725309 2:125157471-125157493 ATTGGAGGATGGAAGTTGGGAGG - Intergenic
938570756 2:132560153-132560175 ATTTTATAATGGCAGGTGGGCGG - Intronic
938613735 2:132975940-132975962 AGTTGTAAATGGTAGGTGGGTGG + Intronic
938877988 2:135553931-135553953 CTTTGAGAAGGCAAGGTGGGCGG - Intronic
938885520 2:135643958-135643980 ATTGGAAGGTGGAGGGTGGGAGG + Intronic
939111079 2:138008135-138008157 ACTTGAGGATGGAGGGTGGGGGG - Intronic
939285871 2:140128582-140128604 ATTTGAGGATGGAAGATGGGAGG - Intergenic
939292029 2:140208158-140208180 ACTTGAAGGTGGAAGGTGGGAGG + Intergenic
939572546 2:143857526-143857548 TTTGGACAATGGAAGGTAGGAGG - Intergenic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
940438508 2:153684799-153684821 TTTGGAAGATGGAGGGTGGGAGG - Intergenic
940493093 2:154390374-154390396 ATTGGAGGATGGAGGGTGGGAGG - Intronic
940701615 2:157051402-157051424 ATAGGAAAAGGGAAGGTCGGAGG - Intergenic
940812604 2:158262354-158262376 ATTTGAGAGTGGAGTGTGGGAGG + Intronic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
942159096 2:173163272-173163294 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
942259013 2:174139001-174139023 ATTTGAAAAATGAAGTTAGGAGG - Intronic
942366199 2:175230423-175230445 TTTTGTCAATGGAAGGTAGGTGG + Intergenic
942493780 2:176517618-176517640 ATTTGAGAAGGCAAGGTGGGTGG - Intergenic
942618078 2:177815570-177815592 ATTTTTGAATGGAGGGTGGGAGG - Intronic
942668802 2:178351834-178351856 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
942737108 2:179126937-179126959 CAATGAAAATGGAAGGCGGGGGG - Intronic
942805015 2:179920282-179920304 ATTTGAGTGTGGAGGGTGGGAGG - Intergenic
943148940 2:184084870-184084892 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
943164718 2:184306353-184306375 ATTTGAGAGTGGAGGGTAGGAGG - Intergenic
943213047 2:184992858-184992880 ATCTGAAAAAGGAAGGTGGTAGG + Intergenic
943237092 2:185336767-185336789 ATTTGAAAATACATGGTTGGAGG - Intergenic
943377550 2:187098559-187098581 ATTTGATTATGGAAGGTGTGAGG + Intergenic
943453018 2:188069586-188069608 ATTTGAAGGTGGAGGGTAGGTGG - Intergenic
943727784 2:191269652-191269674 ATTTGAAAAAGTAACTTGGGTGG + Intronic
943997642 2:194791253-194791275 ATTGGAACGTGGAGGGTGGGAGG - Intergenic
944349400 2:198709158-198709180 AGAGGAAAATGGAAGGAGGGAGG - Intergenic
944774182 2:202945458-202945480 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
944884653 2:204049935-204049957 ATTTCATAAAGGAAGGTGGAGGG - Intergenic
945015827 2:205514985-205515007 ATTTGAGGGTGGAAGGTCGGGGG - Intronic
945146737 2:206746358-206746380 ATTTGAGAATGGAACTTGGGTGG - Exonic
945203872 2:207311127-207311149 TTAAGAAAATGGAAGTTGGGAGG + Intergenic
945204453 2:207317238-207317260 ATTTGATCATGGGAGGTGAGAGG - Intergenic
945541844 2:211097654-211097676 CTTTGAAAAGCCAAGGTGGGTGG - Intergenic
945620104 2:212125565-212125587 ATTGGAGAATGGAAGTTGGGAGG - Intronic
945636024 2:212352162-212352184 CCTTGAAAATGGAGGGTAGGAGG + Intronic
946038904 2:216766797-216766819 ATTTGCAAATCCAGGGTGGGAGG + Intergenic
946062076 2:216951197-216951219 ATTTGATGGTGGAGGGTGGGAGG - Intergenic
946097698 2:217289930-217289952 AATTGAAAATGGAAGGGGGAAGG + Intronic
946390372 2:219411875-219411897 GTTTGAAAAGCCAAGGTGGGAGG + Intergenic
946776955 2:223152796-223152818 ATTTCAAACTGGAAGCTGGTAGG + Intronic
946878328 2:224152393-224152415 ACTTGAGAGTGGAAGGTGGGAGG - Intergenic
947119820 2:226801679-226801701 ATTTGGAAATGGAAGCGAGGCGG + Intergenic
1168744448 20:226253-226275 ACTGGAGAGTGGAAGGTGGGAGG + Intergenic
1168981100 20:2004366-2004388 ATTTGAGAAAGGTAAGTGGGAGG + Intergenic
1168983709 20:2029367-2029389 ATTTGGAAAGGGAACGAGGGGGG + Intergenic
1169149847 20:3280854-3280876 CTTGGAAGATGGAAGGTTGGAGG - Intronic
1169338540 20:4777313-4777335 TTTTGAAAGGGTAAGGTGGGTGG - Intergenic
1169754127 20:9025183-9025205 ATTGGAAAATGGTATCTGGGCGG - Intergenic
1169856506 20:10109331-10109353 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
1170036777 20:11997998-11998020 ATAACAAAATGGAAGCTGGGTGG + Intergenic
1170060175 20:12250664-12250686 TTTGGAGGATGGAAGGTGGGAGG - Intergenic
1170126196 20:12967063-12967085 ATTTGGACATGGAAGGTGTGGGG + Intergenic
1170500745 20:16973907-16973929 ATTGGAGAGTGGAGGGTGGGAGG - Intergenic
1171153491 20:22848714-22848736 ACTTGAAGATGGAGGGAGGGAGG + Intergenic
1171281561 20:23903700-23903722 ACTTGAAAGGGGAGGGTGGGAGG + Intergenic
1172254848 20:33508572-33508594 ATGGGAAAGTGGAGGGTGGGAGG - Intronic
1172380435 20:34485932-34485954 ATTAGAAAACAGAATGTGGGAGG - Intronic
1174652489 20:52139496-52139518 ACTTGAAGATGGAGGGTGGGAGG + Intronic
1174680841 20:52406752-52406774 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1174822378 20:53737887-53737909 ATCTGAAACTGGGGGGTGGGGGG - Intergenic
1174855027 20:54036048-54036070 ATTGGAGGGTGGAAGGTGGGAGG + Intronic
1177118491 21:17113387-17113409 TTCGGAGAATGGAAGGTGGGAGG + Intergenic
1177419270 21:20835045-20835067 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1177493392 21:21857249-21857271 ATTGGCAGGTGGAAGGTGGGAGG + Intergenic
1177571159 21:22888872-22888894 ACTTGAAAGTGGAGGGTGGGAGG - Intergenic
1177775116 21:25559255-25559277 ATATGAATTTGGGAGGTGGGGGG + Intergenic
1177908513 21:27000832-27000854 ACTTGAAAGGGGATGGTGGGAGG + Intergenic
1178360321 21:31944080-31944102 ATCTCAAAAAGAAAGGTGGGAGG - Intronic
1178592801 21:33925528-33925550 ATTCCAAAATGGAAGGCCGGGGG - Intergenic
1178661294 21:34509908-34509930 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1178802489 21:35809100-35809122 ACTTGAAGGTGGAGGGTGGGAGG + Intronic
