ID: 932212348

View in Genome Browser
Species Human (GRCh38)
Location 2:69943164-69943186
Sequence AAACCAGTAGGTGGGATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932212348_932212354 2 Left 932212348 2:69943164-69943186 CCCATCATCCCACCTACTGGTTT 0: 1
1: 0
2: 3
3: 14
4: 205
Right 932212354 2:69943189-69943211 CCTGCTCGTTGACTCATTCTTGG 0: 1
1: 0
2: 0
3: 0
4: 70
932212348_932212355 23 Left 932212348 2:69943164-69943186 CCCATCATCCCACCTACTGGTTT 0: 1
1: 0
2: 3
3: 14
4: 205
Right 932212355 2:69943210-69943232 GGCTGACTTGCCCTTTGTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 167
932212348_932212356 24 Left 932212348 2:69943164-69943186 CCCATCATCCCACCTACTGGTTT 0: 1
1: 0
2: 3
3: 14
4: 205
Right 932212356 2:69943211-69943233 GCTGACTTGCCCTTTGTTTTGGG 0: 1
1: 0
2: 0
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932212348 Original CRISPR AAACCAGTAGGTGGGATGAT GGG (reversed) Intergenic
902885197 1:19399776-19399798 AAACCACTAGATGAGATAATCGG + Intronic
903289510 1:22299202-22299224 AAACCAGTAGCTGGGATTACAGG + Intergenic
903362899 1:22788154-22788176 ATGCCAGGAGGTGGGATCATGGG + Intronic
908925940 1:69255263-69255285 AACCAAGTAGCTGGGATTATAGG - Intergenic
910089229 1:83442344-83442366 AACCCAGTAGCTGGGATGATGGG - Intergenic
910453222 1:87368266-87368288 AAACAAGTATGTGGGAGCATTGG + Intergenic
910734786 1:90441679-90441701 TCACCAGTAGCTGGGATTATAGG - Intergenic
911104230 1:94117497-94117519 AACCCAGAAGCTGGGATGAAGGG + Intronic
914723094 1:150305522-150305544 AAACAAGTATGTAGGATGCTTGG + Intronic
916152263 1:161806492-161806514 AAATCAGTAGGTGGGAATAATGG + Intronic
916421719 1:164643803-164643825 TAACCAGTAAGTGGCATGGTTGG + Intronic
917492367 1:175508374-175508396 ATACCAGGAGGTGGCATGACTGG - Intronic
918245379 1:182655014-182655036 AAACCACTAGGTGCGGTGCTGGG - Intronic
918330710 1:183457954-183457976 TACCCAGTAGCTGGGATTATAGG + Intergenic
918924758 1:190768126-190768148 AATCCAGTAGCTGGGATTACAGG + Intergenic
919942996 1:202301182-202301204 AATCCAGTTTGTGGGAAGATCGG + Exonic
922956857 1:229610263-229610285 AACCCAGTACGTGGCAGGATGGG + Intronic
1063677386 10:8153585-8153607 ATCCCAGTAGCTGGGATTATAGG - Intergenic
1069414730 10:68188231-68188253 ACACCAGTAGCTGGGATTATAGG + Intronic
1070126882 10:73629662-73629684 GTACAAGTAGGTGGGATTATAGG + Intergenic
1070218114 10:74408101-74408123 TACCCAGTAGCTGGGATTATAGG + Intronic
1070528834 10:77318510-77318532 ATACTAGAAGGTAGGATGATAGG - Intronic
1073629093 10:105130216-105130238 AAACCAGAAAGTGGTATGAGCGG + Intronic
1074141288 10:110675283-110675305 AAAAAAATAGGTAGGATGATGGG + Intronic
1075701408 10:124471890-124471912 TACCCAGTAGCTGGGATTATAGG + Intronic
1077552792 11:3208844-3208866 CAGCCAGTAGGTGGGATGCCAGG + Intergenic
