ID: 932207200

View in Genome Browser
Species Human (GRCh38)
Location 2:69893748-69893770
Sequence GTGCATGTGGACAAAAATGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932207200 Original CRISPR GTGCATGTGGACAAAAATGG GGG Exonic
900771230 1:4546256-4546278 GTGCTTGTGGCCAAGAATGGAGG + Intergenic
904390977 1:30185804-30185826 GTGCATATGGTTGAAAATGGTGG + Intergenic
905898401 1:41564232-41564254 ATGGATGGAGACAAAAATGGAGG + Intronic
908022850 1:59916140-59916162 GTCCATGTGTTCAGAAATGGAGG + Intronic
908489114 1:64625249-64625271 GTGCATTTGGACAGAAAGAGTGG + Intronic
908540180 1:65114704-65114726 GTACATCTGGAGAAAAATGGGGG - Intergenic
909252594 1:73377704-73377726 GTGTATGTGGGCATTAATGGTGG + Intergenic
910967550 1:92822934-92822956 GTGCATGGGGAAAAGAAAGGGGG - Intergenic
911590899 1:99746492-99746514 GTGAATATGGAAAAAAAAGGTGG + Intronic
912265412 1:108152306-108152328 CAGCATGTGGACAGAAATGTAGG - Intronic
913423767 1:118703930-118703952 GTACATGTGGACACAAATATAGG - Intergenic
917121700 1:171650185-171650207 GTGTGTGTGTACAAAAATAGTGG - Intronic
919104356 1:193130356-193130378 GAGCACATGGACAAAAATGAAGG - Intronic
919454659 1:197807015-197807037 GAGGATGTGGACAAAAATGAAGG + Intergenic
919807857 1:201391387-201391409 GGGCAGGTGGATAAAGATGGTGG - Intronic
920841140 1:209554841-209554863 GTGCATGTACACATAGATGGTGG - Intergenic
921825060 1:219663214-219663236 TTTCATGTGGACAAAAATGAGGG - Intergenic
922017318 1:221663741-221663763 TTCCATGTGGACAAATTTGGGGG - Intergenic
922252429 1:223862207-223862229 GTGAATGGGTACAAAAATCGTGG - Intergenic
922757882 1:228106501-228106523 GTGCACGTGGACAACCATGTGGG - Intergenic
1067052765 10:43032221-43032243 GTGTATATAGACAAAATTGGGGG + Intergenic
1067328248 10:45290513-45290535 GTCAATCTGGACTAAAATGGTGG - Intergenic
1068232315 10:54184195-54184217 GTGGATTTAGACAAAGATGGTGG - Intronic
1071299830 10:84248162-84248184 GTGTTTGTGAACACAAATGGGGG + Intronic
1075333842 10:121595290-121595312 TTGACTGAGGACAAAAATGGAGG + Intronic
1079586681 11:22133946-22133968 GTACATGTAGACAAAAATAAGGG + Intergenic
1080196027 11:29610004-29610026 TTGTTTGTAGACAAAAATGGTGG + Intergenic
1083195589 11:61084065-61084087 TTGAATGTGGAAATAAATGGTGG + Intergenic
1084578696 11:70008673-70008695 GTGCATGTTGCCAAAGATGAAGG - Intergenic
1085863985 11:80266791-80266813 GTACATGTGGGAAAAAATGAAGG - Intergenic
1086162160 11:83733959-83733981 GTGCATGTGGACATACAGAGTGG - Intronic
1086403644 11:86481654-86481676 CTTCATGTGGACTAAAATAGAGG + Intronic
1087381833 11:97414476-97414498 GTACATGTGGACACAAAAAGAGG - Intergenic
1089144259 11:116312980-116313002 CTGCTTGGGGATAAAAATGGGGG + Intergenic
1089598753 11:119599925-119599947 GTGCATGTGAACAGAAGTGTGGG + Intergenic
1091030704 11:132185212-132185234 GTACATGTGCACACATATGGGGG - Intronic
1093569556 12:20651361-20651383 AAGCATGTGGAAAAAAATGAAGG + Intronic
1095295517 12:40523008-40523030 GTACATTTGAACAAAAATGCTGG + Intronic
1095295949 12:40527657-40527679 GTATATGTGAACAAAAATGCCGG + Intronic
1096179000 12:49540364-49540386 GTGAATGTGATCAAGAATGGGGG - Intronic