1179434917 21:41354678-41354700 ATTGGAGGCTGGAAGGTGGGAGG + Intronic
1180007471 21:45029538-45029560 AGGGGAAAATGGAAGATGGGAGG - Intergenic
1181384905 22:22537585-22537607 ACTTGAAAAACTAAGGTGGGAGG - Intergenic
1182844869 22:33422134-33422156 CTTTGAAAGTCGAAGGTTGGAGG - Intronic
1183551765 22:38491839-38491861 CTTTGAAAATAAAAGGGGGGTGG + Intronic
1183813017 22:40273957-40273979 ATTTTTAAATGAAAGGTGTGAGG + Intronic
1184775871 22:46622394-46622416 TTTTGAAAATGGAAGGAAGTAGG + Intronic
949107641 3:219691-219713 ACTTGAAGGTGGAGGGTGGGAGG + Intronic
949375759 3:3388723-3388745 AGTTGAAGGTGGAGGGTGGGAGG - Intergenic
949478882 3:4474501-4474523 ATTTGAAAAAGAAAAGGGGGCGG - Intergenic
949995685 3:9614783-9614805 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
950564271 3:13757175-13757197 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
950564574 3:13760336-13760358 ATATGAAGGTGGAAGGCGGGAGG + Intergenic
950690835 3:14655953-14655975 TTTTCAAAATAAAAGGTGGGGGG - Intronic
950929618 3:16775203-16775225 ATTTGTAAATTGGAGGTGAGGGG - Intergenic
950974641 3:17227693-17227715 ACTTGAATGTGGAGGGTGGGAGG + Intronic
951011197 3:17682046-17682068 ATTTTTATATGGACGGTGGGGGG - Intronic
951501720 3:23395155-23395177 ATTTTAAGATGGAAGCTGTGAGG - Intronic
951754712 3:26077430-26077452 ATGGGAGAATGGAGGGTGGGGGG - Intergenic
952012755 3:28919762-28919784 ATTTGAAAATGTAATATGGGGGG + Intergenic
952058905 3:29482997-29483019 AATTGAAAATGGTAGGCTGGGGG - Intronic
952097756 3:29974249-29974271 AGGTGAAAATGAAAGGTGGTGGG - Intronic
952160224 3:30685874-30685896 AATTGAAGATGGAAGGTCTGTGG + Intronic
952196421 3:31080336-31080358 ATATGTAAGTGGGAGGTGGGTGG - Intergenic
952572908 3:34738837-34738859 ACTTGAAGATGGATGGTGGAAGG + Intergenic
952856584 3:37776177-37776199 ATTTGAGAATGGAGGTTGGAAGG + Intronic
953039492 3:39242689-39242711 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
953229507 3:41052144-41052166 ACTTCCAACTGGAAGGTGGGAGG + Intergenic
953818797 3:46185986-46186008 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
954077750 3:48193761-48193783 ACTTGAACCTGGGAGGTGGGAGG - Intergenic
954527895 3:51289276-51289298 ATTTGAAGGTGGAGGGTAGGAGG + Intronic
954596255 3:51827808-51827830 ATTTGAGGGTGGAGGGTGGGAGG - Intronic
954673924 3:52305302-52305324 ATTTGATGAAGGAAGGAGGGTGG - Intergenic
954850764 3:53598125-53598147 ATTTGAAAATGAAGGGTGCTTGG + Intronic
955140287 3:56261858-56261880 ATTGGAGGGTGGAAGGTGGGAGG - Intronic
955141211 3:56271755-56271777 ACTTGAGGGTGGAAGGTGGGAGG - Intronic
955886242 3:63601492-63601514 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
956283294 3:67582261-67582283 ACTTGAAAATGGAGGGTAGGAGG - Intronic
956428144 3:69157905-69157927 ATTAGAGGATGGAAGGAGGGAGG + Intergenic
957178027 3:76838226-76838248 ACTTGAGAGTGGATGGTGGGAGG + Intronic
957211404 3:77263400-77263422 ATCAGATAATGGACGGTGGGAGG - Intronic
957548778 3:81676985-81677007 ATTTGAAAAGGAAAGGTTGTTGG - Intronic
957586377 3:82137685-82137707 CTTTGACAATGGATGGTGGTAGG + Intergenic
957763112 3:84585652-84585674 ACTTGAGAGTGGAAGGTGGGAGG - Intergenic
958089602 3:88859201-88859223 ATGTGAAAAATGATGGTGGGTGG - Intergenic
958463126 3:94424247-94424269 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
958662988 3:97095491-97095513 ATTTTGAAAAGGAAGGTGGGGGG - Intronic
958712713 3:97737506-97737528 GTTTGAATATGGAGGGAGGGAGG + Intronic
958756142 3:98251381-98251403 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
958926043 3:100158032-100158054 TTTGGAAAATGGAAAGTGGCTGG - Intronic
958964677 3:100546081-100546103 TTTTGAAAATGGAAGGAGGGGGG + Intronic
959098436 3:101983009-101983031 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
959107624 3:102082620-102082642 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
959115210 3:102169401-102169423 ACTTGAAAGTGGAGGGTGGGAGG - Intronic
959128242 3:102317612-102317634 GCTTGAAAGTGGAGGGTGGGAGG - Intronic
959292649 3:104494179-104494201 AGTTGAATATGGAAGGAGAGGGG - Intergenic
959610590 3:108290487-108290509 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
960215171 3:115025091-115025113 ATCAGAGGATGGAAGGTGGGAGG - Intronic
960307746 3:116082882-116082904 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
960316760 3:116187940-116187962 ATTGGAGGATGGAGGGTGGGAGG - Intronic
960651499 3:119956117-119956139 ATTAGTAAATAGAAGGAGGGAGG + Intronic
960721731 3:120631074-120631096 ACTTGAGAATAGAGGGTGGGAGG + Intronic
960748519 3:120918106-120918128 CTTTGAAAATGGAAGGGGGCTGG - Intronic
961082250 3:124036211-124036233 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
961341908 3:126229857-126229879 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
961533972 3:127558031-127558053 ACTGGCAAATGGAAGGTGGAGGG + Intergenic
962047931 3:131780664-131780686 ATTTGAGAGTGGAGGGTGGGAGG + Intronic
962073901 3:132060206-132060228 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
962341606 3:134590082-134590104 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
962470326 3:135702064-135702086 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
962608455 3:137052074-137052096 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
963019895 3:140863140-140863162 ATCGGAAGGTGGAAGGTGGGAGG + Intergenic
963097999 3:141566038-141566060 ATTTAAAAATAGAAGGAGGAAGG - Intronic
963253665 3:143122699-143122721 ACTTCAAAATGGAAGGCAGGTGG - Exonic
963393220 3:144696565-144696587 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
