ID: 932209227

View in Genome Browser
Species Human (GRCh38)
Location 2:69914195-69914217
Sequence CCGATTCCAGCTCTTTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932209227 Original CRISPR CCGATTCCAGCTCTTTCTTG AGG Intronic
902579105 1:17397167-17397189 GCGGCACCAGCTCTTTCTTGGGG - Intronic
904026859 1:27509488-27509510 CCCACTCCAGCTCTGTTTTGGGG + Intergenic
904714497 1:32457118-32457140 CCCATTCCCTCTCTTTCCTGGGG - Intergenic
904751711 1:32744719-32744741 CTGATTCCACCACTGTCTTGTGG + Intronic
904752755 1:32751140-32751162 GGCATTCCAGCTCATTCTTGTGG + Intronic
905010944 1:34746688-34746710 CAGATTCCAGCTGTTGGTTGGGG - Intronic
905905989 1:41618889-41618911 CTGATTCCAGCTCCATTTTGAGG - Intronic
906517799 1:46449760-46449782 CTGAGTCCAGCCCTTGCTTGGGG + Intergenic
908602523 1:65756428-65756450 CCAATTCTAGGTCTTTCTTCTGG - Intergenic
908621164 1:65981844-65981866 TCAGTTCCAGCCCTTTCTTGGGG - Intronic
911772082 1:101757507-101757529 CTTATTACAGCTCTTTCTTCTGG - Intergenic
914677482 1:149916087-149916109 GCAGTTCCAGCTCTTTCATGGGG - Intronic
914822804 1:151118034-151118056 CTGCTTCCTGCTCTTTCTTTAGG - Exonic
924787565 1:247212271-247212293 CTGATTGCAGCTGTTTCTAGGGG + Intergenic
1063167336 10:3475483-3475505 GCGATTCCAGCCCTTTCTGGAGG + Intergenic
1066074215 10:31856402-31856424 GCGTTTCCAGCTCTGTATTGTGG - Intronic
1067220848 10:44343242-44343264 CTGATTCCACCTCTCTCCTGGGG + Intergenic
1073078125 10:100837211-100837233 CTGATTCAGGCTCTTGCTTGTGG + Intergenic
1077571284 11:3340426-3340448 CCGATTCCAGCTCTGCCTGCAGG + Intronic
1081560993 11:44216384-44216406 CAGATTCCTTCACTTTCTTGCGG + Intronic
1082734818 11:56844815-56844837 CTGATTCCTGCTCTTTCTCCTGG + Intergenic
1088033231 11:105277734-105277756 CCCTTTCCAGTCCTTTCTTGGGG + Intergenic
1095939309 12:47715864-47715886 CCGATTCCTGGACTTTATTGCGG + Intronic
1099434398 12:82626399-82626421 CCTATTCTAGCTTTTTCTTCTGG + Intergenic
1100404571 12:94262371-94262393 CCCTTTCCAGCTCTTTCTACTGG + Intronic
1102421937 12:112810172-112810194 TGATTTCCAGCTCTTTCTTGAGG - Intronic
1103171742 12:118826550-118826572 CCTTTTCCACCTCTTTCTTCTGG + Intergenic
1104805316 12:131586102-131586124 CCGAGCCCAGCTCTGCCTTGGGG - Intergenic
1111718674 13:91913538-91913560 CAGATCCCAGCTTTTTTTTGAGG - Intronic
1114806752 14:25846512-25846534 CTGATTCCAGCTTTTGCTTTGGG + Intergenic
1116430861 14:44843852-44843874 CAAATTCCAGTTCTCTCTTGGGG + Intergenic
1116969724 14:51051664-51051686 CCTATTCCATCTTTTTCTTTGGG - Intronic
1121581491 14:95035575-95035597 GCAATTGCAGCTCTATCTTGAGG + Intergenic
1125605282 15:40936754-40936776 CCACTTCCAGCTCCTTCTTCTGG - Exonic
1130435841 15:83898596-83898618 CCCATTTCTGCTCTTTCATGTGG - Intronic
1136316237 16:29455931-29455953 TCGGATCCAGCTCTTTCTTGAGG + Intronic