1077716856 11:4589719-4589741 AACCCAGTAGTAGGGCTGATTGG + Intergenic
1078022055 11:7664592-7664614 GAACCAGTAGGTGAGAGAATGGG + Intergenic
1078678765 11:13454591-13454613 TACCAAGTAGGTGGGATTATAGG - Intronic
1079644726 11:22849413-22849435 AAACCAGTTGGTGGGATGAATGG + Intronic
1079705233 11:23607463-23607485 AAACCAGAAGCTGGGAGGAAAGG + Intergenic
1082944268 11:58741273-58741295 AACCTAGGAGGTGGGATTATGGG - Intergenic
1084601355 11:70147621-70147643 AAATCAGAAGGTGGGAGGAAGGG + Intronic
1084897526 11:72284768-72284790 TCCCCAGTAGGTGGGATTATAGG + Intergenic
1086404381 11:86487527-86487549 GAACCAGAAGGTGGGAGGAGAGG + Intronic
1087745040 11:101934285-101934307 AGACCATTAGGTTGGATGAATGG - Intronic
1088919522 11:114251103-114251125 AAAGCAGCAGGTGGGCTGAGTGG - Intergenic
1089495561 11:118907185-118907207 TAACCAGTAGGTGGCAGCATAGG + Intronic
1089828863 11:121306734-121306756 ACTCCAGAAGGTGGGAGGATGGG + Intronic
1089930268 11:122303181-122303203 AAGCAAGTAGGTGGGATTACAGG + Intergenic
1090152491 11:124400304-124400326 AAATCAGTATGTGAGTTGATAGG - Intergenic
1091967833 12:4760522-4760544 ACACCAGGAGGAGGGATCATGGG + Intronic
1093378020 12:18455274-18455296 ACACCAGTAGGTGGGATCATTGG + Intronic
1094038556 12:26097825-26097847 AAACCAGAATGTGTGAAGATGGG + Intergenic
1094212792 12:27910193-27910215 CAAAAATTAGGTGGGATGATGGG - Intergenic
1096645110 12:53029000-53029022 ACCCGAGTAGCTGGGATGATAGG - Intronic
1098051471 12:66458506-66458528 TACCCAGTAGCTGGGATTATAGG + Intronic
1101115352 12:101525989-101526011 AATCCAGTAGCTGGGATTACAGG - Intergenic
1101656965 12:106730874-106730896 TCCCCAGTAGCTGGGATGATAGG - Intronic
1101978274 12:109381680-109381702 AACCAAGTAGCTGGGATTATAGG - Intronic
1102165112 12:110799791-110799813 ACACCAGGAGGTGGGATCTTGGG + Intergenic
1102447365 12:113013992-113014014 AAACCATTAGATGAAATGATGGG + Intergenic
1105640099 13:22253040-22253062 TAGCCAGTAGCTGGGATTATGGG + Intergenic
1106802220 13:33267866-33267888 AAACTAGAGGGTGGGATGAAGGG + Intronic
1108242132 13:48475704-48475726 ATACCAGGAGGTGGGGTCATTGG + Intronic
1110243859 13:73299401-73299423 AACCCAGTAGGTGGTAAGGTAGG + Intergenic
1111536972 13:89614569-89614591 TAACCAGTAGCTGGGATCACAGG + Intergenic
1112624529 13:101089019-101089041 AACCCAGTAGCTGGGATTACAGG + Intronic
1112943806 13:104899345-104899367 AAACCATTAGTGGGAATGATTGG - Intergenic
1115909854 14:38243400-38243422 AAATAAGTAGGTGAGGTGATGGG + Intergenic
1118242639 14:64074770-64074792 ATCCCAGTAGCTGGGATTATAGG - Intronic
1119810097 14:77510594-77510616 TACCAAGTAGGTGGGATTATAGG + Exonic
1121805189 14:96812889-96812911 AAACCAGTAGGTAAAATGCTTGG + Intronic
1126397967 15:48239388-48239410 TTCCAAGTAGGTGGGATGATAGG - Intronic
1126439276 15:48670375-48670397 AAAGCAATGGGTGGGATGAAAGG + Intergenic