963509417 3:146228451-146228473 ATTTCAAAGTGGAAGGAGTGGGG + Intronic
963579769 3:147110659-147110681 ACTTGAGAATGGAGGGTGGGAGG - Intergenic
963953966 3:151232779-151232801 ACTTGAGGATGGAGGGTGGGAGG + Intronic
964141910 3:153412505-153412527 ACTTGAGAATGGAGAGTGGGAGG - Intergenic
964206769 3:154183682-154183704 ATGTAAAAATAAAAGGTGGGTGG + Intronic
964244866 3:154639861-154639883 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
964296028 3:155234207-155234229 ACTTGATGGTGGAAGGTGGGAGG - Intergenic
964352285 3:155815072-155815094 ATATGGAAAGGGAAGGTGGTTGG + Intergenic
964514117 3:157488806-157488828 ATTTGGAAAGGGAGGGTGAGGGG - Intronic
964595973 3:158428812-158428834 TTTTGAAAATGGAAGTGGTGTGG + Intronic
964618322 3:158694426-158694448 ATTGGAGGATGGAGGGTGGGTGG + Intergenic
964653024 3:159033124-159033146 ACTTGAAGATGGAAGGTGGGAGG - Intronic
964968605 3:162530700-162530722 ATTTGAGGGTGGAGGGTGGGAGG + Intergenic
964987346 3:162760452-162760474 ATTTGAAGGTGGAGGGTAGGAGG - Intergenic
965036720 3:163449342-163449364 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
965466777 3:169039572-169039594 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
966677843 3:182608708-182608730 ATTTGTAAATAAAAGGGGGGGGG - Intergenic
967002630 3:185351191-185351213 ATTTGAAGGTGGAGGATGGGAGG + Intronic
967587427 3:191232681-191232703 ACTTGAAACTGGGAGGTGGAGGG - Intronic
967619073 3:191610027-191610049 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
967650398 3:191978382-191978404 ATTGGAGAGTGGAAGGTGGGAGG + Intergenic
967670778 3:192232697-192232719 ATTTGAAGGTGGAGGGTAGGAGG - Intronic
967851234 3:194084034-194084056 ATGTGAGAATGGATGGGGGGCGG + Intergenic
968257446 3:197289299-197289321 TTTTGCAAAATGAAGGTGGGGGG + Intronic
968362400 3:198156743-198156765 AGTAGAGAATGGAAGGTGGAAGG + Intergenic
969504062 4:7573067-7573089 TTTTGAAAATGTAAGGTGAGTGG + Intronic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
969951987 4:10846533-10846555 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
970379766 4:15495068-15495090 ATTTGAGGGTGGAGGGTGGGAGG - Intronic
970554828 4:17220692-17220714 ATGTGAAGATGGAAGGGGGATGG + Intergenic
970570246 4:17373859-17373881 ATATGAAACTCTAAGGTGGGTGG - Intergenic
971254091 4:24998117-24998139 ATTTGATAAGCCAAGGTGGGAGG - Intergenic
971734033 4:30423060-30423082 ATTTGAGGATGGAGAGTGGGTGG - Intergenic
972223688 4:36986761-36986783 ATTGGAGGTTGGAAGGTGGGAGG - Intergenic
972300784 4:37783992-37784014 ATTGGAAGGTGGAAGGTGGGAGG - Intergenic
972710581 4:41590597-41590619 AAGAGAAAATGGGAGGTGGGAGG - Intronic
972737170 4:41853956-41853978 ACTTGAAGATGGAGGGTTGGGGG + Intergenic
972998709 4:44917923-44917945 ATGTGAAAATGGAAGGTTATAGG + Intergenic
973289080 4:48452360-48452382 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
974016491 4:56653768-56653790 ATTTGAGAATGGCAGAAGGGGGG + Intronic
974198289 4:58605179-58605201 ACTTGAAGGTGGAAGGTGGGAGG - Intergenic
974461049 4:62188337-62188359 ACTTGAAGGTTGAAGGTGGGAGG + Intergenic
974528284 4:63074686-63074708 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
974546366 4:63313649-63313671 ACTTGATGGTGGAAGGTGGGAGG - Intergenic
974925920 4:68297140-68297162 ATTTGAGGGTGGAAGGCGGGAGG - Intergenic
975474095 4:74802524-74802546 AATTGAGGGTGGAAGGTGGGAGG + Intergenic
975512055 4:75205108-75205130 GTATGAAAATGAAAGCTGGGAGG - Intergenic
975667784 4:76750508-76750530 ATTTGAGGGTGGAGGGTGGGAGG + Intronic
975760803 4:77618040-77618062 ATAGGAAATTGTAAGGTGGGAGG - Intergenic
975989931 4:80248248-80248270 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
976447564 4:85149367-85149389 ATATTGAATTGGAAGGTGGGGGG + Intergenic
976521891 4:86037717-86037739 ATTTGAAAATTGAATAAGGGTGG - Intronic
976639986 4:87328052-87328074 ATTTGAAAGGCCAAGGTGGGTGG + Intergenic
976661577 4:87545621-87545643 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
976851618 4:89553548-89553570 ACTTGAGATTGGAGGGTGGGAGG - Intergenic
977412305 4:96683573-96683595 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
977441978 4:97079413-97079435 CTTTGAAAATGGAAGAAGGAGGG - Intergenic
977647679 4:99432310-99432332 ATTTGAGGGTGGAAGGTGGAGGG + Intronic
977651834 4:99479039-99479061 ATTTGAGAATGGAGGATGAGAGG - Intergenic
977956736 4:103036368-103036390 ATTTTAAAGTGGAGGGTGGCAGG + Intronic
978271589 4:106896545-106896567 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
978538579 4:109790584-109790606 ATTAGAAGATGGAGGCTGGGAGG - Intronic
978656660 4:111073649-111073671 ACTTGAGAATGGTGGGTGGGAGG + Intergenic
978771725 4:112463864-112463886 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
978924082 4:114221307-114221329 ACTGGAGAATGGAGGGTGGGAGG + Intergenic
979008088 4:115330203-115330225 ATCAGAGAGTGGAAGGTGGGAGG - Intergenic
979203702 4:118009232-118009254 GTTGGATAAAGGAAGGTGGGTGG - Intergenic
979418979 4:120479860-120479882 ATTGGAAGGTGGAAGGTAGGAGG - Intergenic
979760689 4:124400035-124400057 ATTTCAAGATGGGAGCTGGGAGG - Intergenic
980005115 4:127532802-127532824 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
980061144 4:128131341-128131363 ATTTGCAAATCAAAGGAGGGAGG + Intronic
980398860 4:132253424-132253446 ATTGGAAGGTGGAGGGTGGGAGG - Intergenic
980403847 4:132330676-132330698 ATTTTAAAATGGAAGGGTAGTGG + Intergenic
980540200 4:134183452-134183474 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
980751121 4:137090381-137090403 ATTGGAATAAAGAAGGTGGGAGG + Intergenic
980755504 4:137154285-137154307 ATTGGAGGTTGGAAGGTGGGAGG - Intergenic