1136430814 16:30195273-30195295 TCGGATCCAGCTCTTTCTTGAGG + Intronic
1138252396 16:55511835-55511857 CTCATTCCAACTCTTTCTTCAGG + Intronic
1138622255 16:58221349-58221371 CCACTTTCAGCTCTTTCTTCTGG - Intergenic
1148259779 17:46171367-46171389 CAGACTCCAGCTCTAACTTGGGG - Exonic
1153414541 18:4832141-4832163 CCAATTCCAGCTCTGCCTGGAGG + Intergenic
1155002812 18:21703848-21703870 CCGATTACAACTCTTTCTGGAGG + Intronic
1157075760 18:44465689-44465711 CCGAGTCCAACTCTTTCATTTGG + Intergenic
1157083795 18:44556222-44556244 CCAAGTCCATCTCTTTCTTGAGG - Intergenic
1161880562 19:6948429-6948451 CAGATACCAGGTCCTTCTTGAGG - Intergenic
1162901269 19:13796469-13796491 CAGATTCCACCTGTTCCTTGGGG + Intronic
1162998440 19:14350990-14351012 CTGAATCCCGCTCTTGCTTGCGG - Intergenic
1164656168 19:29923556-29923578 AAGATTCCAGTTCTATCTTGTGG - Intergenic
1167517625 19:49932555-49932577 TCTGTTCCAGCTCCTTCTTGAGG - Exonic
1168254923 19:55159906-55159928 CCGATTCCAGCTCCTCTATGTGG - Exonic
925905408 2:8537037-8537059 CAGACTCCAGCTATGTCTTGGGG + Intergenic
926731450 2:16038793-16038815 CCCGTTCCAGCTGTTTCTGGCGG + Intergenic
932209227 2:69914195-69914217 CCGATTCCAGCTCTTTCTTGAGG + Intronic
935130556 2:100258013-100258035 CTAATCCCAGCTCTTTCTAGCGG + Intergenic
937458128 2:122061752-122061774 CAAATTCCAGCTCTACCTTGGGG - Intergenic
938764624 2:134452220-134452242 CAGAATCCAGCCCTTTCTTGAGG - Exonic
939282050 2:140076296-140076318 CCGAATACTGCTCTTTCTGGTGG - Intergenic
939884647 2:147668232-147668254 ACATTTCCAGCTCTTTCTTTCGG + Intergenic
939966939 2:148619543-148619565 CCGATTTGAGCTCTTACTTCTGG - Intergenic
943583795 2:189714644-189714666 CCAATTCCTGCTTTGTCTTGTGG - Intronic
943645399 2:190404535-190404557 CCAAATCCAGCCCTTTCTTCTGG + Intergenic
947735038 2:232449925-232449947 GTGATTCCAGTTCTTTCCTGAGG - Intergenic
1173522876 20:43712269-43712291 CCGTTCCCAGCTCTCCCTTGAGG - Intronic
1179138099 21:38698364-38698386 CCGTTTCCAGCTCTTTCCAGTGG + Intergenic
1179353979 21:40641523-40641545 CTGGTTCCAGTTCTTTCTTTTGG + Intronic
1182386227 22:29943789-29943811 CCAATGCCAGCTCCTTCATGTGG + Intronic
1183464806 22:37974142-37974164 CCGACTGCAGCTCTGTCTTCGGG + Exonic
1183585437 22:38750618-38750640 CCCATTCCAGCACTTTCCTGTGG - Intronic
1184942512 22:47779536-47779558 CTGAGTCCAGCTCCTTCCTGGGG - Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950574813 3:13825879-13825901 CCGGTCCCAGCTATTTATTGGGG - Intronic
951570861 3:24061774-24061796 ACACTTCCAGCTCTTTCTTCTGG - Intergenic
951576868 3:24123187-24123209 CCAATTCCAGGCCTTTATTGGGG + Intronic
954960981 3:54564755-54564777 CCTCATCCAGCTCCTTCTTGTGG + Intronic
957376603 3:79366770-79366792 AGGATTCCAGCTGTTTCTTCAGG - Intronic
959285490 3:104403511-104403533 CAAATTCCTGCTCTTTCTTTAGG - Intergenic