1126728832 15:51660565-51660587 AAAGCAGAATGTGGAATGATGGG - Intergenic
1129089098 15:73130095-73130117 AAATGAGTAGCTGGGATTATAGG + Intronic
1130327168 15:82890216-82890238 ACCCAAGTAGGTGGGATTATAGG - Intronic
1133836475 16:9372119-9372141 AAGCTAGTAAGTGGCATGATGGG + Intergenic
1133950151 16:10384943-10384965 CAACAAGTAGCTGGGATTATAGG - Intronic
1134687956 16:16171876-16171898 AAATGAGTAGGTGGGATGGATGG + Intronic
1136591835 16:31222267-31222289 AACCAAGTAGCTGGGATTATAGG - Intronic
1137928386 16:52563530-52563552 CTCCCAGTAGGTGGGATGACAGG - Intergenic
1138033347 16:53578762-53578784 AATCCAGTAGATGGGATGACTGG - Intergenic
1139606987 16:68026112-68026134 ACCCCAGTAGGTGGGATTACAGG + Intronic
1140490744 16:75333831-75333853 AAACCAGAATGTGGTATGAAAGG - Intronic
1140505938 16:75472843-75472865 AAAGCACTAGATGGGCTGATGGG - Exonic
1140691405 16:77487878-77487900 GTACCAGAAGGTGGGATCATGGG + Intergenic
1141139558 16:81488489-81488511 AAACCTGCAGGTGGAATGAGTGG - Intronic
1142357177 16:89606817-89606839 AAAAAAGTAGCTGGGATTATGGG + Intergenic
1142413470 16:89928017-89928039 CAAGCAGTAGGTGGGAAGCTTGG + Intronic
1143850311 17:9806338-9806360 AAACCAGTTACTGTGATGATGGG - Intronic
1144310957 17:14013980-14014002 ATACCAGGAGTTGGGATCATGGG - Intergenic
1144494214 17:15736608-15736630 AAACCAGGACATGGGATGCTTGG - Intronic
1144906047 17:18640068-18640090 AAACCAGGACATGGGATGCTTGG + Intronic
1148466793 17:47869725-47869747 TAACCTGAAGGTGGGATAATGGG + Intergenic
1152840772 17:82566714-82566736 AAAGCAGCAGGTGGGAGGAGAGG - Intronic
1152981702 18:284053-284075 TCCCCAGTAGGTGGGATTATAGG - Intergenic
1155468148 18:26162134-26162156 AAATAAGTATGTGAGATGATGGG - Intronic
1156279407 18:35620308-35620330 AAATCAGTGGGTGGGAATATGGG - Intronic
1156493529 18:37510993-37511015 TGACCAGGAGGTGGGGTGATGGG - Intronic
1156612863 18:38748267-38748289 TAACGAGTAGCTGGGATTATAGG + Intergenic
1156677627 18:39549438-39549460 GAACCAGTAGCTGGGATAATAGG + Intergenic
1158890309 18:61866221-61866243 GAAGCAGTAGGTTGGATGGTTGG - Intronic
1160603458 18:80032252-80032274 AAACCAGCAGGTGGGAAGAAAGG + Intronic
1160765646 19:806380-806402 AAAGCAGGAGGTGAGATGAGCGG - Intronic
1162077917 19:8200965-8200987 TCCCCAGTAGGTGGGATCATAGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1165406697 19:35635190-35635212 AACCGAGTAGCTGGGATTATAGG - Intronic
1165913284 19:39242946-39242968 CCACCAGTAGCTGGGATTATGGG + Intergenic
1168072683 19:53961639-53961661 AAACCAGTGGGTCTGATGTTGGG + Intergenic
1168544115 19:57235868-57235890 TCACAAGTAGGTGGGATTATAGG - Intergenic
925856498 2:8134441-8134463 ACACCAGTGGGTGGGGTGGTGGG - Intergenic
926890960 2:17638519-17638541 CAGCCAGTAAGTGGCATGATTGG + Intronic
927454946 2:23241325-23241347 AGAGCAGAAGGTGGGATGAGAGG + Intergenic