1099091496 12:78315989-78316011 ATGCATGTGGCCAAAACTGATGG + Intergenic
1099352101 12:81585585-81585607 GTGGAGGTGGACGACAATGGTGG - Intronic
1101125633 12:101630952-101630974 CTGCATGTGAACAGAAATGTTGG + Intronic
1101521257 12:105484486-105484508 GTGCATGTTCAGAAGAATGGAGG + Intergenic
1101565534 12:105901573-105901595 GTGAATGAGGAGAAAAATAGAGG + Intergenic
1107424317 13:40277467-40277489 GTGCATATGGAGAATAATGCAGG - Intergenic
1108267672 13:48728865-48728887 TTGAAGGTGGGCAAAAATGGTGG - Intergenic
1108507176 13:51122937-51122959 GTGCATGCTGAAAACAATGGGGG + Intergenic
1109992963 13:70082926-70082948 GCACATGTGGACATAAATGTGGG + Intronic
1111912026 13:94323542-94323564 GTGCATATGGACATAAAGTGTGG + Intronic
1112512986 13:100026472-100026494 GTGGATATGGCCAAAAAAGGTGG + Intergenic
1113202387 13:107881130-107881152 GTACATGTGGACACAAAGAGAGG + Intergenic
1114907019 14:27142293-27142315 GCTCAGGTGAACAAAAATGGTGG - Intergenic
1115156857 14:30350741-30350763 TTGCATGTGGACACAAATATGGG + Intergenic
1115438867 14:33408812-33408834 TTGCATATGGCCAAATATGGTGG + Intronic
1119126749 14:72134510-72134532 GTCCTTGGGCACAAAAATGGAGG + Intronic
1121437746 14:93930066-93930088 GTCCCTGTGGACAAAACAGGGGG + Intergenic
1121670331 14:95705125-95705147 GTGCATGTGTATAAAAAGGTTGG - Intergenic
1123008887 14:105337781-105337803 GTGCCTCTGAACAAAACTGGGGG + Intronic
1125108978 15:36008197-36008219 GTGCATGGGGACAAGTCTGGAGG - Intergenic
1126335052 15:47577904-47577926 ATGCATGTGGAAGAAAATGTAGG + Intronic
1128673600 15:69593191-69593213 GTGAATGTGGATAAACATGGTGG + Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1130760946 15:86819101-86819123 CTCCCTGTGGACAAAAATGCTGG - Intronic
1131162313 15:90114928-90114950 TTGCATCTCAACAAAAATGGAGG + Intergenic
1133579257 16:7127108-7127130 CTTCATGTGGTCATAAATGGTGG + Intronic
1135226908 16:20668651-20668673 GTGCTTGCTGAGAAAAATGGAGG + Intronic
1137055774 16:35746174-35746196 GTGCAGGTGGGCAGAAACGGGGG - Intergenic
1138515071 16:57531407-57531429 GTGACTGTGGACAAAGAAGGTGG - Intronic
1140092143 16:71847087-71847109 GTGCAGGTGTACACAAAAGGTGG - Intronic
1146737365 17:35250337-35250359 GAGCATCTGGACAAAAACAGGGG - Intronic
1147268329 17:39248441-39248463 GGGCAGGTGGAGAAAAGTGGGGG - Intergenic
1147552323 17:41452456-41452478 GTGGATGAGGAGAAAAAGGGAGG - Intergenic
1151973099 17:77469150-77469172 GTGAATCTGGACAAAGAAGGTGG + Intronic
1152660065 17:81537943-81537965 GTGGATGTGGACGGAAGTGGGGG - Intergenic
1154037584 18:10819214-10819236 GTGGATTTGGATAAAACTGGAGG + Intronic
1154101699 18:11480559-11480581 GAGAATGTTGACAAAAGTGGGGG + Intergenic
1155582946 18:27332000-27332022 GTGCATGTGTATATAAATGTGGG - Intergenic
1156112564 18:33745579-33745601 TTTCATGTTGACAAGAATGGCGG + Exonic
1157959174 18:52133483-52133505 CTCCATGTGGAAAAAAATTGTGG + Intergenic
1158060722 18:53337797-53337819 CTGCATATGGATAAAAGTGGAGG + Intronic
1159481097 18:68992418-68992440 GTCCAAGTGAACAGAAATGGAGG - Intronic
1162639425 19:11996466-11996488 GTGCATCTGGCCAGGAATGGTGG + Intergenic
1166207605 19:41282140-41282162 GTACATGTGTACAAATATGAAGG - Intronic