981047002 4:140274376-140274398 ATTTGGAAATTGGAGGTGGAAGG + Intronic
981241324 4:142479802-142479824 ATTTGAGAATGGAGGGTGGGAGG + Intronic
981275192 4:142891349-142891371 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
981527733 4:145723115-145723137 ATGGAAACATGGAAGGTGGGTGG - Intronic
981632569 4:146837340-146837362 GCTTGAGAATGGAGGGTGGGAGG + Intronic
981707079 4:147670962-147670984 TTTGGAAGATGGAGGGTGGGGGG + Intronic
981850533 4:149224458-149224480 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
982009776 4:151095500-151095522 ACTTGAGAATGGAGGGTGGAGGG + Intergenic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
982382255 4:154761539-154761561 ATTCTAAAATGGAGGATGGGAGG + Intergenic
982467447 4:155748210-155748232 GTATGGAAATGGAGGGTGGGAGG - Intergenic
982499623 4:156136851-156136873 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
982683086 4:158456216-158456238 ACTTGAAGGGGGAAGGTGGGAGG + Intronic
982926786 4:161347959-161347981 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
982948609 4:161660619-161660641 ATTAGAGCATGGAGGGTGGGAGG - Intronic
983457036 4:167978135-167978157 ATTTGATTGTAGAAGGTGGGAGG + Intergenic
983548207 4:168985902-168985924 ACTTGAAAGTGGAGGGTGGGAGG + Intronic
983735392 4:171052591-171052613 ACTTGAGACTGGAGGGTGGGAGG + Intergenic
983798922 4:171903110-171903132 CTTTGAAAATGAGAGGTGAGAGG + Intronic
983861845 4:172717064-172717086 ATTTAAAACTGGTAGGTGTGAGG - Intronic
983899541 4:173119180-173119202 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
983913257 4:173264132-173264154 TTTTGAAAAGGGAAGGGTGGAGG - Intronic
984257684 4:177407792-177407814 ACTTTAAAATAGAAGGTGGAGGG + Intergenic
984305242 4:177980998-177981020 ATATGAGGATGGAGGGTGGGAGG - Intronic
984371996 4:178880078-178880100 ATGTGAAAGTGGAAGGGGTGAGG - Intergenic
984663277 4:182397316-182397338 ACTTGAAACTGGGAGGTGGAGGG + Intronic
984724641 4:183009187-183009209 ATTTTAAAATGAGAGGTGAGCGG + Intergenic
984736668 4:183115020-183115042 ATTTGAGAGTGGAAGGTGGGAGG - Intronic
985027635 4:185754293-185754315 ACTTGAGGGTGGAAGGTGGGAGG + Intronic
985258727 4:188095076-188095098 AAATAAAAATAGAAGGTGGGGGG + Intronic
986094478 5:4541092-4541114 AATTGAATGTGGAAAGTGGGTGG - Intergenic
986418936 5:7557521-7557543 ATTGGAGGATGGAGGGTGGGAGG - Intronic
986499922 5:8387976-8387998 ACTTGAGACTGGAGGGTGGGAGG - Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
986816219 5:11414746-11414768 ATTTGAGAGTGGAGGGTGGGAGG - Intronic
987484806 5:18511703-18511725 ACTTGAAGATGGAGGGTGAGAGG + Intergenic
988019705 5:25607428-25607450 ATTTTTAAATGGATGTTGGGAGG + Intergenic
988021059 5:25622698-25622720 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
988117785 5:26919671-26919693 GCTTGAAAATAGGAGGTGGGAGG + Intronic
988736829 5:34030928-34030950 ATGGGAGGATGGAAGGTGGGAGG + Intronic
988871073 5:35390572-35390594 ATGGGAAAGTGGAGGGTGGGAGG + Intergenic
989141921 5:38209966-38209988 AGGGGGAAATGGAAGGTGGGAGG - Intergenic
989151444 5:38303788-38303810 ATTTCAAAACGGAAGGTAGATGG + Intronic
989206967 5:38819162-38819184 ATGGGAGGATGGAAGGTGGGAGG + Intergenic
989312307 5:40034287-40034309 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
989448001 5:41553683-41553705 ACCTGAAAGTGGAGGGTGGGAGG + Intergenic
989489071 5:42029659-42029681 ATTTGAAAATACATGGTGAGAGG - Intergenic
990076083 5:51847535-51847557 ACTTGAAAGGGTAAGGTGGGAGG + Intergenic
990124798 5:52501047-52501069 ATGTGAGAATGGAGGCTGGGAGG + Intergenic
990251140 5:53916348-53916370 ACTTGAGGATGGAGGGTGGGAGG + Intronic
990271348 5:54144021-54144043 ATTTTAACATGGAAGATGGCAGG - Intronic
990291731 5:54359220-54359242 ATATGAAAAGGCAAGGTGAGTGG - Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
990769600 5:59228248-59228270 ACTTGAGGATGGAGGGTGGGAGG + Intronic
991185390 5:63800729-63800751 ATATGAAAATAGAAGGTGAGGGG + Intergenic
991384970 5:66077027-66077049 CTTTGAAAATTGTGGGTGGGAGG + Intronic
992213162 5:74500735-74500757 ATTTGAAAATGGAACATGATAGG + Intergenic
992214444 5:74511801-74511823 ATCAGAGGATGGAAGGTGGGAGG - Intergenic
992459694 5:76948938-76948960 ATTGGAAGTTGGAGGGTGGGAGG + Intergenic
992782296 5:80139101-80139123 ATTTGAAAATGCAATATGTGTGG - Exonic
992809665 5:80374031-80374053 ACTTGAGAGTGGAAGGTGGGAGG - Intergenic
992919903 5:81503979-81504001 ACTTGAGGGTGGAAGGTGGGAGG + Intronic
993097874 5:83501704-83501726 TTTTGAAAATGGAAAGTGTGAGG + Intronic
993382599 5:87224841-87224863 CTTTGAAAATGGAAGAATGGAGG + Intergenic
993465649 5:88243235-88243257 ACTTGAGGATGGAAGGTAGGAGG - Intronic
993765602 5:91853474-91853496 ATTTGAGAATGGAAGTAAGGAGG + Intergenic
993996133 5:94725319-94725341 ATTTGAGAATAGTTGGTGGGTGG + Intronic
994262263 5:97673815-97673837 ATTGGAGAGTGGAGGGTGGGAGG - Intergenic
994564876 5:101430880-101430902 ACTTAAGGATGGAAGGTGGGAGG + Intergenic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
994957525 5:106552550-106552572 ATTTCAGGGTGGAAGGTGGGAGG + Intergenic
995653790 5:114401962-114401984 ATTAGACAATGGAAGATAGGAGG + Intronic
995662977 5:114506778-114506800 ATTTGAGGGTGGAAGGTGGGAGG + Intergenic
995672246 5:114619174-114619196 ATATGAGGATGGAGGGTGGGAGG + Intergenic
995778609 5:115752172-115752194 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
996237298 5:121147328-121147350 ACTTGAAAGTGGAGGGTGGCAGG - Intergenic
996469408 5:123842735-123842757 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
996799737 5:127389766-127389788 ATTGGCAAGTGGAGGGTGGGAGG + Intronic