927704786 2:25290443-25290465 CAACCAGTAGCTGGGATTACAGG + Intronic
929054423 2:37863476-37863498 AAATCAGAAGGGAGGATGATTGG - Intergenic
929675339 2:43921166-43921188 ACCCCAGTAGTTGGGATTATAGG - Intronic
930203038 2:48562759-48562781 GAACCTGTAGGTGGCAAGATGGG - Intronic
931017600 2:58002490-58002512 AAATCAGTATGTGTGAAGATAGG + Intronic
932212348 2:69943164-69943186 AAACCAGTAGGTGGGATGATGGG - Intergenic
933627763 2:84621013-84621035 AAAGCAATAGGTGGGGTGAAAGG + Intronic
934747330 2:96767946-96767968 ACCCCAGTAGCTGGGATTATAGG - Intronic
934866213 2:97814988-97815010 AAAAGGGTAAGTGGGATGATAGG - Intronic
936820105 2:116510258-116510280 AAACCAGTAGATGGCATCTTTGG + Intergenic
942076335 2:172359964-172359986 AAACCAGAAGGAGGTATTATAGG - Intergenic
942290265 2:174462432-174462454 AAACAAGTAGCTGGGATTACAGG + Intronic
943600412 2:189912415-189912437 ACCCCAGTAGCTGGGATTATAGG - Intronic
943912381 2:193584802-193584824 ACACCAGTAGGTGGCAATATGGG - Intergenic
944432451 2:199647771-199647793 TTACCAGTAGATGTGATGATGGG - Intergenic
944907371 2:204276018-204276040 AAAGCAGTAGGTGGCTGGATAGG - Intergenic
946031363 2:216707728-216707750 AAACCAATAGGATGGATGAATGG - Intergenic
947647841 2:231757419-231757441 TCCCCAGTAGGTGGGATTATAGG + Intronic
948202174 2:236137083-236137105 ACACCACTAGCAGGGATGATGGG + Intergenic
1168752893 20:296277-296299 ATACCAGCAGTTGGGATGAAGGG + Intergenic
1170676014 20:18481760-18481782 AAACCTGTGGGAGGGATGATTGG - Exonic
1171126965 20:22610892-22610914 ATACCAGGAGGTGGGATAATTGG + Intergenic
1172154120 20:32811549-32811571 CACCCAGTAGCTGGGATGACAGG - Intergenic
1173092151 20:39983301-39983323 AACCCATTAGGTGGGAAGAAGGG + Intergenic
1173289074 20:41698636-41698658 AAACCAGGAGGCAGGATCATTGG - Intergenic
1175557872 20:59885245-59885267 GAACAAGTAAGTGGCATGATTGG + Intronic
1177157578 21:17514152-17514174 AAATCCGTAGGTGGGATCCTAGG + Intronic
1178787072 21:35663664-35663686 AAACAAGAAGGTGGAAAGATAGG + Intronic
1182532630 22:30972311-30972333 AAACCAATATGTTGAATGATGGG + Intergenic
1184049242 22:41991923-41991945 AAAACAGTATTTGGGGTGATGGG + Intronic
1184883231 22:47325421-47325443 AAAACAGTGGCTGGGATGACTGG - Intergenic
954245511 3:49328394-49328416 AAACTAGTCGGAGGGATGGTGGG - Intronic
954268233 3:49487011-49487033 TAACCAGTAGCTGGGATTACAGG + Intronic
954732736 3:52678272-52678294 AATCAAGTAGCTGGGATTATAGG + Intronic
955564279 3:60226997-60227019 AAACTAGCAGTTAGGATGATGGG + Intronic
958880751 3:99666071-99666093 AAACCTGTAGGTGTGATGTCTGG + Intronic
959366212 3:105461137-105461159 AAACCAGGATGGGGGCTGATAGG + Intronic
961859139 3:129900697-129900719 TCCCCAGTAGGTGGGATTATAGG - Intergenic
963227467 3:142876896-142876918 ATACCAGGAGGTGTGGTGATTGG + Intronic