1166543498 19:43620780-43620802 GTGGAGCTGGACAGAAATGGAGG - Intergenic
926306762 2:11642970-11642992 GTGCAGGAGAACAAATATGGAGG + Intergenic
927465906 2:23336256-23336278 GTGTTTTTGGACAAAAAAGGTGG - Intergenic
931425755 2:62169510-62169532 GTGCATGTGGACACAAAGAGGGG - Intergenic
932207200 2:69893748-69893770 GTGCATGTGGACAAAAATGGGGG + Exonic
932826428 2:74945338-74945360 ATGCATGTGGTTAAAAATTGAGG - Intergenic
933417652 2:82007009-82007031 TTCCATGTGGACATAAATTGAGG - Intergenic
934499350 2:94842871-94842893 GTGCATGTGGTCAATTCTGGAGG - Intergenic
935437129 2:103046830-103046852 GTGCATGGGAACAAATATTGTGG + Intergenic
935561463 2:104564312-104564334 GTGCCTGTGGATTTAAATGGAGG - Intergenic
939364632 2:141216217-141216239 GTGTATCTGGACGAAAGTGGCGG - Intronic
940798435 2:158105050-158105072 AGGCATGTGGAGAGAAATGGAGG + Intronic
940834255 2:158502707-158502729 GTGCAGATGGACACAAAAGGTGG + Intronic
944977157 2:205066968-205066990 GTGCACCTGAACAAAACTGGGGG + Intronic
947045604 2:225979622-225979644 GGAAATGTGGACACAAATGGGGG - Intergenic
1171890573 20:30709573-30709595 GTGCATGTGGTCAATTCTGGAGG - Intergenic
1173163991 20:40673403-40673425 GAGCATCTGGACAAAAACTGTGG + Intergenic
1173412418 20:42825651-42825673 GTGCATTTGGAAGAAAATGGAGG - Intronic
1173861673 20:46287877-46287899 GTCCAGGTGAACAATAATGGTGG + Intronic
1174787103 20:53443452-53443474 CTTCATGTGGAAGAAAATGGAGG - Intronic
1179638949 21:42734330-42734352 ATGGATGAGGACAAAAAGGGTGG - Intronic
1183301031 22:37059279-37059301 GAGCATGGGGAGAAAAATGCAGG - Intronic
1183830595 22:40416633-40416655 GAGCCTTAGGACAAAAATGGAGG - Intronic
949421680 3:3872667-3872689 GGGCATATGGACACAAATGCAGG - Intronic
954431603 3:50473653-50473675 GTGCATTTGGAGAGCAATGGTGG + Intronic
954444919 3:50541431-50541453 CTGCATGGGAATAAAAATGGAGG - Intergenic
954466351 3:50657346-50657368 GTCCAAGAGGACAAACATGGAGG - Intergenic
957228677 3:77482444-77482466 GTGCATGTGTACCAGAATGCAGG + Intronic
957637258 3:82802302-82802324 ATCCATGGTGACAAAAATGGAGG - Intergenic
957793536 3:84971188-84971210 GTGCCTCTGGACAAGAATGTTGG - Intronic
959351951 3:105276852-105276874 GTGCATTTGGACAATGATGCTGG + Intergenic
959804746 3:110537849-110537871 GAACATGTGGTCAAAAATGAAGG - Intergenic
962661773 3:137608977-137608999 GTGCAAATGGACATAAATGCTGG - Intergenic
963523455 3:146385767-146385789 CTGCATTTGAACAACAATGGTGG - Intergenic
964133383 3:153316189-153316211 GTGCATGTGTATAAAAATAAAGG - Intergenic
964871533 3:161318714-161318736 ATGGATGTGGACCAAGATGGTGG + Intergenic
966717600 3:183029484-183029506 TTGCATGTGGAAAACAAAGGAGG - Intronic
967518338 3:190398614-190398636 GTGAAGGTGGAGAAAGATGGAGG - Intronic
967942430 3:194776571-194776593 GGGCCAGTGGAGAAAAATGGTGG - Intergenic
968494991 4:910499-910521 GGGCATGTGTCCAGAAATGGAGG - Intronic
968839971 4:2996176-2996198 GAGCATGTGGACACAAAAGGGGG + Intronic
971192060 4:24437283-24437305 GTACAGATGGACAGAAATGGAGG + Intergenic
972398486 4:38677848-38677870 GTGCATATGGATATAAATGAGGG + Intronic
973317459 4:48777478-48777500 GTGAATCTGCACAGAAATGGAGG + Intronic