996888243 5:128385206-128385228 ACTTGAGAGTGGAAGGTGGGAGG - Intronic
997066198 5:130562342-130562364 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
997120506 5:131168154-131168176 CTTTGAAAATGGAAGGAGTTGGG + Intronic
997369298 5:133347600-133347622 CTTTGGAAATCCAAGGTGGGTGG - Intronic
997897109 5:137728823-137728845 ACTTGAGGATGGAGGGTGGGTGG + Intronic
997971531 5:138406809-138406831 ATTTGAGAATCTTAGGTGGGAGG + Intronic
998601387 5:143588807-143588829 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
998751228 5:145323611-145323633 ACTTGAACATGGAAGGTGCAAGG - Intergenic
999110859 5:149120368-149120390 ATTGGAGGGTGGAAGGTGGGAGG + Intergenic
999761721 5:154706553-154706575 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
999865139 5:155693205-155693227 ATCTGAAAATGAAAGGAGGGAGG - Intergenic
1000790988 5:165607051-165607073 ATTTGAAGGAGGAAGGTGAGAGG - Intergenic
1001545248 5:172567077-172567099 ATCTGAAAATAGAAGGTGCCTGG - Intergenic
1002657834 5:180766575-180766597 ATCTGAAGGTGGATGGTGGGAGG + Intergenic
1002977644 6:2098760-2098782 AATTGAAAATGGAATCTGGATGG + Intronic
1003663622 6:8088365-8088387 ATTTCAAAATGAGATGTGGGTGG - Intronic
1003823921 6:9931247-9931269 ATTGGAAGGTGGAAGGTGGGAGG + Intronic
1003946264 6:11078810-11078832 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1004092801 6:12521979-12522001 ACTTGAAGATGGAGGGTGAGAGG - Intergenic
1004136087 6:12968185-12968207 TTTAGCAAATGGAATGTGGGGGG - Intronic
1005135559 6:22566700-22566722 ATTAGAAAAGGGAAAATGGGAGG - Intergenic
1005604912 6:27467104-27467126 ATTTGAACAAGTAAGGTGGTGGG - Intronic
1005902522 6:30229587-30229609 ATTTGAGGATGGAGGGTGGAAGG - Intergenic
1006266029 6:32924515-32924537 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1006336485 6:33423701-33423723 ATTTGCAAATGGCAGGAGGGTGG + Intronic
1006344446 6:33468668-33468690 ACTTGAATGTGGAGGGTGGGAGG + Intergenic
1006636364 6:35464098-35464120 ATGTGAGAATGGATGGTGGTGGG + Intronic
1006711236 6:36073641-36073663 ATATGACAATAGAAGGTTGGAGG + Intronic
1006732425 6:36246285-36246307 ATTTGAACCTGGGAGGTGGAGGG - Intronic
1006880237 6:37332598-37332620 ATTTGGTAGTGGAGGGTGGGGGG + Exonic
1007019191 6:38502450-38502472 ATTTGAACATGGTAGGAGGCTGG - Intronic
1007914246 6:45546155-45546177 TTTTGAAAATGGGAGTTAGGAGG - Intronic
1007969814 6:46040026-46040048 ATTAGAAAATGGATGCTGAGAGG - Intronic
1008101665 6:47398470-47398492 ATGTGAAAATGGAAGGGTTGGGG - Intergenic
1008242897 6:49133849-49133871 ACTTGAGAGTGGAAGGTGAGAGG + Intergenic
1008331893 6:50255287-50255309 ATTGGAGGATGGAGGGTGGGAGG - Intergenic
1008760683 6:54848247-54848269 ATTTGCAATTGGAAGGTGTGGGG - Intronic
1008823322 6:55660364-55660386 AATTGCGAGTGGAAGGTGGGAGG - Intergenic
1008861559 6:56155064-56155086 ATTGGAAGGTGGAAGGTGGGAGG - Intronic
1008866894 6:56222873-56222895 CTTTGACAATGGAGGGTGAGTGG + Intronic
1009002752 6:57739275-57739297 GTTGGAAAGTGGAGGGTGGGAGG + Intergenic
1009283222 6:61777998-61778020 ATTTGAAGGTAGAGGGTGGGAGG - Intronic
1009505164 6:64468650-64468672 ACTTGAAGGTGGAGGGTGGGAGG - Intronic
1010096814 6:72056257-72056279 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1010178754 6:73059406-73059428 ACTTGAGGATGGAAAGTGGGAGG + Intronic
1010659441 6:78552439-78552461 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1010708284 6:79140329-79140351 ATTAGAGAGTGGAGGGTGGGAGG + Intergenic
1010923360 6:81712362-81712384 ATCTGAGAGTGGAAGGTGGGAGG + Intronic
1011257028 6:85432995-85433017 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1011287436 6:85740015-85740037 AGGTGAAAATGGAAGGTCAGTGG - Intergenic
1011827121 6:91321258-91321280 ATTTGAAAATAGTATGTGAGTGG + Intergenic
1012591042 6:100981606-100981628 ACTTGAAGAGGGAGGGTGGGAGG - Intergenic
1012707007 6:102544236-102544258 ACTTGAAGGTGGAAGGTGGCAGG + Intergenic
1012902126 6:105018746-105018768 ATTAGAAAATGGAAGGGGAGGGG - Intronic
1013421739 6:109973150-109973172 ATTTGAGGATGCAGGGTGGGAGG + Intergenic
1013488466 6:110620763-110620785 AGTTGAAAAGGGAAGGGGAGTGG - Intronic
1013832085 6:114285286-114285308 ATTGGAGGATGGAGGGTGGGAGG + Intronic
1014337771 6:120159476-120159498 ATATGAAAAAGGAAGGTGTTTGG + Intergenic
1014340077 6:120193493-120193515 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1014358693 6:120446750-120446772 ATTTGCACATGTAAGGTTGGTGG + Intergenic
1014402394 6:121006652-121006674 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
1015480964 6:133709014-133709036 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1015612912 6:135045048-135045070 ATTTGCAAAGGGTGGGTGGGGGG + Intronic
1016129516 6:140448990-140449012 GATTTAAAATGTAAGGTGGGAGG - Intergenic
1017400982 6:154061663-154061685 ACTTGAGGGTGGAAGGTGGGAGG + Intronic
1017413456 6:154194486-154194508 AATTGAAAAAGGAAGGTAGTAGG - Intronic
1017474227 6:154771868-154771890 ATTCTAAAATAGAAGTTGGGGGG + Intronic
1017884539 6:158588167-158588189 ATAGGAGAATGGGAGGTGGGCGG + Intronic
1018156259 6:160988054-160988076 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
1018482740 6:164208031-164208053 ATTTAGAAATAGAAGGTGGCGGG - Intergenic
1018594732 6:165466505-165466527 TTTTACAAATGGAAGGTGCGTGG + Intronic
1018786358 6:167111077-167111099 ATTTGAAAAAGGAAGGAGAGGGG + Intergenic
1019253280 7:31964-31986 AGTAGAGAATGGAAGGTGGAAGG - Intergenic
1019944988 7:4320568-4320590 GACAGAAAATGGAAGGTGGGTGG - Intergenic
1020482892 7:8683996-8684018 ATTTGGAAATGGAAATTTGGTGG + Intronic
1021139483 7:17006411-17006433 ATTAGAAAGTGGAAGGAGAGAGG - Intergenic
