ID: 932209046

View in Genome Browser
Species Human (GRCh38)
Location 2:69912316-69912338
Sequence GGAGTCTAAGCTAGACTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932209046 Original CRISPR GGAGTCTAAGCTAGACTTGT TGG Intronic
902925098 1:19690736-19690758 GGAGTCATAGCCAGAGTTGTAGG - Intronic
907107568 1:51897912-51897934 GGATGCTAAGATAGACTTCTAGG - Intergenic
908729767 1:67213945-67213967 CTGGTCTAAGCTAGACTTCTAGG - Intronic
920509672 1:206541638-206541660 GGGGTCTAGGGTAGACTTGAAGG - Intronic
924394200 1:243600750-243600772 AAAGTCAAAGCTAGACCTGTTGG - Intronic
1064767030 10:18685505-18685527 GGAGTCTCATCTAGAAATGTAGG - Intergenic
1067381759 10:45780493-45780515 GGATTCTAAGCAAGCCATGTAGG + Intronic
1069837908 10:71320653-71320675 GGAGTTTAAAATAGACTTGCTGG + Intronic
1071201752 10:83227287-83227309 GGAGACTAAGCTGGCTTTGTGGG - Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1074090818 10:110253063-110253085 GAAGTTTATGCTATACTTGTGGG + Intronic
1078609088 11:12803851-12803873 GAATTCTAATCTAGACCTGTTGG + Intronic
1079003799 11:16778804-16778826 GGAGTCTGAGCTAAACTAGTGGG + Intronic
1079713992 11:23721323-23721345 GTGGCCTAAGATAGACTTGTTGG - Intergenic
1080835619 11:35937724-35937746 GTCGTCTAAGCTAGAACTGTGGG - Intergenic
1086250065 11:84802152-84802174 GGATTCTAGGCTAGAATTCTAGG + Intronic
1086262484 11:84957187-84957209 GGACTCAAACCTAGACTTGCTGG + Intronic
1088283257 11:108159526-108159548 GGATTCAAACCCAGACTTGTAGG + Intronic
1091691925 12:2603134-2603156 GGATTCAAATCTGGACTTGTAGG - Intronic
1093215861 12:16360774-16360796 GGAGTCTAAGTGACACTTGCTGG + Intronic
1096692354 12:53328873-53328895 GGAGGCTGAGCTGGACCTGTGGG + Exonic
1111744390 13:92248289-92248311 GGAACCTAAGCTTGATTTGTTGG - Intronic
1122673505 14:103390400-103390422 GGAGCCTAAGCTAGAGATCTGGG - Intronic
1123763641 15:23452874-23452896 GGAACCTAAGCTTGATTTGTTGG - Intergenic
1127415808 15:58756105-58756127 GGAATCTAAGCAGGACTTGGAGG + Intergenic
1127647868 15:60975625-60975647 GGAGGCTAAGCTGGATTTCTGGG + Intronic
1128441895 15:67717788-67717810 GAAGTCTAAGCTAGCCATGAAGG - Intronic
1129696267 15:77742155-77742177 CCAGTCTGAGCTAGGCTTGTGGG - Intronic
1132229746 15:100172628-100172650 GGGGTCTAAGCCAGAGTGGTGGG - Intronic
1141357183 16:83358224-83358246 GGGGTCTATGTTAGACTTCTAGG + Intronic
1144250213 17:13408824-13408846 GGAGTCTGAGCTGGGCTTGCTGG + Intergenic
1144819484 17:18061709-18061731 ATAGTCTAACCTAGACTTGCTGG - Intronic
1145826936 17:27884175-27884197 AGAGGTTAAGCTAGAGTTGTGGG - Intronic
1146218706 17:30999628-30999650 GGAGACTAAGTTAGCCATGTGGG + Exonic
1158678306 18:59543031-59543053 AGAATCTAAGTTATACTTGTTGG - Intronic
1163178818 19:15584380-15584402 GGAGTCTAAGCCAGGCTCGGAGG + Intergenic
1163344652 19:16732854-16732876 GGAGTCTCAGCTTAACTTGAGGG + Intronic
1167154490 19:47729988-47730010 GGAGTCTAAGCAAGACCAGGAGG - Intronic
926886924 2:17606491-17606513 GGAACCTAAGCTAGAAGTGTAGG - Intronic
