ID: 932214493

View in Genome Browser
Species Human (GRCh38)
Location 2:69958240-69958262
Sequence GACCATGTGGTGCTTCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932214493_932214495 -10 Left 932214493 2:69958240-69958262 CCAGTAAGAAGCACCACATGGTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 932214495 2:69958253-69958275 CCACATGGTCCCTTCCTCCATGG 0: 1
1: 0
2: 2
3: 28
4: 357
932214493_932214496 -9 Left 932214493 2:69958240-69958262 CCAGTAAGAAGCACCACATGGTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 932214496 2:69958254-69958276 CACATGGTCCCTTCCTCCATGGG 0: 1
1: 0
2: 0
3: 22
4: 209
932214493_932214498 -7 Left 932214493 2:69958240-69958262 CCAGTAAGAAGCACCACATGGTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 932214498 2:69958256-69958278 CATGGTCCCTTCCTCCATGGGGG 0: 1
1: 0
2: 3
3: 22
4: 228
932214493_932214497 -8 Left 932214493 2:69958240-69958262 CCAGTAAGAAGCACCACATGGTC 0: 1
1: 0
2: 0
3: 4
4: 110
Right 932214497 2:69958255-69958277 ACATGGTCCCTTCCTCCATGGGG 0: 1
1: 0
2: 4
3: 37
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932214493 Original CRISPR GACCATGTGGTGCTTCTTAC TGG (reversed) Intergenic
902566441 1:17314676-17314698 GACCTTGGGCTGCTTCTGACAGG - Intronic
903447849 1:23433638-23433660 CTCCTTGTGGTGCTTCTTCCTGG + Exonic
907691866 1:56676768-56676790 ACCCATGTGGTGCATCTTACCGG + Intronic
911068424 1:93812652-93812674 GACCCTGTGGTGCCTCTAGCTGG - Intronic
916255078 1:162779036-162779058 GACCATGTGGTTTTTCTTCTGGG + Intronic
918450124 1:184649855-184649877 GACAATGAGGTGCTTCTTCAAGG - Intergenic
922314489 1:224430901-224430923 GACCATTTGGCCCTGCTTACTGG - Intronic
1063289054 10:4722334-4722356 AAACATCTGGTGCTTATTACTGG + Intergenic
1069758377 10:70788788-70788810 GACCAAGTGGGGCTTATTCCAGG - Intergenic
1072335600 10:94395515-94395537 GAACTTGTGGTGCTTTTTCCCGG - Intergenic
1072551830 10:96484208-96484230 AACCATGTGCTGGGTCTTACAGG - Intronic
1077528746 11:3085077-3085099 GACCTTATGGTGCTTGTTGCTGG - Intergenic
1078927121 11:15885072-15885094 GAGCAGGGGCTGCTTCTTACAGG - Intergenic
1081223039 11:40486209-40486231 GACCATATGGGCCTTCTGACAGG + Intronic
1082220284 11:49626902-49626924 GACCAAGTGGTGTTTATTCCAGG - Intergenic
1084943603 11:72627194-72627216 GCCCATGTGGTGCTTGGTATAGG - Intronic
1086629376 11:88998245-88998267 GACCAAGTGGTGTTTATTCCAGG + Intronic
1089943957 11:122447996-122448018 GACCATGTGGTGATTCCTCAAGG - Intergenic
1090910129 11:131111402-131111424 GAACTTGTGGTGCTTTTTCCAGG - Intergenic
1091897750 12:4118795-4118817 GACCACATGGTGCTTCTGGCAGG + Intergenic
1092787743 12:12043633-12043655 GACCAAGTGGGGCTTATTATAGG + Intergenic
1092982491 12:13810522-13810544 GACCATGTGGTCATTCTAAAGGG + Intronic
1097154627 12:57003803-57003825 GACCATGTGGACCTGCTGACGGG - Exonic
1098352405 12:69577537-69577559 GACCATGTGATCCTTCTTTTTGG + Exonic
1103703758 12:122860689-122860711 GACAAGGTGGTGCTTCACACGGG + Exonic
1105238338 13:18583481-18583503 GATAATGTGGTCCTTCTTAGAGG - Intergenic
1114321505 14:21550531-21550553 GCCCATGTGATGCTTTTTAAGGG + Intergenic