965163085 3:165160294-165160316 AAACAAGTATGTGGGAAAATTGG + Intergenic
970335838 4:15041215-15041237 AGACTAGTAGATGGGATGAGAGG + Intronic
973775632 4:54238846-54238868 AGACCAGTAGCTGGGACTATAGG - Intronic
975136447 4:70879151-70879173 AAACCAGTAGCTGGGACTACAGG - Intergenic
975812479 4:78183221-78183243 AGAGTAGTAGGTGGAATGATGGG + Intronic
975816507 4:78222607-78222629 CAAACAGTAGGTGGGATGGGTGG + Intronic
976065113 4:81177991-81178013 ACACCATGAAGTGGGATGATAGG + Intronic
981547404 4:145908439-145908461 AAACCAGAAGGTTGGTTGGTAGG - Intronic
981594122 4:146399947-146399969 AAACCACAGGGTTGGATGATTGG + Intronic
982656802 4:158160286-158160308 AAAACAGTAGGTGGGGAGGTAGG + Intronic
987379433 5:17271243-17271265 TCCCCAGTAGCTGGGATGATAGG + Intronic
988879438 5:35484977-35484999 ATACCAGGAGGTGGGATTATTGG + Intergenic
989435991 5:41414324-41414346 TCACCAGTAGCTGGGATTATAGG + Intronic
989636547 5:43542050-43542072 TCCCCAGTAGCTGGGATGATGGG - Intronic
990688713 5:58337842-58337864 ACACTGGTAGGTGGGAAGATGGG + Intergenic
991029503 5:62068126-62068148 AAAGGAGAAGGTGGTATGATTGG + Intergenic
991453370 5:66776858-66776880 ACAGCAGTGGGTGGTATGATGGG + Intronic
995408252 5:111826656-111826678 ACACCAGTAGCTGGGATTATAGG + Intronic
996151664 5:120044659-120044681 ATACCAGAAGGTGGGATCATTGG - Intergenic
996700535 5:126446273-126446295 AAACCAGTAGGAGGTAGGAGTGG + Intronic
998860600 5:146439958-146439980 ATATCAGAAGGTGGGATCATTGG - Intergenic
999110497 5:149116267-149116289 ATACCAGTAGCTGTGCTGATAGG - Intergenic
1000162167 5:158608748-158608770 AAATCAGAAAGTGGGATTATAGG - Intergenic
1002051370 5:176573521-176573543 TCCCCAGTAGGTGGGATTATAGG - Intronic
1002097294 5:176839096-176839118 GCATCAGTAGCTGGGATGATAGG - Intronic
1003238425 6:4319481-4319503 AAACCAACAGGTGGCATGCTTGG + Intergenic
1006233894 6:32610359-32610381 CAATCAGCAGGTGGGATCATGGG - Intergenic
1007391510 6:41552069-41552091 AAACCAGGGGGTGGGAGGTTGGG + Intronic
1007636952 6:43305424-43305446 AGACCAGTGGGTTGGAGGATGGG - Exonic
1009559198 6:65217757-65217779 AAACCAGAAGCTGGAAAGATAGG + Intronic
1012367827 6:98463992-98464014 AAGCCAGTAAGTGGGATTTTAGG - Intergenic
1014920570 6:127210788-127210810 AAAATAGCAGGTGTGATGATAGG + Intergenic
1014949411 6:127537635-127537657 TAACGAGTAGCTGGGATTATAGG + Intronic
1016500131 6:144711188-144711210 CAACAAGTAGCTGAGATGATAGG - Intronic
1016976867 6:149817343-149817365 AATCCAGTAGGTCGGAAAATGGG + Intergenic
1017755462 6:157525654-157525676 AAACCAGGAGGAGGGATCAATGG + Intronic
1020138627 7:5600047-5600069 AAACCTGGAGGTGGGATGTTTGG - Intronic
1020308107 7:6850238-6850260 AAACCAGGAGGGGGGAAGAGGGG + Intergenic
1022442470 7:30445633-30445655 ACACGAGTAGCTGGGATTATAGG - Intronic
1023449240 7:40264878-40264900 AAACAACTTGGTGTGATGATGGG - Intronic