929299996 2:40292428-40292450 AGTGTCTAAGCTAGATTTTTGGG + Intronic
929418076 2:41764121-41764143 GGAGTCCAAGCAAGACATGATGG + Intergenic
930609861 2:53529987-53530009 GAAGACAAACCTAGACTTGTAGG - Intergenic
931554266 2:63482702-63482724 GAAGACTAACCTAGACCTGTGGG + Intronic
931814106 2:65883441-65883463 GGAGTCTGAGCTAGACCATTTGG + Intergenic
932209046 2:69912316-69912338 GGAGTCTAAGCTAGACTTGTTGG + Intronic
939374520 2:141346502-141346524 GGAAACTAAGCTAGAGATGTGGG + Intronic
939895403 2:147785295-147785317 GGACTCTTAGCTGGACTTGATGG - Intergenic
947047462 2:226004774-226004796 AGACTCTAAACTAGACTTTTGGG - Intergenic
948147295 2:235717096-235717118 TGAGTCTAGGGTAGACTTGGGGG - Intronic
1169636713 20:7700377-7700399 ACAGTTTAATCTAGACTTGTGGG + Intergenic
1173352694 20:42259800-42259822 AAAGTCTAAGCCACACTTGTGGG - Intronic
1181884130 22:26005811-26005833 GGAGTTTATGCTAAACTTTTGGG + Intronic
1182477046 22:30581999-30582021 CGAGTCTGAGCTAGACCTGAAGG - Intronic
1183856031 22:40636040-40636062 GGAGGCTCAGCTGGACTTGTTGG - Intronic
953251330 3:41247751-41247773 TGAGTCTAGGCTAGACTAGTGGG + Intronic
956149046 3:66222084-66222106 GATGTCTTAGCCAGACTTGTAGG + Intronic
957026245 3:75185600-75185622 GAAACCTAAGCTAGACTGGTGGG + Intergenic
959643002 3:108662924-108662946 GGATTTTAAACTAGACTTCTTGG - Intronic
963275972 3:143330059-143330081 GGAGTCTAAGCCAGGCATGGGGG - Intronic
964254619 3:154762124-154762146 GGATTCTAAGCTGGTCATGTTGG - Intergenic
965110553 3:164415888-164415910 AGAGTCTGAGCCAGATTTGTTGG + Intergenic
978074288 4:104509804-104509826 AGAGTCTCAGCTACACTTGAGGG - Intergenic
979039635 4:115772706-115772728 ATAGTCTAAGCTAGATTAGTTGG + Intergenic
979546651 4:121948003-121948025 GGAGTCCAAGCTAGATTTTGAGG - Intronic
981702285 4:147619807-147619829 AGAGTCCAAGCAAGACATGTTGG - Intronic
983547274 4:168977378-168977400 GGAGTCTAAGAAGGACTAGTTGG - Intronic
984321594 4:178204170-178204192 GGAGATTAATCTAGTCTTGTGGG - Intergenic
988448794 5:31318625-31318647 GAAATCTGAGCTCGACTTGTAGG - Intronic
988924364 5:35974377-35974399 GGAGTGTAAGCTAGCATGGTTGG + Intronic
991201542 5:63999903-63999925 GGAGGCTAACCTAAACATGTGGG + Intergenic
998540002 5:142971879-142971901 GGAGTTTAAGATACAGTTGTGGG + Intronic
1002870653 6:1164723-1164745 GGATGGTAAGCCAGACTTGTGGG - Intergenic
1010142523 6:72627645-72627667 GGAGTCTAACCTACACTACTGGG - Intronic
1011104775 6:83767463-83767485 GGAGATTAAGCTACACTTCTAGG + Intergenic
1026650388 7:72211133-72211155 GGAGCCTAAGTTAGTTTTGTTGG - Intronic
1030382028 7:108822720-108822742 GAAGTCTGGGCTAGACTTGTAGG + Intergenic
1041759217 8:61345885-61345907 GAAGGCTTAGCTTGACTTGTGGG + Intronic
1041775786 8:61521504-61521526 GGACTCTAACCTAGGATTGTTGG + Intronic
1044514002 8:93117326-93117348 GGGCTCTAAGCTAGATTTGAAGG - Intergenic
1050017720 9:1252666-1252688 GGAATTTATGCTAGGCTTGTTGG + Intergenic
1057904889 9:98975719-98975741 GGAGTCTGAACTAGATTTGAGGG + Intronic