960944113 3:122954316-122954338 CCTGTTCCAGCCCTTTCCTGAGG + Intronic
961638765 3:128351511-128351533 CCGATTCCAGGTCTGTGGTGAGG - Intronic
964641673 3:158915450-158915472 CCGTTGCAAGCCCTTTCTTGTGG - Intergenic
966876467 3:184324895-184324917 CCTCTTCCAGCTCTTCCTTCAGG - Exonic
974650184 4:64744942-64744964 ACTATTCCAGCTCTTTTTTTTGG + Intergenic
975813954 4:78198038-78198060 CTGATTTCAGCTCTTTATTTTGG + Intronic
977316781 4:95460025-95460047 CAGATTCCAGTTATTTCTTGTGG + Intronic
982274214 4:153622946-153622968 CCGATTCCAGCTCTGACTGTGGG + Exonic
984356855 4:178671323-178671345 CTAATTCCAGCTCATTCTTACGG + Intergenic
986103267 5:4633440-4633462 CCCATTCCAGCTCTTGGTGGAGG + Intergenic
986134933 5:4967820-4967842 CCAATTCCATCTCATTATTGTGG - Intergenic
987297228 5:16564623-16564645 CCTATGCCAGCTCTTCCCTGGGG + Intronic
998249050 5:140537346-140537368 CCTATTCCATCTGTTTCTTCGGG + Intronic
999844214 5:155460636-155460658 CAGAGTCCAGTTCTTTCATGGGG + Intergenic
1000878926 5:166673835-166673857 CTAATGCCAGCTCTTTCGTGAGG + Intergenic
1001333608 5:170779725-170779747 CTGATTTCAGCTCTGTGTTGAGG - Intronic
1002493798 5:179598508-179598530 CTGGTTCCTGCTCTTTCTTGTGG + Intronic
1003517469 6:6828770-6828792 CAAATTTCAGCTCCTTCTTGGGG - Intergenic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1004813876 6:19291378-19291400 CTGATTCCAGCTCAGGCTTGTGG + Intergenic
1004922893 6:20393792-20393814 CTGATTGTACCTCTTTCTTGTGG - Intergenic
1004979665 6:21009203-21009225 CAGATTCAAGCTCTAGCTTGTGG + Intronic
1015121445 6:129705445-129705467 CCTATACCAGGCCTTTCTTGGGG - Intronic
1018240734 6:161771419-161771441 CCTGTGACAGCTCTTTCTTGTGG - Intronic
1023545043 7:41310053-41310075 CCAATTAGAGCACTTTCTTGAGG + Intergenic
1026898229 7:74022746-74022768 CAGATTCCAGCACAGTCTTGGGG + Intergenic
1026934840 7:74248338-74248360 ACCATGCCAGCTTTTTCTTGTGG - Intronic
1027566898 7:79806523-79806545 CAGATTCCAGCTCCCTCTGGAGG - Intergenic
1033529645 7:142248944-142248966 CTGCTCCCAGCTCTTTATTGAGG - Intergenic
1036545162 8:9761183-9761205 CTGATTCCTCCTCTATCTTGAGG + Intronic
1042876982 8:73449006-73449028 CCGACTCCAGCTCATCCTTGAGG - Intronic
1042881575 8:73498503-73498525 CCAAATCTAGCTCTTCCTTGGGG + Intronic
1045338815 8:101233529-101233551 CCTATTCCAGCTCCTTCTAGGGG - Intergenic
1047172446 8:122507033-122507055 CAGCTTCCAGCTCTTCATTGAGG + Intergenic
1047344751 8:124016203-124016225 CCCATTCCTGCCTTTTCTTGTGG - Intronic
1050704556 9:8382430-8382452 CCCATTCCAGCTCTTTACTCAGG + Intronic
1051218093 9:14820470-14820492 CCTTTACCAGCTCTTTCTTCAGG - Intronic
1058408205 9:104701071-104701093 CTTATTTCAGCTCTTTATTGTGG - Intergenic
1193365717 X:80629865-80629887 CCCTTTCCATCTCCTTCTTGAGG - Intergenic
1196881801 X:120205678-120205700 TGGATGCCAGCTCTTTCTTTAGG + Intergenic