1021234255 7:18123135-18123157 ACTTTAAAATGGAAGCTGGTAGG + Intronic
1021419443 7:20428900-20428922 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1021453074 7:20799341-20799363 ATTTATAAAGAGAAGGTGGGAGG - Intergenic
1021494359 7:21258067-21258089 ACTTGAGAATGGAAAGGGGGAGG + Intergenic
1021596293 7:22320573-22320595 ATGTTAAAATGGAAAGAGGGGGG - Intronic
1021674780 7:23069093-23069115 TTTAGACAATGGAATGTGGGTGG + Intergenic
1022895127 7:34742314-34742336 ACTTGAAAGTGGAGGGTGGGAGG - Intronic
1022984886 7:35642801-35642823 ACTTGAGAGTGGAGGGTGGGAGG + Intronic
1023075359 7:36476517-36476539 ATGCGAGTATGGAAGGTGGGAGG - Intergenic
1023243181 7:38171341-38171363 AATTTAAAATGCAAAGTGGGAGG + Intergenic
1023785267 7:43701252-43701274 ATTTGAGGATGGAGAGTGGGAGG - Intronic
1024106258 7:46089983-46090005 ACTTGATAGTGGAGGGTGGGAGG - Intergenic
1024166016 7:46731095-46731117 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1026113591 7:67477817-67477839 ATTGGAGGGTGGAAGGTGGGAGG - Intergenic
1026474360 7:70721541-70721563 AATTGACAAAAGAAGGTGGGTGG - Intronic
1027111637 7:75444244-75444266 ATTTGAAAAAAAAAGGGGGGGGG + Intronic
1027112560 7:75452375-75452397 ACTTGAACCTGGGAGGTGGGAGG + Intronic
1027284804 7:76636981-76637003 ACTTGAACCTGGGAGGTGGGAGG + Intergenic
1027678156 7:81184821-81184843 ACTTGAGGGTGGAAGGTGGGAGG + Intronic
1027832857 7:83202155-83202177 ATTTTAAAAGGGAGGGAGGGAGG - Intergenic
1027884426 7:83885263-83885285 ACTTGAGAATGGAAGGTGGGTGG + Intergenic
1028278232 7:88886301-88886323 ACTTGACAGTGGAGGGTGGGAGG + Intronic
1028330178 7:89580429-89580451 AATTGAGAATGGAGGATGGGAGG + Intergenic
1028374197 7:90129036-90129058 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1029682405 7:102120765-102120787 ATTTGAAAAGGGGAGGAGGCTGG + Intronic
1029932545 7:104387937-104387959 ACTTGAGGGTGGAAGGTGGGAGG - Intronic
1029985325 7:104917522-104917544 ATTAGAAGATGGGGGGTGGGTGG + Intergenic
1030016216 7:105224705-105224727 GTTTTAAAATGGAAGATGAGGGG - Intronic
1030168861 7:106581670-106581692 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
1030303569 7:107998345-107998367 ATCTGAAAATGGTATGTGGTTGG - Exonic
1030419911 7:109295729-109295751 AGGGGAAAATGGAATGTGGGTGG + Intergenic
1030699975 7:112627423-112627445 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1030844111 7:114387938-114387960 AGTTGAAAATGAATGGTGCGAGG - Intronic
1031168204 7:118256699-118256721 ACTTGAACCTGGAAGGTGGAAGG + Intergenic
1031322917 7:120355462-120355484 ACTTGAACCTGGGAGGTGGGGGG + Intronic
1031323673 7:120365147-120365169 AAGGGAAAATGGAGGGTGGGAGG + Intronic
1032230900 7:130073123-130073145 CTTTGAAAGTCCAAGGTGGGAGG + Intronic
1032415058 7:131729397-131729419 GGTGGAGAATGGAAGGTGGGGGG + Intergenic
1032586988 7:133156018-133156040 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1032706317 7:134423643-134423665 ATCTGAGAATGGAATGTGGATGG - Intergenic
1033022303 7:137738727-137738749 ATATGAAAAGGAAAGGGGGGGGG - Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1035543115 8:457525-457547 ATGTAAAGCTGGAAGGTGGGGGG + Intronic
1035602568 8:905453-905475 ATTTGAAAAAGGGCTGTGGGGGG - Intergenic
1035896603 8:3409582-3409604 AATTGAAAAGGGAGGGTGTGGGG - Exonic
1036417411 8:8563569-8563591 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
1036791082 8:11720596-11720618 AATTGAGAGTGGAGGGTGGGAGG - Intronic
1036911803 8:12763665-12763687 CTTTGGGAATGGGAGGTGGGAGG + Intergenic
1037020527 8:13964864-13964886 AGTTGACAGTGGAAGGTGGTAGG - Intergenic
1037048169 8:14336062-14336084 ACTAGAGGATGGAAGGTGGGAGG - Intronic
1037107966 8:15132895-15132917 CTTTGGAAATCCAAGGTGGGTGG + Intronic
1037114366 8:15206022-15206044 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1037191427 8:16130628-16130650 ACTTGAGGGTGGAAGGTGGGAGG - Intronic
1037225999 8:16590689-16590711 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
1037397426 8:18457879-18457901 ACTTGAGGATGGAAGGTGGGAGG + Intergenic
1037871913 8:22506055-22506077 ACTTAAAAATGGAGGGTAGGAGG - Intronic
1039081604 8:33739304-33739326 AATGGAGACTGGAAGGTGGGAGG + Intergenic
1039168793 8:34717047-34717069 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1039264288 8:35808319-35808341 ATTTAAAAATGTAAGGAGGGAGG + Intergenic
1039638301 8:39190911-39190933 ACTTGAGGGTGGAAGGTGGGAGG - Intronic
1039962734 8:42262124-42262146 AATTTGAAATAGAAGGTGGGAGG + Intergenic
1040449912 8:47534624-47534646 ACTTGAAGAGGGAGGGTGGGAGG + Intronic
1040672764 8:49712459-49712481 ATTGGAAGGTGGAGGGTGGGAGG + Intergenic
1040703788 8:50100929-50100951 ATTTGAAGGTGGACAGTGGGAGG - Intronic
1040954638 8:52967389-52967411 ATGTGAAGGTGGAGGGTGGGAGG - Intergenic
1041146364 8:54880638-54880660 TTTTTAAAAAGGAAAGTGGGGGG - Intergenic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1041980501 8:63852910-63852932 TTTTGAAAATAGACTGTGGGGGG - Intergenic
1042401023 8:68347108-68347130 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
1042783195 8:72515471-72515493 AATTGAACATGGAAGGAAGGAGG + Intergenic
1043050348 8:75377543-75377565 AGGGGAAAATGGAAGGTGGAGGG - Intergenic
1043168972 8:76940018-76940040 ATTGGAGAGTGGAGGGTGGGAGG + Intergenic
1043169867 8:76952312-76952334 AATTGTAAATAGAAGGTGGAGGG + Intergenic
1043227729 8:77752998-77753020 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1043275697 8:78389451-78389473 CTTTAAAAATTGAAGGTGTGTGG + Intergenic
1043290609 8:78595579-78595601 ATTTGAGGATGGAAGGTGGGAGG - Intronic