975216082 4:71756651-71756673 GTTCATCTGGACAAAAAGTGGGG - Intronic
976082893 4:81375745-81375767 GTGGATGTGGACAACAACTGGGG - Intergenic
976749586 4:88440682-88440704 GTGCATGTGCTAAAAAAGGGGGG + Intronic
978451045 4:108834207-108834229 GGGAAGGTGGACAAAGATGGCGG - Intronic
978807918 4:112819924-112819946 AGGCATGTGGCCAAAAAAGGGGG - Intronic
981134614 4:141195947-141195969 GGGCATGTGGACAAAGATTATGG + Intronic
982718492 4:158834846-158834868 GTGTATATGGAAAGAAATGGAGG + Intronic
984391037 4:179133447-179133469 ATGCATTTTGACAAGAATGGGGG - Intergenic
987125464 5:14808229-14808251 GTACATGTAGAAAAAAATGCTGG - Intronic
987794126 5:22606034-22606056 CTGCCTCTGGACAATAATGGAGG - Intronic
988411261 5:30888625-30888647 GTACATGTGGACAAAATAGGAGG - Intergenic
989632314 5:43498033-43498055 GTGCTTGTGGACATAACTAGGGG - Intronic
989677871 5:43993533-43993555 GTGGAGGAGGAAAAAAATGGAGG - Intergenic
990701310 5:58477846-58477868 GGGCATATGTACAAAAATAGGGG + Intergenic
992566913 5:78005644-78005666 GTTCTAGTGGACACAAATGGTGG + Intronic
1000821506 5:165990286-165990308 GTGCATGTAGACCAAAGTGGGGG - Intergenic
1001182335 5:169532108-169532130 TCCCATGTGGACAAAAATTGTGG + Intergenic
1001430333 5:171656122-171656144 GAGTATGTGGCCAAAAATAGAGG - Intergenic
1001657821 5:173366255-173366277 GTACACATGGACAAAAAGGGAGG - Intergenic
1001825083 5:174737950-174737972 TTGCATGTGGAGAAAAATGTGGG - Intergenic
1002691557 5:181053664-181053686 GTTCATATGGACAAAAGCGGAGG + Intronic
1006217906 6:32460774-32460796 GTGTCTCTGGACAAAAAGGGAGG + Intergenic
1007664177 6:43504965-43504987 GTGCATGTGGACATGAGTGAGGG + Exonic
1009206725 6:60811091-60811113 GTCAATGTGGCCAGAAATGGAGG + Intergenic
1010254029 6:73737824-73737846 GAGCATGTGGAGAATGATGGCGG + Intronic
1011064184 6:83307207-83307229 TTTCAAGTGAACAAAAATGGTGG - Intronic
1011510566 6:88095654-88095676 TTGAATGTGGACACAAATGATGG - Intergenic
1011842135 6:91514630-91514652 GATCATGTAGACAAAGATGGAGG - Intergenic
1014139647 6:117926530-117926552 GTGCATGTGCACATATGTGGTGG + Intronic
1015314794 6:131806417-131806439 GTGCATGTGGTAAAAAAGAGGGG + Intergenic
1016179859 6:141132193-141132215 GAGCAGGAGGACAAAAATGAAGG - Intergenic
1016453645 6:144209610-144209632 GTGCATGTGTACACACAAGGTGG + Intergenic
1017390050 6:153927858-153927880 GAGCATGTGGATACAAAGGGAGG - Intergenic
1023575716 7:41624149-41624171 GAGCTGGTAGACAAAAATGGAGG + Intergenic
1024388453 7:48780194-48780216 ATGCCTGTGGCCAAGAATGGGGG + Intergenic
1025231846 7:57207811-57207833 TTGAATGTGGACACATATGGGGG + Intergenic
1028448580 7:90954013-90954035 ATTCATGTGGAGAAAAATTGGGG + Intronic
1028663223 7:93308283-93308305 GAGAATGAGGACAAAAATGGTGG - Intronic
1029440358 7:100583828-100583850 GTGCATGTGGACGAAGGGGGTGG + Intronic
1030242035 7:107338051-107338073 GTAGTTGTGGACAAAAATGTGGG - Intronic
1030984547 7:116225928-116225950 CTTCATGTGGATAAAAATGTGGG + Intronic
1032089221 7:128902927-128902949 GGGCATGTGGACAAGGAAGGCGG - Intronic
1032625017 7:133582165-133582187 GTACATGTGGACAAAAAGAAGGG - Intronic
1033621739 7:143068073-143068095 GGGCAAGGGCACAAAAATGGGGG - Intergenic