1122392605 14:101400345-101400367 GACCTGGCGGTGCTTCTTCCAGG - Intergenic
1122582688 14:102781155-102781177 GGCCATCTGGTCCCTCTTACAGG + Intronic
1123965120 15:25448213-25448235 GACCCTGTGTGTCTTCTTACAGG - Intergenic
1125253594 15:37735741-37735763 CACCATGGTGTGCTACTTACTGG - Intergenic
1126992567 15:54398288-54398310 GACCATGTGGAGATTGTTCCAGG - Intronic
1127182394 15:56435946-56435968 GACCAAGTAGTGTTTATTACAGG + Intronic
1127188269 15:56503804-56503826 GATCATGTGGTTTTTCTTCCTGG - Intergenic
1136147175 16:28322380-28322402 ACCCATGTGGTGCTTATTGCGGG - Exonic
1140719555 16:77758968-77758990 GACCCTGTGGGGTCTCTTACAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1150950968 17:69801829-69801851 GAACTTGTGGTGCTTTTTCCAGG + Intergenic
1152930164 17:83105229-83105251 GACCAGGAGGAGCTTCTTAGCGG + Intergenic
1154511729 18:15111307-15111329 GATAATGTGGTCCTTCTTAGAGG - Intergenic
1155985368 18:32225479-32225501 GACCAAGTGTGGCTTCTTCCAGG - Intronic
1156529582 18:37802154-37802176 AACCATGTGGTTCTTGTTATTGG + Intergenic
1156850357 18:41718784-41718806 GACCTTGTGCTGCATTTTACTGG - Intergenic
1158993402 18:62892898-62892920 GACCATGTGGATCTTCTGAAAGG + Intronic
1161601960 19:5189728-5189750 GCCCAGGTGGTGCTTCTGCCAGG + Intronic
1165036719 19:33039062-33039084 GTCAATGTGGTGCTTATTCCTGG - Intronic
1165966281 19:39583656-39583678 CAACAAGTGTTGCTTCTTACTGG + Intergenic
1165977897 19:39693300-39693322 CAACAAGTGTTGCTTCTTACTGG + Intergenic
930612021 2:53554265-53554287 GAACTTGTGGTGCTTTTTTCTGG + Intronic
930729025 2:54709717-54709739 GAACTTGTGGTGCTTTTTTCGGG + Intergenic
931005812 2:57849585-57849607 GAGCCTGTGGTGCTTTTTTCGGG - Intergenic
932214493 2:69958240-69958262 GACCATGTGGTGCTTCTTACTGG - Intergenic
936028688 2:109053990-109054012 GACCAGGTGCTGCATCTTTCAGG + Intergenic
936599167 2:113878858-113878880 GTCCATGTGGTTCTTTTTAGTGG + Intergenic
938511302 2:131948070-131948092 GATAATGTGGTCCTTCTTAGAGG - Intergenic
938663835 2:133513450-133513472 GTCCATGTGGTGCATCCTCCAGG + Intronic
938858753 2:135343564-135343586 GACCATGTGGTGTTATTTAAAGG + Intronic
939233102 2:139455523-139455545 CACCATTTGGTTCTTCTTAGAGG + Intergenic
940761729 2:157745966-157745988 GACCAAGTTGTGCCTCTTATGGG - Intronic
941539153 2:166760761-166760783 GATCATGTGGTGATTATTCCAGG - Intergenic
941981948 2:171468042-171468064 GACCATGTGGTGTTTCCTAAAGG + Intronic
942030220 2:171951731-171951753 GACCAGTTAGTGCTTCTTAATGG + Intronic
946277701 2:218643510-218643532 GTCAAGGTGGTGCTTCTTAGGGG + Exonic
1170254364 20:14323415-14323437 GAACATGTGGTGGTTCCTGCAGG - Exonic
1172310518 20:33914625-33914647 GACCATGGGTTGCTTCTGACTGG + Intergenic
1172895043 20:38294486-38294508 GACCTTGAGGGGCATCTTACAGG - Intronic
1175959906 20:62630789-62630811 GAACTTGTGGTGCTTTTTCCAGG - Intergenic
1176782327 21:13211745-13211767 GATAATGTGGTCCTTCTTAGAGG - Intergenic
1177290222 21:19101793-19101815 GACCTTGTACTTCTTCTTACTGG + Intergenic
1177980172 21:27903851-27903873 GATAATGTGGTCCTTCTTAGAGG + Intergenic
1178200843 21:30403812-30403834 GCCCATGTGTTGCTGCTAACAGG + Intronic