1043310132 8:78848691-78848713 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1043361488 8:79477738-79477760 TTTGGAAATTTGAAGGTGGGTGG + Intergenic
1044193534 8:89347802-89347824 ACTTGAGAGTGGAAGGTGAGAGG - Intergenic
1044269392 8:90223606-90223628 TTTTGAAAAATGAAGGTGGCTGG + Intergenic
1044435656 8:92159635-92159657 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1044769175 8:95611339-95611361 ACTTGAGAGAGGAAGGTGGGAGG - Intergenic
1045909239 8:107386237-107386259 ATTTGAGGATGGAGGGTAGGAGG + Intronic
1046449563 8:114370809-114370831 ACTTGAGGATGGAAGGTGGGAGG + Intergenic
1046810715 8:118530365-118530387 ACTTGAGGGTGGAAGGTGGGAGG - Intronic
1046811354 8:118536674-118536696 AGTTAAAAATGGAAGTGGGGTGG - Intronic
1047018802 8:120752817-120752839 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1047566682 8:126051515-126051537 ATTTGAAACTGGATGAGGGGTGG + Intergenic
1047580409 8:126208251-126208273 ATTTGAGGATGGAGGGTGGGAGG - Intergenic
1048386431 8:133916841-133916863 ACTTGACAATGGAGGGTGGGAGG + Intergenic
1048600572 8:135915172-135915194 GTTTGAAGGTGGAGGGTGGGAGG + Intergenic
1048979581 8:139696006-139696028 TTTAGAAACTGGAACGTGGGGGG - Intronic
1049723992 8:144137116-144137138 ATTTGTAAATGGAGGTTTGGAGG - Intergenic
1050804007 9:9651389-9651411 TTTGGAAGTTGGAAGGTGGGAGG - Intronic
1050933480 9:11361711-11361733 ACTTGAAAGTGAAGGGTGGGTGG + Intergenic
1050974973 9:11926467-11926489 ACTTGAGCAGGGAAGGTGGGAGG + Intergenic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1051066014 9:13103995-13104017 AAGAGAAAATGGAAGGAGGGAGG - Intergenic
1051168893 9:14297550-14297572 ATCTGAAAATAGCAGGTGAGAGG - Intronic
1051551874 9:18338770-18338792 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1051718732 9:20012446-20012468 AATTCAAAATGAAATGTGGGTGG + Intergenic
1051790324 9:20795087-20795109 ATTAAAACATGGAAAGTGGGTGG + Intronic
1052397668 9:27960164-27960186 ATTTCAAAATGGAAGGAAGCTGG - Intronic
1052454082 9:28671628-28671650 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
1052694581 9:31859824-31859846 ACCTGAAGATGGAAGGTGGGAGG + Intergenic
1053211013 9:36228350-36228372 ATTTGAAACAGAAAGGAGGGTGG + Intronic
1053276947 9:36790342-36790364 ATTTGGAAATGGAAGGGGAAGGG + Intergenic
1054801895 9:69358152-69358174 AAGTGAGAATGGTAGGTGGGTGG - Intronic
1055292966 9:74802969-74802991 GGTTGAACTTGGAAGGTGGGTGG - Intronic
1055307483 9:74944644-74944666 ATTGGAAGGTGGAGGGTGGGAGG - Intergenic
1055387805 9:75782563-75782585 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1055406194 9:75976149-75976171 GTTAGAAAATGGAAGGTTTGGGG + Intronic
1055717452 9:79133441-79133463 ATTAGAAAGTGGAAAGTGGCCGG - Intergenic
1055746747 9:79455505-79455527 ATTGGAGGATGGAAGGTGGGTGG - Intergenic
1056489740 9:87093815-87093837 ATTGGAAGGTGGAGGGTGGGAGG - Intergenic
1057165050 9:92919147-92919169 ATCTGAAGGTGGAGGGTGGGAGG - Intergenic
1057376738 9:94531211-94531233 AAAAGAAAATGAAAGGTGGGTGG + Intergenic
1057618336 9:96613953-96613975 ATCTTAAAAAGGAAGGAGGGAGG + Intronic
1058414422 9:104771363-104771385 ACTTGAGAATGGAAGATGGGAGG - Intronic
1058604335 9:106704641-106704663 AGATGAAAATGGGAGGAGGGAGG + Intergenic
1058880555 9:109282417-109282439 TTTTAAAAATAGTAGGTGGGTGG + Intronic
1058916720 9:109574176-109574198 ATTTGAGAATGGAAGGTGGGAGG + Intergenic
1058995878 9:110298367-110298389 ATTTGAAAATGGAGGGCGGAGGG - Intergenic
1059515043 9:114885812-114885834 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1060397547 9:123326722-123326744 ATTTTAAACTGGAACTTGGGGGG - Intergenic
1060690889 9:125659004-125659026 CTTTGGAAAGGCAAGGTGGGAGG + Intronic
1061073200 9:128324568-128324590 ATTTGGGAATCCAAGGTGGGAGG + Intronic
1061643575 9:131980187-131980209 ATGGGAAAATGGGAGGCGGGTGG + Intronic
1062747089 9:138220405-138220427 AGTAGAGAATGGAAGGTGGAAGG + Intergenic
1185912313 X:3993604-3993626 ACTTGAGAGTGGAAGGTTGGGGG + Intergenic
1185919013 X:4068397-4068419 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1186106344 X:6211293-6211315 ATTTGAAAATTAGAGGCGGGAGG + Intronic
1186216810 X:7309387-7309409 ATTTGAGAGGGGAGGGTGGGAGG + Intronic
1186237609 X:7530512-7530534 ATTGGAGGATGGAGGGTGGGAGG + Intergenic
1186265342 X:7826938-7826960 ATTTGAGGAAGGAAGGAGGGAGG - Intergenic
1186330260 X:8525022-8525044 ACTTGAGGGTGGAAGGTGGGAGG - Intergenic
1186389044 X:9139847-9139869 ATTGGAGAGTGGAAGGTGGGAGG + Intronic
1186531761 X:10303835-10303857 ACTTGAGAAAGGAGGGTGGGAGG + Intergenic
1186850916 X:13579242-13579264 ATTTGAGAGTGGAGGGTGGGAGG - Intronic
1187236616 X:17474072-17474094 ACTTGAGGGTGGAAGGTGGGAGG - Intronic
1187306541 X:18100210-18100232 ACTTGAGGGTGGAAGGTGGGAGG + Intergenic
1187788622 X:22922446-22922468 ATTGGAGGGTGGAAGGTGGGAGG - Intergenic
1187845908 X:23537038-23537060 ACTTGACAATGGAGGATGGGAGG + Intergenic
1188163924 X:26838033-26838055 ATTGGAAGGTGGAAGGTGGGAGG - Intergenic
1188228014 X:27625854-27625876 ATTTGTGAGTGGAGGGTGGGAGG + Intronic
1188644012 X:32541645-32541667 ATTTGAGAGTGGAAGGTGGGAGG + Intronic
1188802471 X:34549144-34549166 CTTTGTAAATCCAAGGTGGGCGG - Intergenic
1188819070 X:34751383-34751405 ATTTGAAGATGGAGGGTGGGAGG - Intergenic
1188844748 X:35059044-35059066 ATTAGAAAATGGGAGGAGGAGGG - Intergenic
1188908857 X:35821006-35821028 ACTTGAGAATGGAGGGTGAGAGG - Intergenic
1188909159 X:35824140-35824162 ACTTGAGAATGGAGGGTGAGAGG - Intergenic
1189039287 X:37525339-37525361 AATTAAAAATGGAATGTGGGAGG + Intronic
1189211038 X:39282834-39282856 ACTTGAAGGTGGAAGATGGGAGG + Intergenic
1189545625 X:42039827-42039849 ACTTGACAAGGGAGGGTGGGAGG - Intergenic