1033986931 7:147237433-147237455 GGGCATGTGCAGAAATATGGTGG - Intronic
1036793800 8:11741188-11741210 GTGCTTGTGGCCAGAAGTGGTGG + Intronic
1037332040 8:17752625-17752647 GTGCATGGGGACCACAAGGGAGG - Intronic
1037595477 8:20350710-20350732 CTGTTTGTTGACAAAAATGGCGG + Intergenic
1038853483 8:31304259-31304281 GTTCATGTTGTCACAAATGGTGG + Intergenic
1041307462 8:56477267-56477289 GTTCATTTGTACAAATATGGAGG - Intergenic
1041537621 8:58944546-58944568 GTGCATGTTGCCAAGAATTGAGG + Intronic
1045033964 8:98163051-98163073 CTGCATGTGGACAATCGTGGAGG - Intergenic
1045909229 8:107386194-107386216 GTACATGTGGACAAAAAGAAGGG + Intronic
1046261623 8:111775638-111775660 GTGCATGTGGCCAGACGTGGTGG - Intergenic
1046274146 8:111935091-111935113 CTGCCTGTTGACAAAAACGGAGG - Intergenic
1046979737 8:120324023-120324045 GTACATGTGGACACAAAGGAGGG + Intronic
1047068542 8:121315739-121315761 GTTCATGTGGAAAAAAATGCAGG - Intergenic
1047109165 8:121769375-121769397 GTTCATGTTGACCAAAATGTTGG - Intergenic
1050966401 9:11809594-11809616 GTGCATGTGAACACAAAGGAGGG - Intergenic
1051805558 9:20988922-20988944 GTGCATGTGTGCATATATGGAGG + Intronic
1053409421 9:37905978-37906000 GTGGATGAGGACAGAAATGAAGG - Intronic
1053657807 9:40237666-40237688 GTGCATGTGGTCAATTCTGGAGG + Intronic
1053908175 9:42866945-42866967 GTGCATGTGGTCAATTCTGGAGG + Intergenic
1054369930 9:64383938-64383960 GTGCATGTGGTCAATTCTGGAGG + Intronic
1054526789 9:66138559-66138581 GTGCATGTGGTCAATTCTGGAGG - Intronic
1054677559 9:67873692-67873714 GTGCATGTGGTCAATTCTGGAGG + Intronic
1056144935 9:83720152-83720174 GCCCATGTGGACCAAAATGGGGG - Intergenic
1058105785 9:100970199-100970221 TAGCTTGTGGACAAAAATGTGGG + Intergenic
1058969958 9:110072168-110072190 GTTGATGTGGGCAAAAATGAGGG + Intronic
1059070121 9:111126615-111126637 GAGCATGTGGGAAAAAATGGGGG + Intergenic
1060285845 9:122251601-122251623 GTGCATTTGGTCAAAAATGTAGG + Intronic
1061603124 9:131685860-131685882 GTGCATTTGGACAAACAGAGAGG + Intronic
1062108403 9:134768146-134768168 GTGGATGTGGAGAAGAATGGGGG + Intronic
1203560199 Un_KI270744v1:47350-47372 GTGCATGTGGTCAATTCTGGAGG - Intergenic
1188493061 X:30756175-30756197 GTGCATGTGCACACACATGCTGG - Intergenic
1189902814 X:45724935-45724957 GTGCACATGGACATAAATGTGGG - Intergenic
1190861659 X:54350708-54350730 CTGCATGTGAACAAATATGTAGG + Intronic
1193100510 X:77606196-77606218 GTACATGTGCACATAAATTGGGG - Intronic
1194574559 X:95596263-95596285 GTGAATGTGGAGCAAGATGGTGG + Intergenic
1196236593 X:113288496-113288518 ATGCATTTGGACATAAACGGAGG + Intergenic
1196871492 X:120116571-120116593 GTGCATGCTGCCAAATATGGAGG - Intergenic
1197451820 X:126628908-126628930 GGGCATGCTGATAAAAATGGTGG + Intergenic
1197648687 X:129042407-129042429 GTGCATGTGGACATCAGTGAGGG - Intergenic
1198456023 X:136818724-136818746 GTGGAGGTGGAAAAAAAAGGTGG - Intergenic
1200383277 X:155862168-155862190 GTACGTGTGGACACAAAGGGGGG - Intergenic
1201614479 Y:15882020-15882042 GAGGATGTGGAAAAAAAAGGGGG - Intergenic
1201615889 Y:15897755-15897777 GAGGATGTGGAAAAAAAAGGGGG + Intergenic