1023958694 7:44908954-44908976 AACCAAGTAGCTGGGATTATAGG + Intergenic
1027306085 7:76898782-76898804 AACCCAGTAGCTGGGATGACGGG - Intergenic
1027490199 7:78814187-78814209 ACTCCAGGAGGTGGGATCATGGG - Intronic
1032278176 7:130478080-130478102 AAATGAGTAGGTGGGACTATAGG - Intergenic
1036697835 8:10990294-10990316 AGACCAGCAGGTGGGAAGTTGGG + Intronic
1037076748 8:14729959-14729981 TACCCAGTAGGTGGGATTAGAGG - Intronic
1039507036 8:38059626-38059648 AAAAGAGTAGCTGGGATTATAGG - Intronic
1039730114 8:40265737-40265759 TCACCAGTAGCTGGGATTATGGG - Intergenic
1040309345 8:46228710-46228732 AAACCAGTAGAGGGGAGAATTGG + Intergenic
1040579059 8:48680933-48680955 AAACATGTAGGTAGGAGGATCGG - Intergenic
1040744724 8:50627632-50627654 AAACCTGAAGGTGGGGTCATGGG - Intronic
1040913054 8:52541000-52541022 AAAAAAGTAGCTGGGATGACTGG + Intronic
1042973081 8:74432552-74432574 CATCCAGAAGATGGGATGATAGG - Intronic
1044303385 8:90610400-90610422 AAACCAGTTGGTTGAATGAATGG + Intergenic
1045518206 8:102879713-102879735 ACACCAAAAGGTGGGATCATTGG - Intronic
1045825026 8:106386924-106386946 AAATCAGTAAGTTAGATGATTGG + Intronic
1048333391 8:133486180-133486202 ACACCAGTAGGTGTGAAGTTGGG - Intronic
1050552634 9:6761131-6761153 AACCCAGTAGCTGGGATTACAGG + Intronic
1051516507 9:17935958-17935980 AAACTGGTAGGTGAGAGGATCGG - Intergenic
1052235330 9:26206497-26206519 AAAACAGTTGGTGGTATTATGGG - Intergenic
1056676381 9:88680066-88680088 AATCCAGCTGCTGGGATGATGGG + Intergenic
1057878858 9:98778144-98778166 AACCCAGGAGGTAGGATGAAGGG + Intronic
1058757094 9:108093054-108093076 ATACCAGTAGGTGAGATCACTGG + Intergenic
1060554044 9:124499235-124499257 AAGCCACTAGGTGGGAAGACTGG + Intronic
1060669428 9:125456464-125456486 AAAGCAGAAGGTAGGATCATTGG - Intronic
1061654043 9:132074512-132074534 AAACCAGTAAGTGCGTTAATGGG - Intronic
1185554262 X:1007998-1008020 CCACCAGTAGCTGGGATGACAGG + Intergenic
1186337495 X:8606395-8606417 AAACTGGTAGGTGGGAGGAGTGG + Intronic
1188204764 X:27342116-27342138 ACCCAAGTAGGTGGGATGATAGG + Intergenic
1188512642 X:30953197-30953219 TACCCAGTAGCTGGGATTATAGG + Intronic
1190756107 X:53403549-53403571 GAAGCGGTAGGTGGGAGGATTGG - Exonic
1193334035 X:80266229-80266251 TACCCAGTAGGTGGGCTGCTGGG + Intergenic
1195065838 X:101237389-101237411 AAACCAGTAGGTAGAACCATGGG - Intronic
1195636458 X:107121298-107121320 AATCCACTAGGTGGGATGAGTGG + Intergenic
1196127866 X:112118622-112118644 ATACCAGGAGATGGGATCATGGG + Intergenic
1197370600 X:125621608-125621630 GAACCAGAGGGGGGGATGATGGG + Intergenic
1197896073 X:131317171-131317193 AAACCAGTCTTTGGGATGGTGGG + Intronic
1197929444 X:131679563-131679585 TCCCCAGTAGGTGGGATTATAGG + Intergenic
1201704570 Y:16922081-16922103 TACCTAGTAGGTGGGTTGATAGG - Intergenic