1180015420 21:45079488-45079510 GAACATGTGGAGCTTGTGACTGG + Intronic
1183933785 22:41250338-41250360 GGACATGTGGTGCCTCTTCCCGG - Intronic
959135436 3:102413254-102413276 GACCATGTTGTGTTTGTTTCTGG + Intronic
972106461 4:35494469-35494491 GAACATATGGTGCTTTTTCCAGG + Intergenic
978229908 4:106385869-106385891 GAACGTGTGGTGCCTTTTACAGG - Intergenic
978961193 4:114681379-114681401 GTGCATATGGTGCTTCTTATGGG + Intergenic
979662377 4:123272157-123272179 GACACTGTTGTGCTTCTGACTGG + Intronic
988131579 5:27113593-27113615 GATCATGTGGAGATTCTTAAAGG + Intronic
989624245 5:43414379-43414401 GAACATGTGGAGGTTCTTAGAGG + Intergenic
990233145 5:53737036-53737058 GACAATGTGGTGCTTCCTCAAGG + Intergenic
994916216 5:105982893-105982915 GAACATATGGTGCTTTTTCCAGG + Intergenic
996345380 5:122482674-122482696 GACCATGTGGGGTTTATTCCAGG + Intergenic
997364125 5:133314564-133314586 AACCATGTGGTGCCTCTTGGTGG + Intronic
1000732289 5:164850355-164850377 GACCAAGTGGTATTTATTACAGG - Intergenic
1008610810 6:53183116-53183138 GACCAGGTGGGGCTGCCTACTGG - Intergenic
1010395651 6:75389126-75389148 AATCATGTGGTGTTTGTTACTGG + Intronic
1014201516 6:118614031-118614053 GACCAAGTGGCGCTTATTCCAGG + Intronic
1014393424 6:120893801-120893823 GATCTTGTGGAGCATCTTACTGG + Intergenic
1019941614 7:4296561-4296583 GACCATGTGGTGATTCCTCAAGG - Intergenic
1021560029 7:21960532-21960554 AACAATGTAGTGCTTCTTACAGG + Intergenic
1021818264 7:24470222-24470244 GACAATGTGAGGCTTATTACAGG - Intergenic
1023196044 7:37640785-37640807 GATCTTGTGGAGCATCTTACTGG + Intergenic
1023637939 7:42231381-42231403 GACCATGGGGTAATTTTTACTGG - Intronic
1024116407 7:46197793-46197815 GGCCATGTGGTGAGTCTTCCAGG + Intergenic
1027768213 7:82373348-82373370 GACCGTGTGGTTTTTCTTAAAGG - Intronic
1027948173 7:84778054-84778076 GACCATGTGGTGATTCCTCAAGG + Intergenic
1030253056 7:107470240-107470262 GAACATGTAGTGCTGCTTAGAGG - Exonic
1034215906 7:149405390-149405412 AATCAAGTGGTGCTTCTTCCAGG - Intergenic
1036915440 8:12799690-12799712 GAACTTGTGGTGCTTTTTCCGGG - Intergenic
1037339420 8:17827796-17827818 GACCAAGTGGGGTTTCTTCCAGG + Intergenic
1042626631 8:70765151-70765173 GACAATGTGGTGATTCTTCAAGG - Intronic
1043735004 8:83730899-83730921 GAACTTGTGGTGCTTTTTCCAGG - Intergenic
1043750310 8:83926380-83926402 GAACTTGTGGTGCTTCTTCTGGG - Intergenic
1044050526 8:87497161-87497183 GACCAAGTGGTATTTATTACAGG - Intronic
1046177896 8:110603211-110603233 GACCATGTAATGCTTATTCCAGG - Intergenic
1046963532 8:120136518-120136540 GACCAAGTAGAGCTTATTACAGG - Intronic
1047349390 8:124059185-124059207 GAGCAGGTGGTTCTCCTTACTGG - Intronic
1049422639 8:142523754-142523776 GAGAATGTGGGGCTGCTTACTGG + Intronic
1055748496 9:79477491-79477513 GAACATGTGGTCTTCCTTACAGG - Intergenic
1057375714 9:94520781-94520803 GACCAAGTGGTGTTTATTCCAGG - Intergenic
1057510818 9:95678402-95678424 GAACTTGTGGTGCTTTTTCCAGG - Intergenic
1058582427 9:106472873-106472895 GACCATGTGGTGATTCCTCAAGG - Intergenic
1191073227 X:56424618-56424640 GACAGTGTGGTGATTCTTAAAGG - Intergenic
1201055683 Y:9988188-9988210 GACCATGTGGTGATTCCTCAAGG + Intergenic