1189685663 X:43561304-43561326 ATTGGAGGATGGAAGGTGGGAGG - Intergenic
1189842641 X:45097204-45097226 ATTGGAGTATGGAGGGTGGGAGG + Intronic
1190159302 X:48018755-48018777 ACTTGAAGGTGGAGGGTGGGAGG + Intronic
1190175015 X:48140984-48141006 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1190515235 X:51216829-51216851 ACTTGAGAGTGGAGGGTGGGAGG - Intergenic
1191012870 X:55778895-55778917 ACTTGAAGATGGAGGGTTGGGGG - Intergenic
1191088104 X:56590829-56590851 ATTTGAGGGTAGAAGGTGGGAGG - Intergenic
1191206434 X:57838725-57838747 ACTTGAAAGTGGAGGGTGGGAGG - Intergenic
1191661931 X:63660387-63660409 ACTTGAGGGTGGAAGGTGGGAGG + Intronic
1191743216 X:64457742-64457764 ATTAGAGAGTGGAGGGTGGGAGG - Intergenic
1191744590 X:64472597-64472619 ACTTGAAGGTGGAAGGTGGGAGG - Intergenic
1191810613 X:65183407-65183429 ATTTGAGGTTGGAGGGTGGGAGG + Intergenic
1191910118 X:66141156-66141178 ATTTGAAGGTGGAGGGTGGGAGG - Intergenic
1191968510 X:66787663-66787685 ATTAGAGAGTGGAGGGTGGGAGG + Intergenic
1192305468 X:69954817-69954839 ATTGGAGGGTGGAAGGTGGGAGG - Intronic
1192339002 X:70246749-70246771 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1192901355 X:75501115-75501137 ACTTGAGGATGGAAAGTGGGAGG - Intronic
1192962536 X:76145467-76145489 ATTTGCAACTGGGAGGCGGGCGG - Intergenic
1192962997 X:76149620-76149642 ATTTGCAACTGGGAGGCGGGCGG + Intergenic
1193090539 X:77489341-77489363 ATTTGAGAGTGGAGGGTGAGAGG + Intergenic
1193252277 X:79305713-79305735 ACTTGAAGGTGAAAGGTGGGAGG + Intergenic
1193456006 X:81732391-81732413 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1193464032 X:81825424-81825446 ATTGGAGAGTGGAGGGTGGGAGG - Intergenic
1193472964 X:81928815-81928837 ATTTGAGGGTGGAGGGTGGGAGG + Intergenic
1193631233 X:83890612-83890634 ACTTGAGAGTGGAGGGTGGGGGG - Intergenic
1193667513 X:84340097-84340119 AATGGGAAAGGGAAGGTGGGAGG + Intronic
1193674349 X:84431015-84431037 ACTTGAAGGTGGAAGGTGGGAGG - Intronic
1193746929 X:85293513-85293535 TTTAGAAGGTGGAAGGTGGGAGG + Intronic
1193934214 X:87595886-87595908 ATTTGAACATGAAATTTGGGTGG - Intronic
1193992353 X:88323605-88323627 ATCAGAAGAGGGAAGGTGGGAGG - Intergenic
1194260959 X:91695145-91695167 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1194382655 X:93214585-93214607 CTTTTAAAAAGTAAGGTGGGAGG + Intergenic
1194786518 X:98091479-98091501 ACTTAAGAGTGGAAGGTGGGAGG - Intergenic
1194796949 X:98223547-98223569 ATTTGTAAATGTAAGGTGCAGGG - Intergenic
1194914048 X:99683546-99683568 TTTTGAAAATGAGAGTTGGGGGG + Intergenic
1194945843 X:100066017-100066039 ACTTGAGGCTGGAAGGTGGGAGG + Intergenic
1194959946 X:100223756-100223778 ATTTGGTAATGGAAAATGGGTGG + Intergenic
1195429334 X:104770887-104770909 ATTGGAAGGTGGAAGGTGGGAGG - Intronic
1195483062 X:105370371-105370393 ATTTGATGGTGGAGGGTGGGAGG - Intronic
1195499249 X:105575324-105575346 ATTAGAAGGTGGAGGGTGGGAGG - Intronic
1196040429 X:111197073-111197095 ACTTGAGAGTGGAGGGTGGGAGG - Intronic
1196088953 X:111718332-111718354 ATTTGAAAGTGGAAGGGGCCTGG + Intronic
1196134141 X:112188780-112188802 ATAGGAAAATGGGAGGCGGGGGG - Intergenic
1196257985 X:113545289-113545311 ACTTGAAACTGGAAAGTAGGTGG + Intergenic
1196267105 X:113662844-113662866 TTTGGAGGATGGAAGGTGGGAGG + Intergenic
1196375148 X:115025518-115025540 ATGTGGAATTGGAAGGGGGGTGG - Intergenic
1196579939 X:117367067-117367089 ACTTGAAAGTGGAGGATGGGAGG - Intergenic
1196591975 X:117496057-117496079 ATTGGAAGATGGAGGGTGGGAGG + Intergenic
1196701456 X:118673809-118673831 ATTGGAAAATGGGAGTGGGGTGG - Intronic
1196727296 X:118907838-118907860 AAAAGAAAATGGAGGGTGGGAGG - Intergenic
1196832919 X:119790422-119790444 ACTTGCAAATGGTAGGTAGGTGG - Intronic
1197139386 X:123099100-123099122 ACTTGCACATGGAGGGTGGGAGG + Intergenic
1197377478 X:125699157-125699179 ATTAGAGAGTGGATGGTGGGAGG - Intergenic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1197699231 X:129585225-129585247 ATTTGAAAATGAATAGTGGATGG + Intronic
1197796279 X:130301875-130301897 TTTGGAGGATGGAAGGTGGGAGG + Intergenic
1197953313 X:131920493-131920515 ATTTGAAAATACACGGTGAGAGG + Intergenic
1198209686 X:134505554-134505576 TTTTGAAAATGGGAGTGGGGAGG - Intronic
1198320129 X:135512106-135512128 ACTTGAAGGTGGAGGGTGGGAGG + Intergenic
1198837717 X:140821829-140821851 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1199217029 X:145271620-145271642 AATTGAAGGTGGAGGGTGGGAGG + Intergenic
1199271902 X:145893843-145893865 ACTTGAAGGTGGAGGGTGGGAGG - Intergenic
1199641295 X:149864780-149864802 ATTTGAAGTTGGAGGGTGGGAGG + Intergenic
1199752301 X:150831592-150831614 ATTGGAGAGTGGAGGGTGGGAGG + Intronic
1199880584 X:151971607-151971629 AGTTGGAATTGGAGGGTGGGTGG + Intronic
1200336123 X:155353379-155353401 ATTTAAAAAAAAAAGGTGGGGGG + Intergenic
1200341056 X:155395996-155396018 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
1200350347 X:155487848-155487870 ATTTAAAAAAAAAAGGTGGGGGG - Intergenic
1200431191 Y:3084581-3084603 ATTTGAAGTTGAAAGGTAGGAGG - Intergenic
1200579610 Y:4933947-4933969 ATTTGAGGGTGGAGGGTGGGAGG - Intergenic
1201227328 Y:11830960-11830982 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1201587767 Y:15580237-15580259 ACTTGAGAGTGGAGGGTGGGAGG + Intergenic
1201717087 Y:17057103-17057125 ATATGAGAGTGGAGGGTGGGAGG + Intergenic
1201856072 Y:18544613-18544635 ATTTGTAAGTCCAAGGTGGGTGG + Intergenic
1201877249 Y:18775772-18775794 ATTTGTAAGTCCAAGGTGGGTGG - Intronic
1201898776 Y:19024453-19024475 ATTTGGTAATGGAAGGGGAGGGG + Intergenic
1201991242 Y:20029349-20029371 ACTTGAGAATGGAAGGTAGGAGG + Intergenic